All the starting materials, reagents, and solvents were obtained from Merck and Spectrochem. The synthesis and characterization data of the sulfonic acid-functionalized silica nanospheres (SAFSNS), an environmentally benign solid acid nano-catalyst is available in our recent publication (15). The progress of the synthesis reaction of the SHG-8 molecule was monitored by using thin-layer chromatography (TLC) on silica gel plates and the spots were visualized under ultraviolet light (UV, λ254 nm). Infrared spectra were recorded on a PerkinElmer FTIR spectrophotometer. Mass spectra were measured with an electrospray (ESI-MS) on Shimadzu LCMS-spectrophotometer. ¹H and ¹³C NMR spectra of the SHG-8 molecule were recorded using the Bruker AV-400 NMR spectrometer with tetramethylsilane as an internal standard. High Resolution Mass Spectrum (HRMS) was recorded on an Agilent 6540 HD Accurate Mass QTOF/LC/MS with electrospray ionization (ESI) technique.

Human CRC SW480 and GBM cell line U87MG were obtained from ATCC (ATCC, Virginia, USA). Human monocytic cell lines THP-1 and U937 were obtained from ATCC (ATCC, Virginia, USA). Additionally, the human normal colon tissue HcoEPiC cell line was obtained from iXcells Biotechnologies (iXcells Biotechnologies, San Diego, USA). The adherent cell lines SW480 and U87MG were grown using DMEM (Gibco, Bleiswijk, Netherlands) and MEM (Gibco, Bleiswijk, Netherlands) media respectively, and supplemented with 10% FBS (Gibco, Bleiswijk, Netherlands) and 1% penicillin/streptomycin (Gibco, Bleiswijk, Netherlands). Both THP-1 and U937 suspension cell lines were grown using DMEM (Gibco, Bleiswijk, Netherlands) media respectively, and supplemented with 10% FBS (Gibco, Bleiswijk, Netherlands) and 1% penicillin/streptomycin (Gibco, Bleiswijk, Netherlands). Both cell lines were also differentiated into macrophages 48h post- phorbol 12-myristate 13-acetate (PMA) treatment (50ng/mL) for determining cytokine expression. The HcoEPiC cell line was grown using epithelial cell growth media (iXcells Biotechnologies, San Diego, USA) supplemented with 1% antibiotic-antimycotics (iXcells Biotechnologies, San Diego, USA). All cell lines were incubated at 37°C, 5% CO₂ and further experimental work was conducted upon reaching a minimum confluency of 80%. SHG-8 was solubilised in DMSO at a stock concentration of 10mM and further diluted for various assay experiments.

SW480 CRC cells (1.5x10⁴ cells/well) and HcoEPiC cells were seeded at a cellular density of 2.5x10⁴ cells/well onto a 96 well-plate and left to incubate at 37°C, 5% CO₂ overnight. Following cell adherence, all wells were treated with varying SHG-8 concentrations: 20µM, 40µM, 60µM, 80µM, 100µM and were incubated for 24h at 37°C, 5% CO₂. Following overnight incubation, all wells were treated with 20µL MTT (0.5mg/mL) and were left to incubate for a further 2h at 37°C. The MTT was then removed, and the remaining crystals were treated and solubilised with isopropanol for 30 min on a shaker. Absorbance was then recorded at 540nm using a CLARIOstar plus multi-mode microplate reader (BMG LABTECH, Aylesbury, UK). Average percentage cell viability was calculated.

In total, 4x10⁵ cells/well were seeded onto a 12-well plate and left to incubate overnight at 37°C, 5% CO₂. Following cell adherence, vertical and horizontal scratches were made for each well using a 2µL pipette tip. The wells were then washed with PBS twice. All wells were treated with SHG-8 at 10µM and 40µM concentrations alongside control treatments. Images of the wound area were taken at 0h, 24h, 48h using an Olympus CKX41 inverted microscope (Olympus Life Science Solutions, Stansted, UK) at 4x magnification. All images taken relating to the wound area were then analysed using ImageJ analysis. Plugins for wound healing analysis were obtained from a previous study (16).

In total, 1x10³ cells/well were seeded onto a 12-well plate and left to incubate overnight at 37°C, 5% CO₂. Following cell adherence, the cells were then treated in triplicate with SHG-8 concentrations at 10µM and 40µM and were placed into the incubator for 24h. Following the 24h treatment period, the treatment was replaced with fresh media and left to incubate at 37°C, 5% CO₂ for a period of 7 days. The incubation period was determined by the total number of colonies formed in the DMSO control (colonies were determined as a cluster of cells totalling larger >30 cells). Following the 7-day incubation period, all wells were fixed with 4% PFA for total of 20 min. After fixation, all wells were washed with PBS three times for 5 min each before being stained with 0.1% crystal violet (Pro-Lab Diagnostics, Wirral, UK) for 45 min on a rocker. Following staining, all wells were washed with PBS for 3 min and images of all colonies were taken at 4x and 10x magnifications using an Olympus CKX41 inverted microscope (Olympus Life Science Solutions, Stansted, UK).

SW480 cells (4x10⁵ cells/well) were seeded onto coverslips within a 12 well-plate and left to adhere overnight at 37°C, 5% CO₂. The cells were treated with: DMSO, 10µM and 40µM SHG-8 as well as 100µM cisplatin for 24h. After the incubation period, all wells were washed with PBS. The cells were then fixed with 4% PFA for a period of 15-20 minutes and kept at RT. The fixation was removed and washed again with PBS. The coverslips were removed and placed onto slides with DAPI Antifade Mounting Medium (2Bscientific, Hatfield, UK). Fluorescent images were taken with an EVOS XL Core Imaging system (Fisher Scientific, Hemel Hempstead, UK) at 40x magnification with the DAPI filter.

To determine the stage of apoptosis induction post SHG-8 treatment, a total of 3x10⁶ cells/well were seeded onto a 6 well plate and left to adhere overnight. Following cellular adherence, all wells were treated with control conditions and SHG-8 at 10μM and 40μM conditions for a period of 24h. Following treatment, all wells were washed with ice-cold PBS and 1x10⁶ cells were harvested to 100μL suspensions. The SW480 cells were treated with 1μL of RNase A (10mg/mL) before being labelled with Annexin-V FITC (5μL) and propidium iodide (100μg/mL). Using the dead cell apoptosis kit with Annexin-V FITC and propidium iodide for flow cytometry (Invitrogen, Inchinnan, UK) to each 100μL cell suspension following the manufacturer’s instructions. The cell suspensions were left to incubate at RT for a period of 15 min. Following incubation, 400μL of 1x binding buffer was added to each sample and left on ice before analysing via the Guavasoft 3.1.1 software and guava easyCyte HT system (Merck Millipore, Watford, UK).

Cell cycle analysis of SW480 cells at sub-G0/G1/S/G2/M phases post SHG-8 treatment was performed via PI staining using the dead cell apoptosis kit with Annexin-V FITC and propidium iodide (Invitrogen, Inchinnan, UK) as per the manufacturer’s instructions. The cells were harvested and treated with 100µg/mL PI and left to incubate for 15 min at RT. The cell suspensions were analysed using the Guavasoft 3.1.1 software and guava easyCyte HT system (Merck Millipore, Watford, UK).

To determine ROS production, SW480 (1.5x10⁴ cells/well) cells were seeded onto a 96 well-plate and left to incubate overnight at 37°C, 5% CO₂. ROS production was determined using the Reactive Oxygen Species (ROS) Detection Assay Kit (Abcam, Cambridge, UK). Following cell adherence, 20µL ROS red dye was added to each of the wells and left to incubate at 37°C, 5% CO₂ for 1 hour. After the incubation period, 20µL of each sample treatment was added to each of the wells following manufacturer’s instructions. Fluorescence readings were obtained at 15-, 30-, 45-, 60- and 75-minute intervals at Ex/Em = 520/605 nm using a CLARIOstar plus multi-mode microplate reader (BMG LABTECH, Aylesbury, UK).

A model of the Siglec-15 structure was downloaded from the AlphaFold Protein Structure Database with the corresponding UniProt entry Q6ZMC9, as there was no experimental structure available in the Protein Data Bank (17). The COACH server was used to predict protein-ligand binding sites on the AlphaFold model (18). The chemical structure of SHG-8 was obtained in SDF format. Molecular docking was carried out using the web app Webina 1.0.3 which runs Autodock Vina entirely in the web browser (19). The Siglec-15 AlphaFold model was uploaded as the receptor and the SHG-8 SDF file was uploaded as the ligand, both files were automatically converted to the PDBQT format for docking. The grid box was centred around the ARG143 binding site, and the parameters were set as follows: centre_x = -23, center_y = 6, center_z = 13.272 and size_x = 28, size_y =21, size_z = 22. The default settings of 2 CPUs and exhaustiveness of the global search set as 8 were used for docking.

SW480 and U87MG cells (3x10⁵ cells/well) were seeded onto coverslips onto a 12-well plate and left to incubate overnight. Following cell adherence, all wells were washed with PBS three times for 5 min each and then fixed with 4% PFA for a total of 15 min. With the fixation removed and washed with PBS, all wells were treated with a 1% BSA/PBS blocking buffer for 1h before incubating the primary Siglec-15 antibody (Life Technologies Limited, Renfrewshire, UK) at a dilution of 1:500 at 4°C overnight. Following this, the antibody is removed and washed with PBS before treating with an anti-rabbit Alexa-488 secondary antibody (Life Technologies Limited, Renfrewshire, UK) at a dilution of 1:500 for 1h at RT. The coverslips were then placed onto microscope slides and visualised with an EVOS XL Core Imaging system (Fisher Scientific, Hemel Hempstead, UK) at 40x magnification with the DAPI and GFP filter.

SW480 cells were seeded at a density of 3x10⁶ cells/well onto a 6 well plate and left to adhere overnight. Following cell adherence, the cells were treated with varying SHG-8 concentrations and controls for 24h. Post-treatment, the cells were washed with ice-cold PBS and harvested with 10mM EDTA at a cellular density of 1x10⁶ cells and resuspended in 2% BSA : PBS (fluorescence activated cell sorting buffer- FACS buffer). The cells were washed with ice-cold PBS and centrifuged at 200xg for 5 min twice. The cell samples were then resuspended in FACS buffer alongside the addition of a monoclonal Siglec-15 primary antibody (R&D Systems, Minneapolis, USA) (0.25µg) raised in mouse and left to incubate on ice for a period of 45 min. Following incubation, the cells were washed with ice-cold PBS and centrifuged at 200xg for 5 min twice before being resuspended in FACS buffer. Each cell suspension was treated with an anti-mouse Alexa- 488 secondary antibody (Life Technologies Limited, Renfrewshire, UK) and left to incubate on ice for a period of 30 min in the dark. After the secondary antibody incubation, the cells were washed once more with ice-cold PBS and centrifuged before being resuspended in FACS buffer for analysis via the guava easyCyte HT system (Merck Millipore, Watford, UK) and Guavasoft 3.1.1 software.

The secretion of pro-inflammatory cytokines TNF-α and IL-1β were evaluated in THP-1 and U937 differentiated macrophages following SHG-8 treatment. Both cell lines were differentiated into macrophages with PMA (50ng/mL) for 48h prior to 40µM SHG-8 treatment and LPS (50ng/mL) stimulation for 24h. The supernatant was harvested and were placed as duplicates onto microwell strips alongside standards using the respective cytokine human ELISA kit (Life Technologies Limited, Renfrewshire, UK) after several wash steps as per the manufacturer’s instructions. 50µL of biotin-conjugate were added to all the strips and were left to incubate at RT for 2h on a microplate shaker. Following the incubation period, the strips were washed and 100µL of streptavidin-HRP were added to all the strips for 1h. The strips were then washed again following the incubation period. After consecutive wash steps, 100µL of TMB substrate solution were added to all wells and left to incubate at RT for 10 min or until a noticeable colour change was observed. Following colour development, 100µL of stop solution were added to each of the strips and was then measured at 620nm using a CLARIOstar microplate reader (BMG LABTECH, Aylesbury, UK).

Total RNA was extracted from SW480 cultured cells 24hrs post-treatment under the following conditions: DMSO, SHG-8 10μM and 40μM as well as 100μM cisplatin using the TRIzol method (Life Technologies Limited, Renfrewshire, UK). RNA quality and quantity of all treated samples for gene and miRNA expression analyses were evaluated using a Nanodrop ND-1000 spectrophotometer UV-Vis Nanogen Inc. (Marshall Scientific, Hampton, USA). Following quantification, expression measurement analysis of treated samples had undergone Dnase treatment with the Rnase-free Dnase set respectively (Qiagen, Hilden, Germany). In brief, the mRNA samples for gene analysis were directly subjected to cDNA synthesis and subsequent RT-qPCR was performed using the High-Capacity cDNA reverse transcription kit (Applied Biosystems, Massachusetts, USA) followed by the Taqman Fast Advanced Mastermix, no UNG (Applied Biosystems, Massachusetts, USA) and PowerUp SYBR Green Mastermix (Applied Biosystems, Massachusetts, USA for probe-based and SYBR green qPCR analyses. SYBR green primer sequences involved in analysis are as follows: GAPDH forward (GGAGCGAGATCCCTCCAAAAT) and reverse (GGCTGTTGTCATACTTCTCATGG) and PTTG1IP forward (GTCTGGACTACCCAGTTACAAGC) and reverse (CGCCTCAAAGTTCACCCAA). All treated samples collected for miRNA expression analysis were further purified and subjected to miRNA enrichment with the miRvana miRNA Isolation Kit (Life Technologies Limited, Renfrewshire, UK). Following this, miRNA samples were further quantified for their RNA quality and quantity prior to reverse transcription with the TaqMan MicroRNA Reverse Transcription kit (Applied Biosystems, Massachusetts, USA). RT-qPCR of individual Taqman miRNA assays (Applied Biosystems, Massachusetts, USA) were performed using the TaqMan Universal Mastermix II, no UNG (Applied Biosystems, Massachusetts, USA) following manufacturer’s instructions. All samples were performed in triplicate using the QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems, Massachusetts, USA). GAPDH and U47 used as housekeeping controls respectively. Relative expression of SIGLEC15 and candidate miRNAs and genes were performed using the 2^–ΔΔCt method.

To determine the differential expression of miRNAs treated with SHG-8, sRNA-seq was outsourced to Biomarker Technologies (Biomarker Technologies, Inc., CA, USA). SW480 cells were subjected to 24hrs SHG-8 treatment prior to total RNA extraction via TRIzol reagent method. The purity and quantity of each RNA sample was processed using a Nanodrop ND-1000 spectrophotometer UV-Vis Nanogen Inc. (Marshall Scientific, Hampton, USA) and 4150 TapeStation System (Agilent Technologies, California, USA). All samples were recorded with RIN numbers >7.0. The resulting data was subjected to Kyoto Encyclopedia of Genes and Genomes (KEGG), Gene Set Enrichment Analysis (GSEA) and Gene Ontology (GO) to identify enriched pathways, biological processes, molecular function, and cellular components in relation to CRC.

The UALCAN database (http://ualcan.path.uab.edu, accessed on 9 May 2023) was utilised for TCGA cancer genomic analysis and is presented as a tool for cancer transcriptomics. Utilising TCGA genomic data, the expression of selected miRNAs was compared among both tumour and normal subgroups. PTTG1IP expression in normal and tumour subgroups were also compared at the protein level.

MTT assays for both SW480 and HcoEPiC cell lines and colony formation assays evaluating the effect of SHG-8 on cancer cells and cytokine secretion of SHG-8 treated THP-1 and U937 differentiated macrophages were compared using the one-way ANOVA statistical test followed by Dunnett’s multiple comparison post-hoc test to identify any statistical significance. The migration assay compared all treatment conditions with Welch’s one-way ANOVA followed by Dunnett’s multiple comparison post-hoc test. Additionally, determining the effect of ROS production in the induction of apoptosis used the two-way ANOVA statistical test followed by Dunnett’s multiple comparison post-hoc test. RT-qPCR expression analyses of SIGLEC15, gene targets and candidate miRNAs were compared with the one-way ANOVA statistical test and Dunnett’s multiple comparison test. Genomic and proteomic data of candidate miRNAs and gene targets between normal and tumour subgroups were compared with an unpaired student’s t-test. Statistical analysis was performed using GraphPad prism 8. *P<0.05, **P<0.01, ***P<0.001, **** P<0.0001 were considered as statistically significant.

The 3-(4-bromophenyl)-1-phenyl-3-(phenylamino)propan-1-one SHG-8 molecule was synthesised efficiently using our in-house developed environmentally benign solid acid nano-catalyst (SAFSNS) at ambient temperature and in good yield. The compound SHG-8 was characterized by spectroscopic techniques including IR, Mass, ¹HNMR and ¹³C NMR and melting point that accurately matches with the literature data (20). The observed melting point of compound SHG-8 was 122-126°C that corresponds to the literature melting point (123–127°C). The sharp peak at 3391 (medium) and 1667 (strong) cm^-1 in IR spectrum indicated the presence of -NH and C=O group respectively ( Figure 1A ). In the ¹H NMR spectrum of compound SHG-8 ( Figure 1B ), the two COCH₂ protons appeared as multiplet at δ 3.41-3.45 and the one NH proton appeared as singlet at δ 4.56. The one CH proton next to NH group appeared as a triplet at δ 4.96. The fourteen aromatic protons were observed in the downfield region, including a doublet at δ 6.53 (J = 8 Hz) for two protons, triplet at δ 6.68 for one proton, multiplet at δ 7.07-7.11 for two protons, doublet at δ 7.31 (J = 8Hz) for two protons, multiplet at δ 7.42-7.57 for four protons, multiplet at δ 7.55-7.57 for one proton and a doublet at δ 7.79 (J = 8 Hz) for two protons. The ¹³C NMR spectrum of compound SHG-8 ( Figure 1C ) was also in full agreement with the assigned structures showing fifteen peaks at δ 45.9, 54.1, 113.8, 118.6, 121.3, 128.2, 128.3, 128.8, 129.4, 132.0, 133.7, 136.7, 142.3, 146.3, 197.9. The MS (ESI) spectra showed M++H peak at m/z 380 ( Figure 1D ) and in the HRMS (ESI) spectra ( Figure 1E ) the m/z peak is found at 380.0639 matching with the calculated m/z for C₂₁H₁₉BrNO [M+H]⁺ which is 380.0645, showing the delta value 0.0006.

The cytotoxic effect of SHG-8 was evaluated in vitro on the SW480 CRC cell line via MTT, wound healing and colony formation assays ( Figure 2 ). Using cisplatin as a positive control, SHG-8 has demonstrated a significant dose-dependent cytotoxic effect on the SW480 cell line with an IC₅₀ value of ~20μM, and significant cell death of ~90% upon reaching 80-100μM concentrations (p<0.0001) ( Figure 2B ). Wound healing has also shown an anti-tumour effect on cellular migration with the SHG-8 40μM concentration showing significant reduction of 15.37% at 24 hours (p<0.05) ( Figure 2C ). Additionally, both SHG-8 10µM and 40µM concentrations have shown similar reductions for 48 hours at 13.22% and 13.28% respectively in comparison to the DMSO control, possibly only effective in the early time points. SHG-8 has also shown a significant negative effect on colonisation of cancer cells ( Figures 2E-G ). Both 10µM and 40µM SHG-8 concentrations produced no colonies on the plate as also observed with the cisplatin control (p<0.0001) ( Figure 2G ).

SHG-8 was evaluated on whether it could induce apoptotic cell death to produce its cytotoxic effect ( Figure 3 ). DAPI staining was performed to see cell fragmentation as a marker of apoptosis. Initially, SHG-8 induced apoptosis in a dose-dependent manner with nuclear fragmentation occurring at both 10μM and 40μM concentrations ( Figure 3A ). Morphological changes of the cancer cells were also apparent; with irregular structural changes indicating a consequential effect of nuclear fragmentation; shown with white arrows. Furthermore, dual staining with Annexin-V and PI has shown significant apoptosis induction in cisplatin 100μM, SHG-8 10μM and 40μM conditions in comparison to the DMSO control ( Figure 3B ). The cisplatin condition had a larger percentage of cells within early apoptosis at 13.88% (lower right quadrant) whilst both SHG-8 10μM and 40μM conditions had a larger percentage of cells exhibiting late apoptosis induction (upper right quadrant) at 15.74% and 17.75% respectively when compared to DMSO. All conditions have shown a minimal number of cells exhibiting necrotic like features (upper left quadrant). Moreover, cell cycle arrest analysis of SHG-8 treated SW480 cells have shown an increased presence in the G2/M phase with SHG-8 at 10μM (13.314%) and 40μM (16.168%) which demonstrated the greatest increase in comparison to the DMSO control condition (10.968%) ( Figure 3C ). Cisplatin shows the greatest number of cells present in the S phase (12.802%) of the cell cycle in comparison to SHG-8 treatments of 10μM and 40μM at 5.954% and 5.975% respectively. Further to this, there are minimal cell populations present in the sub-G0 phase in all treatment conditions. Additionally, a ROS assay was performed to investigate the role of ROS production on the likelihood of apoptosis induction ( Figure 3D ). From this, it can be inferred that ROS production seemingly exhibited no effect on cell death.

The top ranked binding site predicted by the COACH server included the amino acid residues of Siglec-15 at positions: 44, 70, 143,152,153,154,155 and 157 ( Supplementary Figure 1 ) and the region selected as the target site for docking was predicted with very high confidence by AlphaFold. The highest predicted binding affinity between SHG-8 and Siglec-15 was -5.4 kcal/mol and the docking pose revealed that SHG-8 binds around a narrow cleft on the surface of the protein. The amino acid residues that form the cleft and are within 5.0 Å of SHG-8 include: Arg153, Glu145, Ala147, Phe146, Pro76, Ala97, Ala96, Ala98, Arg94 and Ala107 ( Figure 4A ). The binding affinity for mode two was -5.2 kcal/mol. The amino acid residues with atoms within 5.0 Å of SHG-8 mode 2 include: Trp44, Tyr87, Tyr154, Arg143, Asp152, Arg153. Later investigations looked at Siglec-15 expression in vitro which tested positive for expression with a highly expressed Siglec-15 positive cell line (U87MG) for comparison via fluorescence staining methods ( Figure 4B ). RT-qPCR methods were used to determine the expression of SIGLEC15 when treated with SHG-8. RT-qPCR methods have shown that SHG-8 regulates SIGLEC15 expression. We have identified a downregulation of SIGLEC15 respectively at both SHG-8 10µM and 40µM treated conditions (p<0.5, p<0.01, p<0.0001) ( Figure 4C ). However, Siglec-15 protein expression via flow cytometry methods highlighted no significant difference in expression level when treated with SHG-8 at 10μM and 40μM conditions in comparison to the DMSO control ( Figure 4D ).

To determine if SHG-8 poses a cytotoxic effect on normal colon epithelial cells, an MTT assay was conducted using HCoEPiC cells at varying SHG-8 concentrations ( Figure 5A ). SHG-8 has shown no significant difference in cell viability at 20µM which was the determined IC₅₀ value in SW480 cells. However, increasing SHG-8 concentrations affect cell viability ranging from 77.18% at 40µM to 45.26% at 100µM concentration in comparison to 32.97% at 40µM to 5.41% at 100µM at the same concentration range in SW480 cells. Moreover, the IC₅₀ value for HCoEPiC treated cells was found around 90µM, which is significantly higher than SW480 cells highlighting lower toxicity. In addition to this, to determine the effect of pro-inflammatory cytokine secretion in immune cells in the presence of SHG-8, the cytokine levels of TNF-α and IL-1β were determined 24h post SHG-8 treatment and LPS (50ng/mL) stimulation ( Figures 5B-E ). LPS stimulation significantly enhanced pro-inflammatory cytokine secretion of TNF-α and IL-1β in both differentiated macrophage cell lines in comparison to the control group (p<0.0001). In addition to this, SHG-8 treatment at 40µM reduced the LPS-triggered pro-inflammatory cytokine release from differentiated macrophages in all variable conditions. Furthermore, upon exposure to SHG-8 only at 24h, there is a significant reduction in inflammatory cytokine secretion with lower TNF-α secreted in U937 (7.731ng/mL) and IL-1β in THP-1 cells (11.52ng/mL).

SRNA-seq analysis of mRNA SHG-8 treated samples identified clear differential miRNA expression between SHG-8 treatment and control conditions via constructed heat map ( Figure 6A ). Analysis also identified 185 differentially expressed miRNAs via volcano plot ( Figure 6B ). Of those, 106 genes were identified as significantly downregulated, and 79 genes were significantly upregulated having shown a two-fold change in expression. The top 5 most significantly downregulated miRNAs were identified as novel miR-1031/1130/503/993 whilst the top 5 most significantly upregulated miRNAs were listed as novel miR-1401/1065/233/1431 and hsa-miR-6715b-3p. Differential expression also classified COG functions which were correlated largely with signal transduction mechanisms and functions related to translation, ribosomal structure, and biogenesis ( Figure 6C ). KEGG pathway analysis depicted that signalling pathways related to autophagy and senescence were all enriched ( Figure 6D ). GO classification identified several biological processes were elevated including regulation of cellular components, cellular response, and regulation of immune cell apoptotic processes ( Figure 6E ). Additionally, cellular components relating to lysosomes and vesicles were enriched ( Figure 6F ). Furthermore, nucleic acid binding displayed the most enriched molecular function followed by GTP binding and specific protein domain binding ( Figure 6G ).

To investigate the expression profile of miR-6715b-3p in CRC, UALCAN TCGA genomic data was used to confirm sRNA-seq findings ( Figure 7 ) and analysed its expression in the CRC tumour group compared to a normal subgroup ( Figure 7A ). The mean expression level of miR-6715b-3p in the tumour group was 0.655 while in the normal tissue subgroup, the mean expression level was 6.949, indicating a significant substantial dysregulation (p<0.05) of miR-6715b-3p in CRC. To confirm the validity of miR-6715b-3p expression in CRC outlined via in silico analysis, RT-qPCR analysis determined the relative expression of miR-6715b-3p in vitro between SHG-8 treated and untreated conditions ( Figure 7B ). The resulting data demonstrated a significant increase in the expression of miR-6715b-3p (p<0.01) following SHG-8 treatment at both 10µM and 40µM concentrations in comparison to the untreated control. Therefore, confirming the observed increase in miR-6715b-3p expression identified by high-throughput sequencing. Furthermore, sRNA-seq analysis identified that miR-6715b-3p is involved in regulating PTTG1IP, a possible oncogene in CRC. To investigate the differential expression of the PTTG1IP protein between normal and tumour subgroups, in silico analysis was performed using proteomics data ( Figure 7C ). In silico analysis revealed significant upregulation of PTTG1IP protein expression in the CRC tumour subgroup with a mean expression of 0.00 compared to their corresponding normal tissue subgroup with a mean expression of -0.554 (p<0.05). To assess the expression profile of PTTG1IP at the gene level in CRC cells, RT-qPCR analysis on SHG-8 treated and control subgroups was conducted to evaluate its relevance in CRC ( Figure 7D ). The RT-qPCR results revealed that PTTG1IP expression was significantly downregulated in both 10µM and 40µM SHG-8 treated conditions with a relative expression of 0.525 and 0.449 respectively compared to the control group (p<0.01, p<0.001). The mean relative expression of PTTG1IP in treated SW480 cells were 1.12-fold lower than in untreated cells, indicating an SHG8-treatment induced effect on PTTG1IP regulation in SW480 cells.