NLRC4^V341A/V341A mice were generated by Cyagen Biosciences by CRISPR/Cas9-mediated genome editing of the V341-encoding GTG codon to an A341-encoding GCC codon in exon 4 of the endogenous NLRC4 gene of C57BL/6 mice (see also Figure 1 ). Briefly, C57BL/6 zygotes were co-injected with a vector encoding Cas9 as well as the gRNA 5’-CAGGTGATCACCACGAAGAG-3’ and with the 5’-tgtgggcccaaatccaggagtccaggtgcctgagaaatctgatgaagacccctctcttcGCCgtgatcacctgtgcaattcagatgggcagacaggaattccaagctcacacccaaaccatg-3’oligo donor for homology-directed repair. Pups were genotyped for the mutated GCC codon by sequencing a 361bp PCR amplicon around the mutated codon. Two founder animals carrying the correct GCC mutation and no other mutations within the amplicon were crossed to C57BL/6J mice and then intercrossed to obtain homozygous Nlrc4^V341A/V341A mice. Upon observing that Nlrc4^V341A/V341A offspring from both founders were born in Mendelian ratios and appeared healthy, all further analyses were performed on progeny from one founder animal. Il18bp^{tm1.1(KOMP)Vlcg} (IL-18BP^-/-) mice were generated by the Knockout Mouse Project Repository (University of California, Davis, Davis, CA) on C57BL/6N background by the Velocigene approach, in which the entire coding region of the Il18bp gene was replaced by a LacZ gene and a LoxP-flanked Neomycin cassette (12). Specific pathogen free (SPF) mice were housed in individually ventilated cages in the animal facility of the IRC-VIB. Germfree (GF) Nlrc4^V341A/V341A mice were generated by transfer of Nlrc4^V341A/+ embryo’s in GF foster mothers that had been mated with GF vasectomized males, after which the resulting GF Nlrc4^V341A/+ mice were intercrossed to generate GF Nlrc4^+/+ and Nlrc4^V341A/V341A littermates. GF mice were generated at the Axenic/Gnoto Facility of the Instituto Gulbenkian de Ciência (Lisbon, Portugal) in the context of an INFRAFRONTIER2020 project, and were then transfered to a GF facility at Ghent University where they were housed in positive-pressure flexible film isolators (North Kent Plastics). Food and water were provided ad libitum. All animal experiments were performed according to institutionally approved protocols according to national (Belgian Laws 14/08/1986 and 22/12/2003, Belgian Royal Decree 06/04/2010) and European (EU Directives 2010/63/EU, 86/609/EEG) animal regulations. Animal protocols were reviewed and approved by the Ethical Committee Animal Experimentation VIB site Ghent - Ghent University - Faculty of Sciences (permit number LA1400091) with approval IDs 2018-032 and 2019-072. All necessary efforts were made to minimize suffering of the animals.

Age- and sex-matched mice were infected by oral gavage with 10⁴ or 10⁵ CFU of the SL1344 S. Typhimurium strain administered in a 100 μl inoculum in the logarithmic phase of proliferation after starvation of 4h. Overall susceptibility to the infection was evaluated by survival.

Age- and sex-matched mice were infected by oral gavage with 5 x 10⁹ CFU of the nalidixic acid (NAL) resistant ICC169 C. rodentium strain administered in a 200 μl inoculum in the logarithmic phase of proliferation, as described (13). Enumeration of C. rodentium loads was performed by plating stool samples and colon tissues collected at the indicated time points after infection, on selective Luria-Bertani (LB) agar containing 50 μg/ml NAL. Colony forming units (CFUs) were normalized to the weight of the sample. Mice that did not surpass the threshold of 1 x 10⁵ CFU/g feces at 7 days post-infection (dpi) were considered not successfully infected and were removed from the experiment.

Primary macrophages were generated from bone marrow cells flushed from femur and tibia. Cells were differentiated to bone marrow derived macrophages (BMDMs) by culturing them in Iscove’s modified Dulbecco’s medium (IMDM, Lonza) with 10% (v/v) heat-inactivated FBS, 30% (v/v) L929 cell-conditioned medium, 1% Gibco non-essential amino acids, penicillin (100 U/ml) and streptomycin (100 mg/ml) for 6 days in 37°C in the presence of 5% CO₂. After differentiation, medium was aspirated and the cells were scraped in IMDM supplemented with 10% FBS and 1% Gibco non-essential amino acids. For specific experiments, 10⁶ cells were seeded in 0.5 ml culture medium per well in 12-well plates and were incubated overnight at 37˚ C and 5% CO₂. On day 7, FlaTox stimulations (1 µg/ml, 2h) and S. Typhimurium infections (MOI1, 3h) were performed on LPS-primed (1 µg/ml, 5h) or unprimed BMDMs. At 2h post S. Typhimurium infection 100 µg/ml gentamycin was added followed by 1h incubation. After incubation at 37°C and 5% CO₂ samples were collected.

Lytic cell death was evaluated by detection of LDH released in the cell culture supernatant by LDH assay (Promega) according to manufacturer’s instructions. The data were plotted as percentage of total cell death as determined by a 100% cell death control from Triton X-100 treated wells.

Tissue samples were weighed and were homogenized in PBS with protease inhibitors, after which lysis was completed by addition of lysis buffer (20 mM Tris HCl (pH 7.4), 200 mM NaCl, 1% Nonidet P-40) and incubation for 20 minutes on ice. Full speed centrifugation for 30 minutes cleared the homogenate and supernatant was used for further analysis. Mouse cytokines in cell culture supernatants, serum and tissue homogenates were determined by magnetic bead-based multiplex assay using Luminex technology (Bio-Rad, Hercules, CA, USA) according to the manufacturer’s instructions. Cytokines from tissue homogenates were normalized to weight of tissue, while cytokines from cell culture supernatants and serum were expressed as concentration per ml of cell culture medium or serum.

Cells and culture supernatants, colon or ileum intestinal epithelial cells (IECs), or whole colon or ileum homogenates, were incubated with cell lysis buffer (20 mM Tris HCl (pH 7.4), 200 mM NaCl, 1% Nonidet P-40) and denatured in Laemlli buffer by boiling for 10 min. Proteins were separated by SDS-PAGE electrophoresis (Thermo Scientific) after which proteins were transferred to membranes using turbo (7 min) blotting. Blocking and antibody incubation were performed in PBS supplemented with 0.05% or 0.2% Tween20 (vol/vol) and 3% non-fat dry milk. The membranes were incubated overnight at 4˚ C with primary antibodies against caspase-1 (1:1000; Adipogen, AG-20B-0042-C100), IL-1β (1:2000; GeneTex, GTX74034), GSDMD (1:1000, Abcam, ab209845) and IL-18 (1:1000, Biovision, 5180R-100). After washing, membranes were incubated with HRP-conjugated anti-mouse, anti-rabbit or anti-goat antibodies (1:5000; Jackson ImmunoResearch Laboratories, 115-035-146, 111-035-144 and 305-035-003) or were incubated with the directly labeled primary antibody β-Actin-HRP (1:10000; Santa Cruz) for up to 3h. Proteins of interest were detected by the enhanced SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific).

Colon and ileum tissues were fixed in 4% paraformaldehyde, embedded in paraffin, and cut in 4 µm sections. For histopathological analysis hematoxylin and eosin staining were performed according to standard protocols. Histological crypt length quantifications were performed in a blinded fashion using Image-J-win4. Cell death was evaluated on paraffin sections by TUNEL staining (in situ cell death detection kit, TMR red, Roche) performed according to the manufacturer’s instructions. For immunohistochemical Ki67 staining paraffin sections were rehydrated and heat-induced antigen retrieval was performed in Antigen Unmasking Solution, Citric Acid Based (Vector Laboratories). Endogenous peroxidase activity was blocked by incubating the slides in methanol containing 3% H₂O₂. Sections were then incubated overnight with primary antibody for Ki67 (1/1000, Cell Signalling, D3B5) in PBS containing 10% goat serum. Biotinylated secondary antibody was purchased from Dako (E0432). Stainings were visualized with Vectastain ELITE ABC Kit and DAB substrate (ImmPACT DAB Substrate kit, Peroxidase, Vector Laboratories), after which sections were counterstained with hematoxylin. Incubation times with DAB substrate were equal for all samples. For AB-PAS staining paraffin sections were rehydrated, stained for 20 min with Alcian blue. This was followed by 15 min treatment with 1% periodic acid and 15 min treatment with Shiff’s reagent. After washing with running tap water for 10 min, nuclei were stained with Mayer’s hematoxylin for 20 sec. Finally, sections were dehydrated and mounted with depex. For immunofluorescent Lysozyme staining paraffin sections were rehydrated and heat-induced antigen retrieval was performed in Antigen Unmasking Solution, Citric Acid Based (Vector Laboratories). Endogenous peroxidase activity was blocked by incubating the slides in methanol containing 3% H₂O₂. Sections were incubated overnight with anti-lysozyme primary antibody (1/700, DAKO, A0099) in PBS containing 0.2% goat serum, 0.5% fish skin gelatin and 2% BSA, followed by one-hour incubation with a secondary antibody labeled with Dylight-488 (1/500, Thermofisher, 35553) and nuclei staining with DAPI (1/1000, Thermofisher, D21490) for 10min in Prolong Gold anti-fade. All pictures were taken with a high content screening microscope (Zeiss AxioScan) at the same exposure and intensity settings.

Ileum and colon were dissected and flushed with PBS to remove fecal content. The tissue was turned inside-out, washed with PBS and incubated in HBSS containing 2 mM EDTA for 30 min at 37°C shaking. Afterwards tissue was removed and cells were collected by centrifugation at 3000 rpm for 5 min, followed by washing of the cells with PBS by centrifugation at 5000 rpm for 5 min. Cells were lysed in cell lysis buffer (20 mM Tris HCl (pH 7.4), 200 mM NaCl, 1% Nonidet P-40) for Western Blot analysis or kept in TRIsure (Bioline) until further isolation of RNA.

Total RNA was isolated using TRIsure reagent (Bioline) and the RNeasy^® Mini Kit (QIAGEN) according to manufacturer’s instructions. cDNA was synthesized using the iScript gDNA clear cDNA Synthesis kit (Biorad) according to the manufacturer’s instructions. cDNA was amplified on quantitative PCR in a total volume of 5 µl with SensiFAST SYBR^® No-ROX Kit (Bioline) and specific IL-18 primers (Fwd ACTTTGGCCGACTTCACTGTA, Rev CTTCACAGAGAGGGTCACAGC) on a LightCycler 480 (Roche). The reactions were performed in triplicates. Primer sequences reference genes: Gapdh (Fwd TGAAGCAGGCATCTGAGGG, Rev CGAAGGTGGAAGAGTGGGAG), Hprt1 (Fwd AGTGTTGGATACAGGCCAGAC, Rev CGTGATTCAAATCCCTGAAGT), Ubc (Fwd AGGTCAAACAGGAAGACAGACGTA, Rev TCACACCCAAGAACAAGCACA).

All statistical analyses were performed using GraphPad Prism version 9.0. For mouse survival curves, statistical significance was determined by log-rank Mantel-Cox test. Other data were analyzed by applying either unpaired two-sided student t-tests or unpaired two-sided Mann-Whitney tests in case of not normal distribution of the values. Data are shown as means of biological replicates with SD as indicated in figure legends. Statistical results are indicated as ns not significant; *p < 0.05; **p < 0.01 or ***p < 0.001.

The V341A mutation of human NLRC4 was reported to cause AIFEC characterized by neonatal-onset enterocolitis, periodic fevers, and fatal or near-fatal episodes of autoinflammation in four individuals from two unrelated pedigrees (4, 5). To better understand the pathogenic mechanisms involved in these NLRC4^V341A-expressing AIFEC patients, we created mice expressing a V341A variant of the murine NLRC4 protein, as the region around the V341 residue is conserved in humans and mice ( Figure 1A ). For this purpose, we introduced a codon encoding the V341A substitution in the endogenous Nlrc4 gene of C57BL/6 mice by CRISPR/Cas9-mediated genome editing ( Figures 1B, C ). Both NLRC4^V341A/WT and NLRC4^V341A/V341A mice were born in Mendelian ratios and aged indistinguishably from their NLRC4^WT/WT littermates. Therefore, to maximize potential pathologic effects of NLRC4^V341A expression, we proceeded with analyzing inflammatory parameters in homozygous NLRC4^V341A/V341A mice as compared to their NLRC4^WT/WT littermates.

AIFEC patients show chronically elevated serum IL-18 levels that are thought to originate from increased NLRC4 inflammasome activity (4–7). Therefore, to determine whether NLRC4^V341A-expressing mice displayed a similar IL-18-dominant serum signature, we measured the inflammasome-dependent IL-18 and IL-1β as well as the inflammasome-independent IL-6 and TNF cytokines in serum of NLRC4^V341A/V341A and NLRC4^WT/WT mice. NLRC4^V341A/V341A mice showed significantly higher circulating IL-18 levels than NLRC4^WT/WT littermates ( Figure 2A ), while IL-1β, IL-6 and TNF serum levels did not differ between these genotypes ( Figures 2B–D ). Thus, as observed in AIFEC patients (4–7), NLRC4^V341A expression in mice induces a specific increase in circulating IL-18 levels.

A previously described genetic mouse model expressing an NLRC4^T337S mutant showed that IL-18 production in these mice mainly originated from IECs (14). We therefore investigated whether the gastrointestinal tract was the source of increased circulating IL-18 levels in NLRC4^V341A/V341A mice. Whole tissue qPCR analyses showed no differences in pro-IL-18 mRNA expression in ileum or colon of NLRC4^V341A/V341A mice, while these analyses did show that IL-18 mRNA expression was higher in colon compared to ileum in both genotypes ( Figure 2E ). In accordance, pro-IL-18 protein was mainly detectable in colon lysates, but NLRC4^V341A/V341A mice did not show different pro-IL-18 levels compared to NLRC4^WT/WT mice when analyzing complete ileum or colon lysates ( Figure 2F ). In addition, these protein analyses on complete tissue lysates only detected low levels of mature IL-18 in either ileum or colon, and did not reveal clear effects of NLRC4^V341A expression on IL-18 maturation ( Figure 2F ). Next, given their high IL-18 expression levels (14–16), we analyzed IL-18 production specifically in IECs of ileum and colon of NLRC4^V341A/V341A mice. Interestingly, whereas IECs isolated from ileum showed no differences in pro-IL-18 mRNA expression, colon IECs from NLRC4^V341A/V341A mice showed higher pro-IL-18 mRNA expression than colon IECs from NLRC4^WT/WT mice ( Figure 2G ). Accordingly, immunoblotting analyses showed that NLRC4^V341A expression increased pro-IL-18 protein levels in colon but not in ileum IECs ( Figures 2H, I ). However, these immunoblotting analyses did not allow detecting mature IL-18 in IECs. In addition, cleavage of caspase-1 to its active p20 subunit was undetectable in colon or ileum IECs of naïve NLRC4^V341A/V341A mice ( Figures 2H, I ). Overall, these observations indicate that NLRC4^V341A expression increases pro-IL-18 mRNA as well as protein levels specifically in colonic IECs, but inflammasome activation leading to IL-18 maturation could not be detected in these cells under homeostatic conditions. Therefore, although our observations suggest that NLRC4^V341A-expressing colon IECs have a higher capacity to produce mature IL-18, it remains unclear whether the elevated circulating IL-18 levels in these mice derive from the intestines.

Intestinal biopsies and autopsy specimens from NLRC4^V341A-expressing AIFEC patients showed mixed immune cell infiltration, villous blunting with tissue edema, and tissue autolysis (4, 5). Given this remarkable intestinal pathology and the increased pro-IL-18 production by colonic IECs in NLRC4^V341A/V341A mice, we performed histopathological analyses on ileum and colon of these mice. H&E staining revealed no abnormal immune cell infiltration or structural differences in both ileum or colon of NLRC4^V341A/V341A mice ( Figure 3A ). Furthermore, normal numbers of goblet cells and Paneth cells were observed in NLRC4^V341A/V341A mice as assessed by Alcian Blue-Periodic acid-Schiff (AB-PAS) staining and Lysozyme immunostaining, respectively ( Figures 3B, C ). Finally, NLRC4^V341A/V341A mice showed normal rates of intestinal epithelial proliferation ( Figure 3D ), and a TUNEL staining revealed no increased cell death in ileum or colon of NLRC4^V341A/V341A mice ( Figure 3E ). Taken together, these analyses suggest that the increased pro-IL-18 levels in colon IECs do not give rise to sufficient IL-18 activity to induce histopathological changes in the intestine of NLRC4^V341A/V341A mice under homeostatic conditions.

IL-18 Binding Protein (IL-18BP)-mediated sequestering of IL-18 prevents the mature cytokine from binding with its receptor (17–19). To investigate whether this might provide a possible explanation for the lack of intestinal inflammation in NLRC4^V341A/V341A mice, we generated NLRC4^V341A/V341A mice in an IL-18BP-deficient background. However, the absence of IL-18BP did not provoke histopathology in ileum or colon of these NLRC4^V341A/V341AIL-18BP^-/- mice ( Figure 3F ). This indicates that the absence of intestinal pathology in NLRC4^V341A/V341A mice did not result from IL-18 neutralization by IL-18BP. Overall, the above analyses show that despite their increased IL-18 circulation, naïve NLRC4^V341A/V341A mice do not display gastrointestinal pathologies even in the absence of the endogenous IL-18 antagonist IL-18BP.

As our above analyses showed that elevated IL-18 circulation in naïve NLRC4^V341A/V341A mice was not associated with gastrointestinal pathologies, we next evaluated the response of these mice to gastrointestinal infections. Indeed, NLRC4 plays important roles in host defense against a wide range of NLRC4-activating bacterial pathogens, for which the enteropathogen Salmonella Typhimurium is a prototypical example (20). To assess whether NLRC4^V341A intrinsically alters NLRC4-mediated inflammasome activation, we first evaluated NLRC4^V341A responses in bone-marrow-derived macrophages (BMDMs). For this purpose, we treated BMDMs with FlaTox to deliver flagellin to the cytosol (21, 22), and we infected BMDMs with S. Typhimurium. Upon both of these NLRC4-activating triggers, NLRC4^V341A/V341A and NLRC4^WT/WT BMDMs showed similar caspase-1, GSDMD and IL-18 cleavage ( Figure 4A ), and showed no significant differences in IL-18 secretion ( Figure 4B ). In addition, although LPS-primed NLRC4^V341A/V341A BMDMs showed a slight reduction in IL-1β cleavage compared to NLRC4^WT/WT BMDMs upon FlaTox stimulation ( Figure 4A ), FlaTox- as well as S. Typhimurium-induced IL-1β secretion was equal between these genotypes ( Figure 4C ). In line with these cytokine observations, NLRC4^V341A/V341A and NLRC4^WT/WT BMDMs died to a similar extent upon FlaTox stimulation or S. Typhimurium infection ( Figure 4D ). Notably, in each of these inflammasome activation, cytokine and cell death analyses, untreated NLRC4^V341A/V341A and NLRC4^WT/WT BMDMs showed no baseline differences ( Figures 4A–D ). Taken together, these data indicate that NLRC4^V341A expression does not alter either baseline or stimulated NLRC4 inflammasome activity in BMDMs. Furthermore, baseline as well as LPS- and S. Typhimurium-induced IL-6 production was similar between NLRC4^V341A/V341A and NLRC4^WT/WT BMDMs ( Figure 4E ), suggesting that also NF-κB transcriptional effects in BMDMs were not affected by NLRC4^V341A expression. Overall, these data show that NLRC4^V341A expression does not alter S. Typhimurium responses in BMDMs. Next, to extend these analyses to a physiological infectious context, we infected NLRC4^V341A/V341A and NLRC4^WT/WT mice orally with S. Typhimurium as a model of lethal typhoid fever caused by systemic pathogen dissemination from the gastrointestinal tract (23, 24). However, neither female nor male NLRC4^V341A/V341A mice showed differences in survival upon S. Typhimurium infection as compared to their NLRC4^WT/WT littermates ( Figures 4F, G ). This observation shows that NLRC4^V341A expression does not influence the overall host response against S. Typhimurium induced typhoid fever-like disease, which together with our BMDM observations argues against NLRC4^V341A critically altering NLRC4 inflammasome responses during S. Typhimurium infection.

As a second gastrointestinal infection model we inoculated NLRC4^V341A/V341A mice by oral gavage with C. rodentium, a murine enteropathogen used to mimic enteropathogenic and enterohaemorrhagic Escherichia coli infections in humans (25). Notably, NLRC4 inflammasome activation was demonstrated to participate in host defense against C. rodentium by acting in non-hematopoietic cells (26), thereby providing an opportunity to assess potential in vivo effects of epithelial NLRC4^V341A expression. During C. rodentium infection, NLRC4^V341A/V341A mice did not display consistent body weight changes compared to NLRC4^WT/WT littermates ( Figure 5A ), and these mice cleared the infection with similar kinetics as NLRC4^WT/WT littermates ( Figure 5B ). Furthermore, NLRC4^V341A/V341A mice did not show differences in colonic C. rodentium loads at the peak of infection [10 days post-infection (dpi)] ( Figure 5C ). In addition, whereas transmissible colonic crypt hyperplasia is a characteristic histopathological feature of C. rodentium colitis, NLRC4^V341A/V341A and NLRC4^WT/WT mice showed comparable crypt lengths at 10 dpi ( Figure 5D ). Overall, these observations indicate no obvious influence of NLRC4^V341A expression on the host defense against a gastrointestinal C. rodentium infection. However, C. rodentium further increased serum IL-18 levels in NLRC4^V341A/V341A mice and, as observed in uninfected conditions, C. rodentium-infected NLRC4^V341A/V341A mice showed higher IL-18 levels in the serum compared to their NLRC4^WT/WT littermates ( Figure 5E ). Moreover, in contrast to our observations in uninfected mice, whole colon lysates of C. rodentium-infected mice showed the presence of mature IL-18 as well as cleaved caspase-1 and GSDMD, indicating that this infection induced inflammasome activation in the colon ( Figure 5F ). Nevertheless, these Western blotting analyses showed similar levels of colonic inflammasome activation in C. rodentium-infected NLRC4^V341A/V341A and NLRC4^WT/WT mice ( Figure 5F ). An IL-18 ELISA approach to more specifically quantify mature IL-18 levels confirmed this semi-quantitative Western blotting observation, as whole colon lysates of NLRC4^V341A/V341A and NLRC4^WT/WT mice showed equal IL-18 upregulation ( Figure 5G ). Together, these observations suggest that NLRC4^V341A expression does not induce excessive inflammasome responses during a C. rodentium infection and thereby does not impact on the host response against this enteropathogen. Considering also our observations with S. Typhimurium, these C. rodentium observations argue that NLRC4^V341A expression does not influence the host response to NLRC4-triggering pathogens.

While our above observations argued against a role for pathogenic bacteria in exacerbating NLRC4^V341A-induced IL-18 production, we next aimed to investigate whether commensal bacteria were responsible for the observed IL-18 production in NLRC4^V341A/V341A mice. For this purpose, we generated germfree (GF) NLRC4^V341A/V341A mice that are devoid of microbiota. Remarkably, GF NLRC4^V341A/V341A mice showed significantly higher IL-18 levels in circulation compared to GF NLRC4^WT/WT mice, similar as observed under specific pathogen free (SPF) conditions ( Figure 6A ). This showed that systemic IL-18 elevation in NLRC4^V341A/V341A mice was independent of the microbiota. Moreover, analyzing IL-18 levels in ileum and colon of GF NLRC4^V341A/V341A mice revealed that the absence of microbiota unmasked an IL-18-inducing effect of NLRC4^V341A in the intestine. Consistent with a role for the gut microbiota in inducing basal IL-18 production (27–30), ileal and colonic IL-18 production were abolished in GF NLRC4^WT/WT mice ( Figures 6B, C ). However, GF NLRC4^V341A/V341A mice showed increased IL-18 levels in both ileum and colon ( Figures 6B, C ), thereby demonstrating that NLRC4^V341A/V341A mice produce intestinal IL-18 independently of the microbiota. Consistent with these ELISA-based mature IL-18 measurements, western blot analyses showed increased IL-18 cleavage in both the colon and ileum of GF NLRC4^V341A/V341A mice compared to GF NLRC4^WT/WT mice ( Figure 6D ). This suggests that the microbiota-independent IL-18 production in GF NLRC4^V341A/V341A mice could be associated with NLRC4^V341A-mediated inflammasome activation. However, despite the detectable elevations in intestinal mature IL-18 production in GF mice, like SPF NLRC4^V341A/V341A mice also GF NLRC4^V341A/V341A mice showed no obvious histopathology in both ileum or colon ( Figure 6E ). Taken together, these observations show that NLRC4^V341A expression increases intestinal as well as systemic IL-18 levels independently of the microbiota, while these elevated IL-18 levels do not suffice to provoke gastrointestinal pathology.