<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Immunol.</journal-id>
<journal-title>Frontiers in Immunology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Immunol.</abbrev-journal-title>
<issn pub-type="epub">1664-3224</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fimmu.2023.1194733</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Immunology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Interleukin-36&#x3b3; is causative for liver damage upon infection with Rift Valley fever virus in type I interferon receptor-deficient mice</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Anzaghe</surname>
<given-names>Martina</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1185752"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Niles</surname>
<given-names>Marc A.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Korotkova</surname>
<given-names>Eugenia</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/651902"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Dominguez</surname>
<given-names>Monica</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1220683"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Kronhart</surname>
<given-names>Stefanie</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Ortega Iannazzo</surname>
<given-names>Samira</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Bechmann</surname>
<given-names>Ingo</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/86237"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Bachmann</surname>
<given-names>Malte</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/423804"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>M&#xfc;hl</surname>
<given-names>Heiko</given-names>
</name>
<uri xlink:href="https://loop.frontiersin.org/people/22827"/>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Kochs</surname>
<given-names>Georg</given-names>
</name>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Waibler</surname>
<given-names>Zoe</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/632599"/>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Division of Immunology, Paul-Ehrlich-Institut</institution>, <addr-line>Langen</addr-line>, <country>Germany</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Medical Faculty, Institute for Anatomy, University Leipzig</institution>, <addr-line>Leipzig</addr-line>, <country>Germany</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Pharmazentrum Frankfurt/ZAFES, University Hospital Frankfurt, Goethe-University Frankfurt am Main</institution>, <addr-line>Frankfurt am Main</addr-line>, <country>Germany</country>
</aff>
<aff id="aff4">
<sup>4</sup>
<institution>Institute of Virology, Medical Center, Faculty of Medicine, University of Freiburg</institution>, <addr-line>Freiburg</addr-line>, <country>Germany</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Philip Bufler, Charit&#xe9; University Medicine Berlin, Germany</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Javier Mora, University of Costa Rica, Costa Rica; Cornelius Engelmann, Charit&#xe9; University Medicine Berlin, Germany</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Zoe Waibler, <email xlink:href="mailto:zoe.waibler@pei.de">zoe.waibler@pei.de</email>
</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>01</day>
<month>09</month>
<year>2023</year>
</pub-date>
<pub-date pub-type="collection">
<year>2023</year>
</pub-date>
<volume>14</volume>
<elocation-id>1194733</elocation-id>
<history>
<date date-type="received">
<day>27</day>
<month>03</month>
<year>2023</year>
</date>
<date date-type="accepted">
<day>16</day>
<month>08</month>
<year>2023</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2023 Anzaghe, Niles, Korotkova, Dominguez, Kronhart, Ortega Iannazzo, Bechmann, Bachmann, M&#xfc;hl, Kochs and Waibler</copyright-statement>
<copyright-year>2023</copyright-year>
<copyright-holder>Anzaghe, Niles, Korotkova, Dominguez, Kronhart, Ortega Iannazzo, Bechmann, Bachmann, M&#xfc;hl, Kochs and Waibler</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>Type I interferons (IFN) are pro-inflammatory cytokines which can also exert anti-inflammatory effects via the regulation of interleukin (IL)-1 family members. Several studies showed that interferon receptor (IFNAR)-deficient mice develop severe liver damage upon treatment with artificial agonists such as acetaminophen or polyinosinic:polycytidylic acid. In order to investigate if these mechanisms also play a role in an acute viral infection, experiments with the <italic>Bunyaviridae</italic> family member Rift Valley fever virus (RVFV) were performed. Upon RVFV clone (cl)13 infection, IFNAR-deficient mice develop a severe liver injury as indicated by high activity of serum alanine aminotransferase (ALT) and histological analyses. Infected IFNAR<sup>-/-</sup> mice expressed high amounts of IL-36&#x3b3; within the liver, which was not observed in infected wildtype (WT) animals. In line with this, treatment of WT mice with recombinant IL-36&#x3b3; induced ALT activity. Furthermore, administration of an IL-36 receptor antagonist prior to infection prevented the formation of liver injury in IFNAR<sup>-/-</sup> mice, indicating that IL-36&#x3b3; is causative for the observed liver damage. Mice deficient for adaptor molecules of certain pattern recognition receptors indicated that IL-36&#x3b3; induction was dependent on mitochondrial antiviral-signaling protein and the retinoic acid-inducible gene-I-like receptor. Consequently, cell type-specific IFNAR knockouts revealed that type I IFN signaling in myeloid cells is critical in order to prevent IL-36&#x3b3; expression and liver injury upon viral infection. Our data demonstrate an anti-inflammatory role of type I IFN in a model for virus-induced hepatitis by preventing the expression of the novel IL-1 family member IL-36&#x3b3;.</p>
</abstract>
<kwd-group>
<kwd>rift valley fever virus</kwd>
<kwd>type I interferon</kwd>
<kwd>interleukin-36&#x3b3;</kwd>
<kwd>anti-inflammatory</kwd>
<kwd>immune pathology</kwd>
<kwd>dysregulation</kwd>
<kwd>liver injury</kwd>
</kwd-group>
<counts>
<fig-count count="6"/>
<table-count count="1"/>
<equation-count count="0"/>
<ref-count count="54"/>
<page-count count="14"/>
<word-count count="5929"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Cytokines and Soluble Mediators in Immunity</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>Type I interferons (IFN) are a family of cytokines which are expressed early upon infection in order to guarantee the survival of the host until the adaptive immunity is activated. In order to elicit their pro-inflammatory function, type I IFN are induced e.g. upon sensing of pathogen-associated molecular patterns (PAMPs). PAMPs are recognized by pattern recognition receptors (PRRs) such as toll-like receptors (TLR) and the retinoic acid-inducible gene (RIG)-I-like receptors (RLR). Whereas most TLR signal via the adaptor protein myeloid differentiation primary response 88 (MyD88), signaling of RLR is dependent on the adaptor protein mitochondrial antiviral signaling protein (MAVS) (<xref ref-type="bibr" rid="B1">1</xref>). Type I IFN can be subdivided into 13 isoforms of IFN-&#x3b1;, one IFN-&#x3b2;, as well as IFN-&#x3f5;, IFN-&#x3c4;, IFN-&#x3ba;, IFN-&#x3c9;, IFN-&#x3b4;, IFN-&#x3b6;, and IFN-v (<xref ref-type="bibr" rid="B2">2</xref>). All type I IFN bind to a common type I IFN receptor (IFNAR) in order to regulate the expression of hundreds of IFN-stimulated genes (ISG) (<xref ref-type="bibr" rid="B2">2</xref>, <xref ref-type="bibr" rid="B3">3</xref>). It has been shown by several studies in the past that a positive feedback loop via the IFNAR is necessary for the formation of robust type I IFN responses. Small amounts of early type I IFN, mainly IFN-&#x3b1;<sub>4</sub> and IFN-&#x3b2;, bind to the IFNAR in order to induce the production of high amounts of type I IFN (<xref ref-type="bibr" rid="B4">4</xref>&#x2013;<xref ref-type="bibr" rid="B6">6</xref>). Nevertheless, depending on dose and route of infection, the IFNAR feedback loop is not strictly necessary for robust type I IFN expression upon infection with a variety of RNA-encoded viruses (<xref ref-type="bibr" rid="B7">7</xref>).</p>
<p>Even though type I IFN are generally considered as pro-inflammatory cytokines, they can also exert anti-inflammatory functions. Impaired induction of type I IFN in a model of TLR9 ligand-induced liver injury resulted in increased inflammation and liver damage. Here, the protective role of type I IFN was mediated via the attenuation of IL-1&#x3b2; expression and induction of the IL-1 receptor antagonist (RA) (<xref ref-type="bibr" rid="B8">8</xref>). Moreover, IL-1 family member-mediated immune pathology was shown for alcohol-induced hepatitis, fatty liver disease, as well as in a mouse model investigating lipopolysaccharide (LPS)/d-galactosamine (D-GalN)-induced liver injury (<xref ref-type="bibr" rid="B9">9</xref>, <xref ref-type="bibr" rid="B10">10</xref>). In addition, in a previous study we showed that the artificial double-stranded RNA polyinosinic:polycytidylic acid (poly(I:C)) induced severe liver injury in IFNAR-deficient mice (IFNAR<sup>-/-</sup>). Deficient type I IFN signaling was associated with increased levels of IL-1&#x3b2;, which in turn was causative for the induction of severe liver damage as shown e.g. by high activity of serum alanine aminotransferase (ALT) (<xref ref-type="bibr" rid="B11">11</xref>, <xref ref-type="bibr" rid="B12">12</xref>). As many viruses produce double-stranded RNA during their life cycle, poly(I:C) resembles a good model for a viral infection. To further explore the anti-inflammatory role of type I IFN upon a &#x2018;real&#x2019; acute viral infection, we aimed to investigate the regulation of IL-1 family members in virus-induced hepatitis.</p>
<p>Rift Valley fever is an emerging zoonotic disease endemic in sub-Saharan African countries and the Arabian Peninsula. The disease is caused by the Rift Valley fever virus (RVFV), which is an enveloped virus with a segmented negative-sensed single-stranded RNA genome. It belongs to the <italic>Bunyaviridae</italic> family, genus <italic>Phlebovirus</italic>, and is primarily transmitted via <italic>Aedes mcintoshi</italic> mosquitos (<xref ref-type="bibr" rid="B13">13</xref>&#x2013;<xref ref-type="bibr" rid="B18">18</xref>). RVFV outbreaks in the human population vary in extent, intensity, and location. Thus far, the largest outbreak was documented in Egypt 1977 with 10,000-20,000 cases and a mortality rate of up to 20% (<xref ref-type="bibr" rid="B16">16</xref>). RVFV predominantly infects domestic ruminant animals including sheep, cattle, goats, and camels (<xref ref-type="bibr" rid="B16">16</xref>). In humans, infection with RVFV usually causes a self-limiting mild disease with influenza-like symptoms. Nevertheless, a small percentage of patients develop complications with clinical symptoms ranging from hemorrhagic fever to acute hepatitis, severe encephalitis, or thrombosis (<xref ref-type="bibr" rid="B13">13</xref>, <xref ref-type="bibr" rid="B17">17</xref>, <xref ref-type="bibr" rid="B19">19</xref>). The liver is considered the major target organ for RVFV and viral replication was shown to induce apoptosis in hepatocytes accompanied by necrosis (<xref ref-type="bibr" rid="B13">13</xref>, <xref ref-type="bibr" rid="B15">15</xref>, <xref ref-type="bibr" rid="B18">18</xref>). In line with that, RVFV pathogenesis in mice is associated with a loss of liver function due to liver necrosis and hepatitis (<xref ref-type="bibr" rid="B15">15</xref>, <xref ref-type="bibr" rid="B16">16</xref>, <xref ref-type="bibr" rid="B20">20</xref>).</p>
<p>RVFV was described to mainly infect epithelial cells (such as hepatocytes), mesenchymal cells, neural cells, hematopoietic cells such as mononuclear phagocytes, and cells morphologically consistent with dendritic cells (DC) (<xref ref-type="bibr" rid="B15">15</xref>). Other studies identified macrophages to be the primarily virus shedding cells while DC and granulocytes are additional target cells for RVFV replication (<xref ref-type="bibr" rid="B17">17</xref>).</p>
<p>The genome of RVFV consists of three segments: large (L), medium (M), and small (S) (<xref ref-type="bibr" rid="B16">16</xref>, <xref ref-type="bibr" rid="B18">18</xref>). RVFV clone (cl)13 is an avirulent virus variant, which harbors a large deletion in the S segment. It is naturally attenuated and was obtained by plaque purification from a field isolate obtained from a nonfatal human case during an outbreak in 1974 (<xref ref-type="bibr" rid="B19">19</xref>). RVFV cl13 has no pathogenicity for mice or hamsters and the animals survive infections with up to 10<sup>6</sup> plaque-forming units (pfu) without developing any signs of disease. Nevertheless, type I IFN are critical for the survival of mice upon RVFV cl13 infection as IFNAR<sup>-/-</sup> mice show up to 100-fold higher titers when compared to their wildtype (WT) counterparts and finally succumb to infection (<xref ref-type="bibr" rid="B19">19</xref>).</p>
<p>In order to investigate if type I IFN also exert anti-inflammatory effects upon an acute viral infection, we used RVFV cl13 and analyzed the induction of IL-1 family members. Interestingly, data revealed a critical role for the novel IL-1 family member IL-36&#x3b3; which was known thus far to play a pro-inflammatory role in some human disorders such as psoriasis, inflammatory bowel disease, pulmonary disease, or rheumatoid arthritis (<xref ref-type="bibr" rid="B21">21</xref>&#x2013;<xref ref-type="bibr" rid="B24">24</xref>). IL-36 cytokines are new members of the IL-1 family which comprise IL-36&#x3b1;, IL-36&#x3b2;, and IL-36&#x3b3; (<xref ref-type="bibr" rid="B25">25</xref>&#x2013;<xref ref-type="bibr" rid="B27">27</xref>). All bind to a heterodimeric receptor composed of the IL-36 receptor (IL-36R) and IL-1 receptor accessory protein (IL-1RAcP). IL-36 receptor antagonist (IL-36RA) and IL-38 have been shown to negatively regulate the IL-36 signaling pathway via competitive binding to IL-36R, suppressing agonist recognition and IL-1RAcP recruitment (<xref ref-type="bibr" rid="B21">21</xref>, <xref ref-type="bibr" rid="B28">28</xref>&#x2013;<xref ref-type="bibr" rid="B30">30</xref>). IL-36R is expressed in skin (especially on keratinocytes), epithelial cells within the lung, the gastrointestinal tract, and other tissues. Furthermore, several types of immune cells were shown to express IL-36R and respond to stimulation. In addition, human and mouse DC express IL-36R and binding of IL-36 promotes DC maturation and improves antigen presentation via upregulation of HLA-DR, CD83, and CD86 (<xref ref-type="bibr" rid="B21">21</xref>, <xref ref-type="bibr" rid="B29">29</xref>, <xref ref-type="bibr" rid="B31">31</xref>&#x2013;<xref ref-type="bibr" rid="B33">33</xref>). IL-36 stimulates the production of various cytokines, chemokines, adhesion molecules, and pro-inflammatory mediators. IL-36 cytokines can be induced upon stimulation with different agents including cytokines, TLR ligands, bacterial or viral infections, or other pathological conditions (<xref ref-type="bibr" rid="B30">30</xref>, <xref ref-type="bibr" rid="B34">34</xref>, <xref ref-type="bibr" rid="B35">35</xref>).</p>
<p>In this study, we provide for the first time a mechanism for the type I IFN-mediated regulation of IL-36&#x3b3; induction in the context of an acute viral infection.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<label>2</label>
<title>Materials and methods</title>
<sec id="s2_1">
<label>2.1</label>
<title>Mice</title>
<p>C57BL/6 WT mice were purchased from Harlan Winkelmann (Borchen, Germany). IFNAR<sup>-/-</sup> mice (<xref ref-type="bibr" rid="B6">6</xref>) were backcrossed at least 20 times on the C57BL/6 background. ISRE-eGFP mice express eGFP under the control of an interferon-stimulated response element (ISRE) (<xref ref-type="bibr" rid="B36">36</xref>). CD4Cre IFNAR<sup>flox/flox</sup> and CD19Cre IFNAR<sup>flox/flox</sup> mice (<xref ref-type="bibr" rid="B37">37</xref>), LysMCre IFNARflox/flox mice (<xref ref-type="bibr" rid="B38">38</xref>), and CD11cCre IFNARflox/flox (<xref ref-type="bibr" rid="B6">6</xref>) have been described before. To obtain MyD88<sup>-/-</sup>IFNAR<sup>-/-</sup> double-deficient mice and MAVS<sup>-/-</sup>IFNAR<sup>-/-</sup> double-deficient mice, MyD88<sup>-/-</sup> mice or MAVS<sup>-/-</sup> mice were intercrossed with IFNAR<sup>-/-</sup> mice as described before (<xref ref-type="bibr" rid="B7">7</xref>). All mice were bred under specific pathogen free conditions at the Zentrale Tierhaltung of the Paul-Ehrlich-Institut. Correct gene knock outs were verified by PCR analyses for all genotypes used. Health monitoring results of sentinel mice for all knock out mice showed no differences when compared to WT mice in our breeding. Fur structure, bearing, nutrition, and mating behavior of all knock out mice were inconspicuous. Mouse experimental work was carried out using 8 to 12 week old mice in compliance with regulations of German animal welfare.</p>
</sec>
<sec id="s2_2">
<label>2.2</label>
<title>Viruses and stimuli</title>
<p>For infection experiments RVFV cl13 (<xref ref-type="bibr" rid="B19">19</xref>) was used (under BSL2 conditions). Virus was propagated and titrated on Vero cells. Virus supernatants were harvested without further purification. Plaque assay analyses were performed as described earlier (<xref ref-type="bibr" rid="B39">39</xref>). <italic>In vivo</italic> infections were performed with 2x10<sup>4</sup> pfu RVFV cl13 in 200 &#xb5;l via the intraperitoneal (i.p.) route. Recombinant human IL-1RA (Anakinra, kindly provided by Swedish Orphan Biovitrum) was diluted in PBS and i.p. injected 6 hours before, simultaneously with, and 10 hours after infection with 100 &#xb5;g/g bodyweight in a maximal volume of 200 &#xb5;l. Recombinant mouse IL-36&#x3b3;/IL-1F9 (aa 13-164; R&amp;D) was diluted in PBS and intravenously (i.v.) injected (1 &#xb5;g in a volume of 200 &#xb5;l). Recombinant mouse IL-36RA (R&amp;D) was diluted in PBS and i.v. injected 12 hours and 24 hours hours after infection (6 &#xb5;g in a volume of 200 &#xb5;l).</p>
</sec>
<sec id="s2_3">
<label>2.3</label>
<title>Quantification of cytokine production and ALT activity</title>
<p>To determine serum cytokine levels and ALT activity, peripheral blood was taken retro-orbitally upon anesthetization using Isofluran (CP-Pharma) and serum was prepared. IL-36&#x3b3; was determined by enzyme-linked immunosorbent assay (ELISA) according to manufacturer&#x2019;s instructions (Cloud-Clone Corp). Levels of eight different cytokines were measured via ProcartaPlex multiplex immunoassay kit (Thermo Fisher Scientific) according to manufacturer&#x2019;s instructions. ALT activity was determined using a commercially available kit (Hiss Diagnostics GmbH).</p>
</sec>
<sec id="s2_4">
<label>2.4</label>
<title>Histology</title>
<p>For histological analysis, livers were fixed in 10% buffered formalin and embedded in paraffin. Sections were stained with hematoxylin and eosin (H&amp;E) as described before (<xref ref-type="bibr" rid="B11">11</xref>) and examined by light microscopy.</p>
</sec>
<sec id="s2_5">
<label>2.5</label>
<title>Quantitative real-time PCR</title>
<p>Total RNA was prepared from liver, spleen, and peritoneal exudate cells (PEC) using Trizol (Invitrogen)/chloroform extraction. Isolation of liver and spleen was described earlier (<xref ref-type="bibr" rid="B11">11</xref>). Samples were treated with DNaseI (Roche) for 15 min at 37&#xb0;C. Absence of genomic DNA contamination was confirmed by standard PCR using a glyceraldehyde 3-phosphate dehydrogenase (GAPDH)-specific primer pair. Target- and reference-mRNA levels were examined by qRT-PCR using QuantiFast SYBR Green PCR kit (Qiagen). Primer pairs used were the following: GAPDH forward 5&#x2019;-ACCACAGTCCATGCCATCAC-3&#x2019;, GAPDH reverse 5&#x2019;-TCCACCACCCTGTTGCTGTA-3&#x2019;, pro-IL-1&#x3b2; forward 5&#x2019;-TCTTTGAAGTTGACGGACCC-3&#x2019;, pro-IL-1&#x3b2; reverse 5&#x2019;-TGAGTGATACTGCCTGCCTG-3&#x2019;, IL-1RA forward 5&#x2019;-TCAGATCTGCACTCAATGCC-3&#x2019;, IL-1RA reverse 5&#x2019;-CTGGTGTTTGACCTGGGAGT-3&#x2019;, IL-36&#x3b3; forward 5&#x2019;-CAGGCCCTTGTGACAGTTCCA-3&#x2019;, IL-36&#x3b3; reverse 5&#x2019;- TTAGCAGCAAAGTAGGGTGTCCATTA-3&#x2019;, IL-36&#x3b1; forward 5&#x2019;- CCGATGAGCTGCCTGTTCTGC -3&#x2019;, IL-36&#x3b1; reverse 5&#x2019;- GTGGGCAGCTCCCTTTAGAGC -3&#x2019;, IL-36&#x3b2; forward 5&#x2019;- AATGTCAAGCCTGTCATTCTTAGC -3&#x2019;, IL-36&#x3b2; reverse 5&#x2019;- GTGGGCAGCTCCCTTTAGAGC -3&#x2019;, IL-36RA forward 5&#x2019;- CGCAGAGAAGGTCATTAAAGG -3&#x2019;, IL-36RA reverse 5&#x2019;- AGCTCTTTGATTCCTTGGC -3&#x2019;. The expression levels of all target genes were normalized against GAPDH (&#x394;Ct). Gene expression values were calculated based on the &#x394;&#x394;Ct method using the mean of the untreated control group as calibrator to which all other samples were compared. Relative quantities (RQ) were determined using the equation RQ=2<sup>-&#x394;&#x394;Ct</sup>.</p>
</sec>
<sec id="s2_6">
<label>2.6</label>
<title>Flow cytometry</title>
<p>Isolation of PEC was described elsewhere (<xref ref-type="bibr" rid="B7">7</xref>, <xref ref-type="bibr" rid="B11">11</xref>). For FACS analyses, cells were stained for 20 min at 4&#xb0;C with the following fluorochrome-labeled monoclonal antibodies: anti-CD11c-allophycocyanin (APC), anti-B220-PE (both from BD PharMingen), anti-CD11b-Pacific Blue (from Caltag/Invitrogen), and anti-F4/80-APC (AbD Serotec). Cells were washed and analyzed with a LSRII flow cytometer (Becton Dickinson). Analyses were performed using BD FACSDiva&#x2122; 8.0.1 and FlowJo&#xae; 7.6.5 and 10.7.1.</p>
</sec>
<sec id="s2_7">
<label>2.7</label>
<title>Statistics</title>
<p>For all animal experiments, the statistical evaluation was exploratory. All observed effects were described by specifying key statistical metrics (mean value, standard deviation, etc.). For normally distributed data, 95% confidence intervals are given for the mean estimates (also for mean differences). Statistical tests were decided at the two-sided significance level &#x3b1;=5%. For paired comparisons between several treatment groups, the associated p-values were adjusted. Data that are not normally distributed were transformed accordingly. If a transformation is not possible, non-parametric methods were used. All animal experiments were approved by the Regierungspr&#xe4;sidium Darmstadt with the license number F107_1027.</p>
<p>Either Welch&#x2019;s t-test or Mann Whitney test were performed using GraphPad Prism 9.2.0.Values with p &#x2264; 0.05 are statistically significant which is illustrated by the number of stars: (*) for p &#x2264; 0.05, (**) for p &#x2264; 0.01, (***) and for p &#x2264; 0.001; ns = not significant.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<label>3</label>
<title>Results</title>
<sec id="s3_1">
<label>3.1</label>
<title>IFNAR<sup>-/-</sup> mice develop severe liver damage upon infection with RVFV</title>
<p>As shown before (<xref ref-type="bibr" rid="B7">7</xref>), IFNAR<sup>-/-</sup> mice succumb to infection with RVFV cl13, which is accompanied by body weight loss and a drop in body temperature, while their WT counterparts survive the infection and do not show such symptoms (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1A-C</bold>
</xref>). In line with this, WT mice mount IFN-&#x3b1; responses 12 hpi while IFNAR<sup>-/-</sup> mice produced high amounts of IFN-&#x3b1; (up to ~4500 pg/ml) at 30 hpi indicating uncontrolled IFN-&#x3b1; production in the course of infection (<xref ref-type="supplementary-material" rid="SF1">
<bold>Supplementary Figure&#xa0;1</bold>
</xref>). As given in <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1D</bold>
</xref>, infection with RVFV induces viremia with high viral loads in all organs tested in IFNAR<sup>-/-</sup> but not WT mice resulting in the death of IFNAR<sup>-/-</sup> mice 30 hours post infection (<xref ref-type="bibr" rid="B7">7</xref>). In addition, IFNAR<sup>-/-</sup> but not WT mice show high ALT activity in the peripheral blood 30 h post infection indicating a severe liver injury in these animals (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1E</bold>
</xref>). In conclusion, IFNAR<sup>-/-</sup> but not WT mice develop a severe liver damage upon infection with RVFV cl13.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Infection with RVFV cl13 induces liver damage in type I IFN-deficient mice. C57BL/6 (WT) and IFNAR<sup>-/-</sup> mice were i.p. infected with 2x10<sup>4</sup> pfu/200 &#xb5;l RVFV cl13 (n=4-7) and <bold>(A)</bold> survival, <bold>(B)</bold> body weight, and <bold>(C)</bold> body temperature was monitored at the indicated time points post infection. <bold>(D)</bold> Viral loads were analyzed 30 hours post infection (hpi) in the indicated organs by plaque assay (n=4). <bold>(E)</bold> ALT activity was measured 30 hpi within the serum of WT and IFNAR<sup>-/-</sup> mice (n=6). Error bars indicate standard deviations. * &lt; 0.05 (Welch&#x2019;s t-test); n.d., not detectable.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-14-1194733-g001.tif"/>
</fig>
</sec>
<sec id="s3_2">
<label>3.2</label>
<title>Liver damage in RVFV-infected IFNAR<sup>-/-</sup> mice is caused by IL-1 family member IL-36&#x3b3;</title>
<p>Next, we aimed to investigate if liver damage upon RVFV cl13 infection is mediated by a dysregulation of the IL-1 family members IL-1&#x3b2; and/or IL-1RA as it has been shown before for poly(I:C) treatment (<xref ref-type="bibr" rid="B11">11</xref>, <xref ref-type="bibr" rid="B12">12</xref>). Thus, we isolated livers of IFNAR<sup>-/-</sup> and WT mice 30 hours post RVFV cl13 infection and analyzed IL-1&#x3b2; (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>) and IL-1RA (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2B</bold>
</xref>) induction by ELISA. Unlike poly(I:C)-treated animals (<xref ref-type="bibr" rid="B11">11</xref>, <xref ref-type="bibr" rid="B12">12</xref>), RVFV cl13-infected IFNAR<sup>-/-</sup> mice showed high IL-1&#x3b2; as well as IL-1RA expression while WT mice did not show any IL-1&#x3b2; or IL-1RA induction upon infection. To confirm that an IL-1&#x3b2;/IL-1RA imbalance is indeed not involved in RVFV cl13-mediated liver injury, RVFV cl13-infected IFNAR<sup>-/-</sup> mice were treated with recombinant IL-1RA (Anakinra) and analyzed for the development of liver damage by analyzing ALT activity within the serum (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2C</bold>
</xref>). Here, the administration of recombinant IL-1RA could not prevent the development of severe liver injury in RVFV cl13-infected IFNAR<sup>-/-</sup> mice indicating that IL-1&#x3b2;/IL-1RA are not involved in RVFV cl13-induced liver injury.</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Liver injury in RVFV cl13-infected IFNAR<sup>-/-</sup> mice is not mediated by a dysregulation of IL-1&#x3b2;/IL-1RA. C57BL/6 (WT) and IFNAR<sup>-/-</sup> mice were i.p. infected with 2x10<sup>4</sup> pfu/200 &#xb5;l RVFV cl13. Levels of IL-1&#x3b2; <bold>(A)</bold> and IL-1RA <bold>(B)</bold> were measured 30 hpi within the serum by an ELISA method (n=4-13). <bold>(C)</bold> WT and IFNAR<sup>-/-</sup> mice were infected with 2x10<sup>4</sup> pfu/200 &#xb5;l RVFV cl13. Then, a subset of infected IFNAR<sup>-/-</sup> animals was treated with 100 &#xb5;g recombinant IL-1RA (Anakinra) per g body weight as described in material methods. ALT activity was measured 30 hpi within the serum (n=4-13) Error bars indicate standard deviations. ** &lt; 0.01; *** &lt; 0.001 (Welch&#x2019;s t-test); n.s., not significant.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-14-1194733-g002.tif"/>
</fig>
<p>In a model of paracetamol (acetaminophen, APAP)-induced liver damage, the IL-1 family member IL-36&#x3b3; and its antagonist IL-36RA were shown to play a role in the onset and regeneration of liver damage (<xref ref-type="bibr" rid="B40">40</xref>). Hence, we presumed that these IL-1 family members might be type I IFN regulated and thus involved in the RVFV cl13-induced liver damage in absence of IFNAR-signaling. To obtain a first insight, we analyzed the expression of IL-36&#x3b3; upon RVFV cl13 infection by an ELISA method. As given in <xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref>, IFNAR<sup>-/-</sup> but not WT mice show high levels of IL-36&#x3b3; 30 hours post infection. To investigate if IL-36&#x3b3; is sufficient to cause liver injury, we i.p. injected WT animals with 1 &#xb5;g recombinant IL-36&#x3b3; and analyzed ALT activity (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3B</bold>
</xref>). Indeed, WT mice developed a severe liver injury within 3 hours post IL-36&#x3b3; injection as indicated by high ALT activity within the serum.</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>IL-36&#x3b3; is causative for the liver injury in RVFV cl13-infected IFNAR<sup>-/-</sup> mice. C57BL/6 (WT) and IFNAR<sup>-/-</sup> mice were i.p. infected with 2x10<sup>4</sup> pfu/200 &#xb5;l RVFV cl13. <bold>(A)</bold> IL-36&#x3b3; was measured 30 hpi within the serum using an ELISA method (n=4-6). <bold>(B)</bold> C57BL/6 (WT) mice were i.v. injected with 1 &#xb5;g recombinant IL-36&#x3b3;. ALT activity within the serum was measured 3 hours post treatment (n=3). <bold>(C)</bold> RVFV cl13-infected IFNAR<sup>-/-</sup> mice were i.v injected with 6 &#xb5;g rIL-36RA in 200 &#xb5;l 12 and 24 hpi. RVFV cl13-infected IFNAR<sup>-/-</sup> mice served as control. ALT activity was measured 30 hpi (n=5). <bold>(D)</bold> Histological analyses were performed using H&amp;E staining. Liver sections of RVFV cl13-infected WT and IFNAR<sup>-/-</sup> mice were prepared 30 hpi as described earlier (<xref ref-type="bibr" rid="B11">11</xref>). Additionally, RVFV cl13-infected IFNAR<sup>-/-</sup> mice were rIL-36RA-treated (all n=2). Untreated animals served as controls. Arrows exemplarily indicate apoptotic bodies within the tissue. <bold>(E)</bold> Organs of WT and IFNAR<sup>-/-</sup> mice were harvested 30 hours post RVFV infection and analyzed for the viral load by plaque assay (n=2-6). Error bars indicate standard deviations. * &lt; 0.05; ** &lt; 0.01 (Welch&#x2019;s t-test).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-14-1194733-g003.tif"/>
</fig>
<p>To further verify that IL-36&#x3b3; was causative for the liver damage upon RVFV cl13 infection, RVFV cl13-infected IFNAR<sup>-/-</sup> mice were treated with recombinant IL-36RA 12 and 24 hours post infection (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3C</bold>
</xref>). Analyses of IFNAR<sup>-/-</sup> mice revealed that the administration of recombinant IL-36RA significantly reduced ALT activity (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3C</bold>
</xref>) and overall liver damage as indicated by histological analyses (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3D</bold>
</xref>). Of note, viral titers within all organs analyzed were not affected by IL-36RA treatment (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3E</bold>
</xref>). These data strongly indicate that the dysregulated IL-36&#x3b3; expression in absence of type I IFN-signaling is causative for the liver injury observed upon RVFV cl13 infection.</p>
</sec>
<sec id="s3_3">
<label>3.3</label>
<title>Macrophage-like cells within the peritoneum are the main source of IL-36 &#x3b3; in the absence of type I IFN signaling</title>    <p>To gain insight in which cells or organs are the source of IL-36&#x3b3; upon RVFV cl13 infection, we analyzed spleens (as an organ harboring many immune cells), livers (as the site where the damage occurs), and PEC (because of the intraperitoneal route of infection) of WT and IFNAR<sup>-/-</sup> mice. To ensure that both genotypes show a comparable basal expression of IL-36&#x3b3;, we analyzed uninfected mice by qRT-PCR analysis. As given in <xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4A</bold>
</xref>, spleen, liver, and PEC of WT and IFNAR<sup>-/-</sup> mice showed comparable basal levels of IL-36&#x3b3; mRNA. Next, we infected WT and IFNAR<sup>-/-</sup> mice with RVFV for 24 hours and isolated spleen, liver, and PEC RNA for qRT-PCR analyses. As shown in <xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4B</bold>
</xref>, IFNAR<sup>-/-</sup> mice express high levels of IL-36&#x3b3; mRNA in all organs/cells tested with the highest expression in PEC (up to 4000-fold induction) while WT mice did not show upregulation in spleen and liver and only minor upregulation (up to 80-fold) in PEC. These results strongly indicate that PEC are the main source of IL-36&#x3b3; in IFNAR<sup>-/-</sup> mice upon RVFV cl13 infection and that type I IFN signaling in these cells prevents IL-36&#x3b3; induction.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>PEC are the main source of IL-36&#x3b3; upon RVFV cl13 infection of IFNAR<sup>-/-</sup> mice. <bold>(A)</bold> To exclude genotype-specific differences in basal expression levels, spleen, liver, and peritoneal exudate cells (PEC) of C57BL/6 (WT) and IFNAR<sup>-/-</sup> mice (each n=4) were isolated and RNA was prepared as described elsewhere (<xref ref-type="bibr" rid="B11">11</xref>). Expression of IL-36&#x3b3; was determined by qRT-PCR analyses. All values were normalized to WT animals; n.s.=not significant (Mann Whitney test). <bold>(B)</bold> C57BL/6 (WT) and IFNAR<sup>-/-</sup> mice (n=4-9) were i.p. infected with 2x10<sup>4</sup> pfu RVFV cl13 in 200 &#xb5;l. Spleen, liver, and PEC were isolated 24 hpi infection and RNA was prepared as described earlier (<xref ref-type="bibr" rid="B11">11</xref>). Expression of IL-36&#x3b3; was determined by qRT-PCR analyses. <bold>(C)</bold> ISRE-eGFP mice were either left untreated or infected with RVFV cl13 for 30 hours. PEC were isolated and analyzed for eGFP expression by flow cytometry. eGFP-positive cells were further characterized as CD11b<sup>+</sup>F4/80<sup>+</sup> (one representative staining out of three is shown). Error bars indicate standard deviations; * &lt; 0.05 (Welch&#x2019;s t-test); n.s., not significant.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-14-1194733-g004.tif"/>
</fig>
<p>In order to clarify which cells within the peritoneum directly sense type I IFN upon infection, we used reporter mice expressing eGFP under the control of the ISRE for further experiments. Flow cytometric analyses of PEC derived from RVFV-infected mice demonstrated that eGFP-positive cells are mainly CD11b<sup>+</sup>F4/80<sup>+</sup> and therefore show a myeloid/macrophage-like phenotype (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4C</bold>
</xref>).</p>
<p>To investigate if sensing of type I IFN in myeloid/macrophage-like cells is critical for IL-36&#x3b3; expression, we used conditional knockout mice, deficient for the IFNAR in certain types of immune cells (DC-IFNAR<sup>-/-</sup> with specific IFNAR deletion in DC, Mye-IFNAR<sup>-/-</sup> with specific IFNAR deletion in myeloid cells, T-IFNAR<sup>-/-</sup> with specific IFNAR deletion in T cells, whereas all other cell types remain IFNAR-competent as described in (<xref ref-type="bibr" rid="B11">11</xref>)) and infected these mice with RVFV cl13. IFNAR<sup>-/-</sup> mice served as control. As given in <xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5A</bold>
</xref>, mice deficient for the IFNAR in myeloid cells (Mye-IFNAR<sup>-/-</sup>) and DC (DC-IFNAR<sup>-/-</sup>) develop a severe liver injury upon infection which was even more pronounced when compared to IFNAR<sup>-/-</sup> mice. In contrast, T-IFNAR<sup>-/-</sup> control-mice did not show enhanced ALT activity upon infection. In line with this, qRT-PCR analyses of PEC derived from those animals show IL-36&#x3b3; induction in Mye-IFNAR<sup>-/-</sup> (350-fold) and DC-IFNAR<sup>-/-</sup> (500-fold) which was not observed in T-IFNAR<sup>-/-</sup> mice. As shown before, IFNAR<sup>-/-</sup> mice strongly upregulate IL-36&#x3b3; mRNA upon infection (1000-fold) (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5B</bold>
</xref>). Of note, IL-36&#x3b3; induction in Mye-IFNAR<sup>-/-</sup> mice was comparable to IFNAR<sup>-/-</sup> mice. These results indicate that upon RVFV cl13 infection the absence of IFNAR-signaling in myeloid cells/DC results in IL-36&#x3b3; expression, which in turn mediates a severe liver damage.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Myeloid cells need to sense type I IFN in order to protect from IL-36&#x3b3;-mediated liver injury. IFNAR<sup>-/-</sup>, Mye-IFNAR<sup>-/-</sup>, DC-IFNAR<sup>-/-</sup>, and T-IFNAR<sup>-/-</sup> mice were i.p. infected with 2x10<sup>4</sup> pfu RVFV cl13 in 200 &#xb5;l. <bold>(A)</bold> ALT activity was measured 0 and 30 hpi infection (n=3-4). <bold>(B)</bold> Induction of IL-36&#x3b3; within the PEC was determined by qRT-PCR analyses (n=5-8); * &lt; 0.05; ** &lt; 0.01 (Welch&#x2019;s t-test); n.s., not significant.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-14-1194733-g005.tif"/>
</fig>
</sec>
<sec id="s3_4">
<label>3.4</label>
<title>MAVS is critically involved in the production of IL-36&#x3b3; upon RVFV infection of IFNAR<sup>-/-</sup> mice</title>
<p>Viral infections can be sensed via different pathways such as those involving TLR or RLR (<xref ref-type="bibr" rid="B41">41</xref>, <xref ref-type="bibr" rid="B42">42</xref>). To uncover which signaling pathway is involved in IL-36&#x3b3; induction and liver damage upon RVFV infection, we used IFNAR<sup>-/-</sup> mice additionally deficient for MyD88 (MyD88<sup>-/-</sup>IFNAR<sup>-/-</sup> affecting most TLR pathways) and IFNAR<sup>-/-</sup> mice additionally deficient for MAVS (MAVS<sup>-/-</sup>IFNAR<sup>-/-</sup> not capable of using the RLR pathway). qRT-PCR analysis of PEC derived from those mice revealed that MAVS<sup>-/-</sup>IFNAR<sup>-/-</sup> did not induce any IL-36&#x3b3; mRNA upon RVFV cl13 infection while IFNAR<sup>-/-</sup> and MyD88<sup>-/-</sup>IFNAR<sup>-/-</sup> showed high levels of IL-36&#x3b3; mRNA. Interestingly, IL-36&#x3b3; mRNA-levels were even significantly higher in MyD88<sup>-/-</sup>IFNAR<sup>-/-</sup> mice when compared to IFNAR<sup>-/-</sup> mice (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6A</bold>
</xref>). These data show that for IL-36&#x3b3; mRNA expression by IFNAR<sup>-/-</sup> PEC, the MAVS-adapted RLR pathway is used while the MyD88-adapted TLR are of no relevance. Finally, we analyzed the ALT activity in the serum of these different knockout mice. While MyD88<sup>-/-</sup>IFNAR<sup>-/-</sup> showed levels comparable to those in IFNAR<sup>-/-</sup> mice, no ALT activity was detected in MAVS<sup>-/-</sup>IFNAR<sup>-/-</sup> mice indicating that these mice were indeed protected from the RVFV cl13-induced IL-36&#x3b3;-mediated liver injury. Of note, plaque assay analyses revealed high viral loads in all organs tested, irrespective of the genotype of mice investigated (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6C</bold>
</xref>). Of note, higher levels of IL-36&#x3b3; expression in MyD88<sup>-/-</sup>IFNAR<sup>-/-</sup> could not be correlated with increased viral loads in these mice.</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>MAVS is critically involved in IL-36&#x3b3; induction and IL-36&#x3b3;-mediated liver injury upon RVFV cl13 infection of IFNAR<sup>-/-</sup> mice. IFNAR<sup>-/-</sup>, MAVS<sup>-/-</sup>IFNAR<sup>-/-</sup>, and MyD88<sup>-/-</sup>IFNAR<sup>-/-</sup> mice were i.p. infected with 2x10<sup>4</sup> pfu RVFV cl13 in 200 &#xb5;l for 30 hours. <bold>(A)</bold> IL-36&#x3b3; induction was investigated by qRT-PCR analyses of the PEC (n=4-6). <bold>(B)</bold> ALT activity was measured in serum samples at 30 hours post infection (n=4-8). <bold>(C)</bold> Viral load in different organs was analyzed by plaque assay (n=4-7). Error bars indicate standard deviations; * &lt; 0.05; ** &lt; 0.01; n.s., not significant.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-14-1194733-g006.tif"/>
</fig>
<p>In conclusion, our study demonstrated a critical role for the IL-1 family member IL-36&#x3b3; for the induction of liver damage in the course of viral infection. In line with results obtained using the artificial double-stranded RNA poly(I:C), the dysregulation of IL-1 family members in the absence of type I IFN results in severe liver injury independent of viral titers.</p>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<label>4</label>
<title>Discussion</title>
<p>It was shown before that members of the IL-1 family, especially IL-1&#x3b2;, play an important role in liver injury (<xref ref-type="bibr" rid="B11">11</xref>, <xref ref-type="bibr" rid="B43">43</xref>). The current study demonstrates a pathological role for IL-36&#x3b3; upon an acute viral infection. The pro-inflammatory cytokine IL-36&#x3b3; was known before to be critically involved in several inflammatory disorders such as psoriasis (<xref ref-type="bibr" rid="B29">29</xref>, <xref ref-type="bibr" rid="B44">44</xref>, <xref ref-type="bibr" rid="B45">45</xref>), inflammatory bowel disease (<xref ref-type="bibr" rid="B23">23</xref>, <xref ref-type="bibr" rid="B32">32</xref>, <xref ref-type="bibr" rid="B44">44</xref>), rheumatoid arthritis (<xref ref-type="bibr" rid="B21">21</xref>), or systemic lupus erythematosus (SLE) (<xref ref-type="bibr" rid="B24">24</xref>). Accumulating evidences suggest that IL-36&#x3b3; also plays a role during infectious diseases (<xref ref-type="bibr" rid="B24">24</xref>). Nevertheless, it is not fully understood yet if it promotes infection, drives immune-pathology, or rather plays a protective role.</p>
<p>A study by Wang et&#xa0;al. using a mouse model for influenza A virus (IAV) infection revealed that IL-36 contributes to lung damage and mortality by promoting inflammation. Mice deficient for the IL-36R were protected from IAV-induced lung injury and mortality. Furthermore, IL-36R<sup>-/-</sup> mice showed reduced lymphocyte activation, accumulation of myeloid cells, reduced permeability of the alveolar epithelial barrier, and less production of pro-inflammatory cytokines and chemokines (<xref ref-type="bibr" rid="B24">24</xref>, <xref ref-type="bibr" rid="B46">46</xref>). In line with that, patients with IAV-induced acute respiratory syndrome (ARDS) show higher concentrations of IL-36&#x3b3; in the plasma when compared to healthy individuals (<xref ref-type="bibr" rid="B47">47</xref>). In addition, IL-36&#x3b3; and IL-36&#x3b1; are significantly upregulated in patients with pulmonary tuberculosis, bacterial pneumonia, or chronic hepatitis B virus (HBV) infection (<xref ref-type="bibr" rid="B47">47</xref>, <xref ref-type="bibr" rid="B48">48</xref>).</p>
<p>Others reported a protective role for IL-36. Upon infection of mice, pretreatment with IL-36&#x3b3; increased the resistance against Herpes simplex virus (HSV)-2 infection and disease (<xref ref-type="bibr" rid="B21">21</xref>). Mice lacking IL-36&#x3b3; showed increased morbidity and mortality upon IAV infection which was associated with increased virus titers and higher levels of inflammatory cytokines (<xref ref-type="bibr" rid="B46">46</xref>). Furthermore, IL-36&#x3b3;<sup>-/-</sup> mice showed higher bacterial load in the lung, systemic dissemination, and higher mortality upon infection with <italic>Staphylococcus pneumoniae</italic> when compared to WT mice (<xref ref-type="bibr" rid="B45">45</xref>). Blocking IL-36&#x3b3; receptor binding and using recombinant IL-36&#x3b3; (see <xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3</bold>
</xref>), we found IL-36&#x3b3; to be causative for the liver damage induced upon infection with RVFV cl13 in absence of intact type I IFN signaling. Interestingly, neither IL-36&#x3b1;, IL-36&#x3b2;, nor IL-36RA were elevated in organs of RVFV cl13-infected IFNAR<sup>-/-</sup> mice when compared to untreated IFNAR<sup>-/-</sup> or WT mice (see <xref ref-type="supplementary-material" rid="SF2">
<bold>Supplementary Figure&#xa0;2</bold>
</xref>).</p>
<p>IL-36&#x3b3; was shown before to play a role in drug-induced liver injury. In a model of acetaminophen (APAP)-induced hepatitis, Scheiermann et&#xa0;al. showed elevated levels of IL-36&#x3b3; within the liver of IFNAR<sup>-/-</sup> mice. However, application of IL-36RA increased the late phase of liver injury indicating a potential role for IL-36&#x3b3; as a cytokine contributing to the decision between tissue damage and liver regeneration (<xref ref-type="bibr" rid="B40">40</xref>). Moreover, treatment with IL-36RA significantly reduced the production of pro-inflammatory cytokines in BALB/c mice in a model of Concanavalin (Con)A-induced liver injury (<xref ref-type="bibr" rid="B49">49</xref>). ConA-treated IL-36R<sup>-/-</sup> animals exhibited exaggerated T cell responses as shown by increased infiltration of effector T cells into the liver accompanied by the production of pro-inflammatory cytokines (<xref ref-type="bibr" rid="B29">29</xref>).</p>
<p>Interestingly, in our study, IL-36&#x3b3;-mediated liver injury upon RVFV infection was completely independent from viral loads in various organs tested. In particular, while viral titers in MAVS<sup>-/-</sup>IFNAR<sup>-/-</sup> animals are comparable to those in IFNAR<sup>-/-</sup> mice (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1</bold>
</xref>, <xref ref-type="fig" rid="f6">
<bold>6</bold>
</xref>), ALT activity in these double-deficient mice is comparable to WT animals (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref>). This suggests an immunopathology caused by IL-36&#x3b3; expression in an IFNAR-deficient situation, whereas the hepatocellular tropism of RVFV and thus a virus-induced hepatitis seem to play a minor role.</p>
<p>Upon drug-induced liver injury, hepatocytes were shown to be the major source of IL-36 promoting the inflammatory response (<xref ref-type="bibr" rid="B50">50</xref>). In line with this, IL-6, TNF-&#x3b1;, and IFN-&#x3b3; were slightly elevated in RVFV cl13-infected IFNAR<sup>-/-</sup> mice when compared to RVFV cl13-infected WT mice (for all p-value = 0.0571, Mann-Whitney-Test). In addition, a minor expression of IL-12p70 and IL-18 was observed in RVFV cl13-infected IFNAR<sup>-/-</sup> mice while other cytokines such as IL2, IL-4 or IL-5 did not differ between RVFV cl13-infected IFNAR<sup>-/-</sup> and WT mice (<xref ref-type="supplementary-material" rid="SF3">
<bold>Supplementary Figure&#xa0;3</bold>
</xref>). Our study revealed that type I IFN sensing by macrophages as well as DC is critical for the prevention of IL-36&#x3b3; production and thus the IL-36&#x3b3;-induced liver injury upon RVFV cl13 infection (see <xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5</bold>
</xref>). The protective role of myeloid cells was also shown before for poly(I:C)-induced liver damage. Here, myeloid-derived suppressor cells infiltrated the liver in a type I IFN-dependent manner in order to produce IL-1RA and therefore prevent IL-1&#x3b2;-mediated liver injury (<xref ref-type="bibr" rid="B11">11</xref>). Interestingly, in the current study, no enhanced IL-36RA expression was detected in qRT-PCR analyses of organs of WT mice (see <xref ref-type="supplementary-material" rid="SF2">
<bold>Supplementary Figure&#xa0;2</bold>
</xref>) indicating that other factors are involved in order to regulate the expression of IL-36&#x3b3;. Within the poly(I:C)-induced model of liver damage as well as in our current study, myeloid cells within the peritoneum are of particular importance. Along this line, deficient type I IFN signaling was associated with decreased liver recruitment of DC in a model of TLR9 ligand-induced liver damage (<xref ref-type="bibr" rid="B8">8</xref>). In addition, a study by Pinto et&#xa0;al. demonstrated that deletion of the IFNAR on subsets of myeloid cells such as macrophages and DC, resulted in uncontrolled replication of West Nile virus (WNV), production of pro-inflammatory cytokines, organ damage, and death (<xref ref-type="bibr" rid="B51">51</xref>). Interestingly, particularly cells of the macrophage lineage show increased susceptibility to RVFV cl13 infection in the absence of type I IFN. During initial stages of infection of IFNAR<sup>-/-</sup> mice, RVFV cl13 replicates within macrophages and DC (<xref ref-type="bibr" rid="B17">17</xref>). Ermler et&#xa0;al. demonstrated that murine conventional DC and macrophages express type I IFN in response to RVFV cl13 (<xref ref-type="bibr" rid="B14">14</xref>, <xref ref-type="bibr" rid="B18">18</xref>).</p>
<p>In addition, RVFV cl13-infected human monocyte-derived macrophages were shown to secrete TNF-&#x3b1; and type I IFN (<xref ref-type="bibr" rid="B18">18</xref>). This together with our data implies that production as well as sensing of type I IFN by myeloid cells such as macrophages and DC, is critical in order to prevent IL-36&#x3b3; production and thus the IL-36&#x3b3;-induced liver damage upon RVFV cl13 infection. Besides immune cells, human lung fibroblasts and human bronchial epithelial cells were shown to produce IL-6 and CXCL8 upon treatment with IL-36 (<xref ref-type="bibr" rid="B30">30</xref>). Thus, other cells than immune cells such as hepatocytes might contribute to a production of pro-inflammatory cytokines and dysregulated immune reaction upon RVFV cl13 infection.</p>
<p>It was shown in several studies that myeloid cells sense PAMPs rather via RLRs than TLRs. For example, Dutta et&#xa0;al. revealed that MAVS signaling in myeloid cells was critical for the resistance to Ebola virus infection in mice (<xref ref-type="bibr" rid="B52">52</xref>). In line with this, a variety of RNA-encoded viruses were shown to induce IFNAR-independent type I IFN responses in a MAVS-dependent manner (<xref ref-type="bibr" rid="B7">7</xref>). Here, we show that IL-36&#x3b3; production and accordingly liver damage were dependent on MAVS in RVFV cl13-infected IFNAR<sup>-/-</sup> mice while MyD88-adapted TLR are of no importance for IL-36&#x3b3; production (see <xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref>). Along this line, others showed that upon infection with WNV no cytokine production was observed in MAVS<sup>-/-</sup>IFNAR<sup>-/-</sup> mice (<xref ref-type="bibr" rid="B51">51</xref>). Of note, production of pro-inflammatory cytokines by DC or fibroblasts upon IL-36&#x3b3; stimulation was shown to be dependent on MyD88 indicating that induction and sensing of IL-36&#x3b3; can be mediated by different pathways (<xref ref-type="bibr" rid="B23">23</xref>, <xref ref-type="bibr" rid="B45">45</xref>).</p>
<p>The interaction between type I IFN and IL-36 was previously observed also in psoriasis patients. Here, the expression of IL-36 strongly correlated with type I IFN overexpression (<xref ref-type="bibr" rid="B53">53</xref>). In addition, IL-36 serum levels in patients correlate with SLE disease activity, a disorder characterized by an enhanced type I IFN signature (<xref ref-type="bibr" rid="B53">53</xref>). In epithelial cells, IL-36 was shown to increase antiviral immunity by enhancing the expression of type I IFN stimulated genes (ISG) via the IFNAR (<xref ref-type="bibr" rid="B54">54</xref>). This mechanism may have evolved in order to control viruses that developed immune evasion strategies by blocking the production of type I IFN.</p>
<p>In conclusion, our study demonstrated that pro-inflammatory IL-36&#x3b3; is causative for the observed liver injury in IFNAR<sup>-/-</sup> mice upon an acute viral infection. The expression of IL-36&#x3b3; is regulated by type I IFN, which need to be sensed by myeloid cells in order to prevent liver damage.</p>
</sec>
<sec id="s5" sec-type="data-availability">
<title>Data availability statement</title>
<p>The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.</p>
</sec>
<sec id="s6" sec-type="ethics-statement">
<title>Ethics statement</title>
<p>The animal study was approved by Regierungspr&#xe4;sidium Darmstadt, license number F107-1027. The study was conducted in accordance with the local legislation and institutional requirements.</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author contributions</title>
<p>All authors contributed either to research design (MA, ZW, and GK) and/or the acquisition (MA, MN, EK, MD, SK, IB, SO-I), data analysis (MA, ZW, MN, EK, MD, SK, IB, SO-I), or interpretation of data (all authors). MA and ZW drafted the manuscript, which was critically revised by all other authors. All authors contributed to the article and approved the submitted version.</p>
</sec>
</body>
<back>
<ack>
<title>Acknowledgments</title>
<p>We thank Dorothea Kreuz, Bj&#xf6;rn Becker, and Yvonne Krebs for expert technical assistance.</p>
</ack>
<sec id="s8" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s9" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s10" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fimmu.2023.1194733/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fimmu.2023.1194733/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="Image_1.tif" id="SF1" mimetype="image/tiff">
<label>Supplementary Figure&#xa0;1</label>
<caption>
<p>RVFV cl13-infected IFNAR<sup>-/-</sup> mice express high levels of IFN-&#x3b1; in the serum 30 hpi while WT mice show low amounts 12 hpi. C57BL/6 (WT) and IFNAR<sup>-/-</sup> mice (n= 2-14) were i.p. infected with 2x10<sup>4</sup> pfu RVFV cl13 in 200 &#xb5;l. Serum was collected prior to infection as well as 30 hpi and tested using a multiplex kit for the presence of IL-6, TNF-&#x3b1;, and IFN-&#x3b3; as described in the material and methods section. Error bars indicate standard deviations; *&lt; 0.05; ** &lt; 0.01; **** &lt; 0.0001 (Welch&#x2019;s t-test); n.s., not significant.</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="Image_2.tif" id="SF2" mimetype="image/tiff">
<label>Supplementary Figure&#xa0;2</label>
<caption>
<p>Spleen, liver, and PEC of RVFV cl13-infected IFNAR<sup>-/-</sup> mice do not upregulate IL-36&#x3b1;, Il-36&#x3b2;, or IL-36RA when compared to WT mice. C57BL/6 (WT) and IFNAR<sup>-/-</sup> mice (for IL-36&#x3b1; and IL-36&#x3b2; n=3-5; for IL-36RA n= 2-11) were i.p. infected with 2x10<sup>4</sup> pfu RVFV cl13 in 200 &#xb5;l. Spleen, liver, and PEC were isolated 24 hpi infection and RNA was prepared as described earlier (<xref ref-type="bibr" rid="B11">11</xref>). Expression of IL-36&#x3b1;, IL-36&#x3b2;, and IL-36RA was determined by qRT-PCR analyses. n.s., not significant (Welch&#x2019;s t-test).</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="Image_3.tif" id="SF3" mimetype="image/tiff">
<label>Supplementary Figure&#xa0;3</label>
<caption>
<p>RVFV cl13-infected IFNAR<sup>-/-</sup> mice show slightly enhanced levels of IL-6, TNF-&#x3b1;, and IFN-&#x3b3; within the serum when compared to WT mice. C57BL/6 (WT) and IFNAR<sup>-/-</sup> mice (n= 3-4) were i.p. infected with 2x10<sup>4</sup> pfu RVFV cl13 in 200 &#xb5;l. Serum was collected prior to infection as well as 30 hpi and tested using a multiplex kit for the presence of a panel of eight different cytokines as described in the material and methods section. n.s., not significant (Mann-Whitney-Test).</p>
</caption>
</supplementary-material>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>H</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>Z</given-names>
</name>
</person-group>. <article-title>The essential adaptors of innate immune signaling</article-title>. <source>Protein Cell</source> (<year>2013</year>) <volume>4</volume>:<fpage>27</fpage>&#x2013;<lpage>39</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s13238-012-2063-0</pub-id>
</citation>
</ref>
<ref id="B2">
<label>2</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Schneider</surname> <given-names>WM</given-names>
</name>
<name>
<surname>Chevillotte</surname> <given-names>MD</given-names>
</name>
<name>
<surname>Rice</surname> <given-names>CM</given-names>
</name>
</person-group>. <article-title>Interferon-stimulated genes: a complex web of host defenses</article-title>. <source>Annu Rev Immunol</source> (<year>2014</year>) <volume>32</volume>:<page-range>513&#x2013;45</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1146/annurev-immunol-032713-120231</pub-id>
</citation>
</ref>
<ref id="B3">
<label>3</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Trinchieri</surname> <given-names>G</given-names>
</name>
</person-group>. <article-title>Type I interferon: friend or foe</article-title>? <source>J Exp Med</source> (<year>2010</year>) <volume>207</volume>:<page-range>2053&#x2013;63</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1084/jem.20101664</pub-id>
</citation>
</ref>
<ref id="B4">
<label>4</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Honda</surname> <given-names>K</given-names>
</name>
<name>
<surname>Yanai</surname> <given-names>H</given-names>
</name>
<name>
<surname>Takaoka</surname> <given-names>A</given-names>
</name>
<name>
<surname>Taniguchi</surname> <given-names>T</given-names>
</name>
</person-group>. <article-title>Regulation of the type I IFN induction: a current view</article-title>. <source>Int Immunol</source> (<year>2005</year>) <volume>17</volume>:<page-range>1367&#x2013;78</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/intimm/dxh318</pub-id>
</citation>
</ref>
<ref id="B5">
<label>5</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ma</surname> <given-names>F</given-names>
</name>
<name>
<surname>Li</surname> <given-names>B</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Iyer</surname> <given-names>SS</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>M</given-names>
</name>
<name>
<surname>Cheng</surname> <given-names>G</given-names>
</name>
</person-group>. <article-title>Positive feedback regulation of type I interferon by the interferon-stimulated gene STING</article-title>. <source>EMBO Rep</source> (<year>2015</year>) <volume>16</volume>:<page-range>202&#x2013;12</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.15252/embr.201439366</pub-id>
</citation>
</ref>
<ref id="B6">
<label>6</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>M&#xfc;ller</surname> <given-names>U</given-names>
</name>
<name>
<surname>Steinhoff</surname> <given-names>U</given-names>
</name>
<name>
<surname>Reis</surname> <given-names>LF</given-names>
</name>
<name>
<surname>Hemmi</surname> <given-names>S</given-names>
</name>
<name>
<surname>Pavlovic</surname> <given-names>J</given-names>
</name>
<name>
<surname>Zinkernagel</surname> <given-names>RM</given-names>
</name>
<etal/>
</person-group>. <article-title>Functional role of type I and type II interferons in antiviral defense</article-title>. <source>Science</source> (<year>1994</year>) <volume>264</volume>:<page-range>1918&#x2013;21</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1126/science.8009221</pub-id>
</citation>
</ref>
<ref id="B7">
<label>7</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Anzaghe</surname> <given-names>M</given-names>
</name>
<name>
<surname>Kronhart</surname> <given-names>S</given-names>
</name>
<name>
<surname>Niles</surname> <given-names>MA</given-names>
</name>
<name>
<surname>H&#xf6;cker</surname> <given-names>L</given-names>
</name>
<name>
<surname>Dominguez</surname> <given-names>M</given-names>
</name>
<name>
<surname>Kochs</surname> <given-names>G</given-names>
</name>
<etal/>
</person-group>. <article-title>Type I interferon receptor-independent interferon-&#x3b1; induction upon infection with a variety of negative-strand RNA viruses</article-title>. <source>J Gen Virol</source> (<year>2021</year>) <volume>102</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.1099/jgv.0.001616</pub-id>
</citation>
</ref>
<ref id="B8">
<label>8</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Petrasek</surname> <given-names>J</given-names>
</name>
<name>
<surname>Dolganiuc</surname> <given-names>A</given-names>
</name>
<name>
<surname>Csak</surname> <given-names>T</given-names>
</name>
<name>
<surname>Kurt-Jones</surname> <given-names>EA</given-names>
</name>
<name>
<surname>Szabo</surname> <given-names>G</given-names>
</name>
</person-group>. <article-title>Type I interferons protect from Toll-like receptor 9-associated liver injury and regulate IL-1 receptor antagonist in mice</article-title>. <source>Gastroenterology</source> (<year>2011</year>) <volume>140</volume>:<fpage>697</fpage>&#x2013;<lpage>708.e4</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1053/j.gastro.2010.08.020</pub-id>
</citation>
</ref>
<ref id="B9">
<label>9</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gehrke</surname> <given-names>N</given-names>
</name>
<name>
<surname>H&#xf6;velmeyer</surname> <given-names>N</given-names>
</name>
<name>
<surname>Waisman</surname> <given-names>A</given-names>
</name>
<name>
<surname>Straub</surname> <given-names>BK</given-names>
</name>
<name>
<surname>Weinmann-Menke</surname> <given-names>J</given-names>
</name>
<name>
<surname>W&#xf6;rns</surname> <given-names>MA</given-names>
</name>
<etal/>
</person-group>. <article-title>Hepatocyte-specific deletion of IL1-RI attenuates liver injury by blocking IL-1 driven autoinflammation</article-title>. <source>J Hepatol</source> (<year>2018</year>) <volume>68</volume>:<page-range>986&#x2013;95</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jhep.2018.01.008</pub-id>
</citation>
</ref>
<ref id="B10">
<label>10</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tilg</surname> <given-names>H</given-names>
</name>
<name>
<surname>Moschen</surname> <given-names>AR</given-names>
</name>
<name>
<surname>Szabo</surname> <given-names>G</given-names>
</name>
</person-group>. <article-title>Interleukin-1 and inflammasomes in alcoholic liver disease/acute alcoholic hepatitis and nonalcoholic fatty liver disease/nonalcoholic steatohepatitis</article-title>. <source>Hepatology</source> (<year>2016</year>) <volume>64</volume>:<page-range>955&#x2013;65</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/hep.28456</pub-id>
</citation>
</ref>
<ref id="B11">
<label>11</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Conrad</surname> <given-names>E</given-names>
</name>
<name>
<surname>Resch</surname> <given-names>TK</given-names>
</name>
<name>
<surname>Gogesch</surname> <given-names>P</given-names>
</name>
<name>
<surname>Kalinke</surname> <given-names>U</given-names>
</name>
<name>
<surname>Bechmann</surname> <given-names>I</given-names>
</name>
<name>
<surname>Bogdan</surname> <given-names>C</given-names>
</name>
<etal/>
</person-group>. <article-title>Protection against RNA-induced liver damage by myeloid cells requires type I interferon and IL-1 receptor antagonist in mice</article-title>. <source>Hepatology</source> (<year>2014</year>) <volume>59</volume>:<page-range>1555&#x2013;63</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/hep.26915</pub-id>
</citation>
</ref>
<ref id="B12">
<label>12</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Anzaghe</surname> <given-names>M</given-names>
</name>
<name>
<surname>Resch</surname> <given-names>T</given-names>
</name>
<name>
<surname>Schaser</surname> <given-names>E</given-names>
</name>
<name>
<surname>Kronhart</surname> <given-names>S</given-names>
</name>
<name>
<surname>Diez</surname> <given-names>C</given-names>
</name>
<name>
<surname>Niles</surname> <given-names>MA</given-names>
</name>
<etal/>
</person-group>. <article-title>Organ-specific expression of IL-1 receptor results in severe liver injury in type I interferon receptor deficient mice</article-title>. <source>Front Immunol</source> (<year>2019</year>) <volume>10</volume>:<elocation-id>1009</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2019.01009</pub-id>
</citation>
</ref>
<ref id="B13">
<label>13</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ikegami</surname> <given-names>T</given-names>
</name>
<name>
<surname>Makino</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>The pathogenesis of Rift Valley fever</article-title>. <source>Viruses</source> (<year>2011</year>) <volume>3</volume>:<fpage>493</fpage>&#x2013;<lpage>519</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/v3050493</pub-id>
</citation>
</ref>
<ref id="B14">
<label>14</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ermler</surname> <given-names>ME</given-names>
</name>
<name>
<surname>Traylor</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Patel</surname> <given-names>K</given-names>
</name>
<name>
<surname>Schattgen</surname> <given-names>SA</given-names>
</name>
<name>
<surname>Vanaja</surname> <given-names>SK</given-names>
</name>
<name>
<surname>Fitzgerald</surname> <given-names>KA</given-names>
</name>
<etal/>
</person-group>. <article-title>Rift Valley fever virus infection induces activation of the NLRP3 inflammasome</article-title>. <source>Virology</source> (<year>2014</year>) <volume>449</volume>:<page-range>174&#x2013;80</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.virol.2013.11.015</pub-id>
</citation>
</ref>
<ref id="B15">
<label>15</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Smith</surname> <given-names>DR</given-names>
</name>
<name>
<surname>Steele</surname> <given-names>KE</given-names>
</name>
<name>
<surname>Shamblin</surname> <given-names>J</given-names>
</name>
<name>
<surname>Honko</surname> <given-names>A</given-names>
</name>
<name>
<surname>Johnson</surname> <given-names>J</given-names>
</name>
<name>
<surname>Reed</surname> <given-names>C</given-names>
</name>
<etal/>
</person-group>. <article-title>The pathogenesis of Rift Valley fever virus in the mouse model</article-title>. <source>Virology</source> (<year>2010</year>) <volume>407</volume>:<page-range>256&#x2013;67</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.virol.2010.08.016</pub-id>
</citation>
</ref>
<ref id="B16">
<label>16</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gray</surname> <given-names>KK</given-names>
</name>
<name>
<surname>Worthy</surname> <given-names>MN</given-names>
</name>
<name>
<surname>Juelich</surname> <given-names>TL</given-names>
</name>
<name>
<surname>Agar</surname> <given-names>SL</given-names>
</name>
<name>
<surname>Poussard</surname> <given-names>A</given-names>
</name>
<name>
<surname>Ragland</surname> <given-names>D</given-names>
</name>
<etal/>
</person-group>. <article-title>Chemotactic and inflammatory responses in the liver and brain are associated with pathogenesis of Rift Valley fever virus infection in the mouse</article-title>. <source>PloS Negl Trop Dis</source> (<year>2012</year>) <volume>6</volume>:<elocation-id>e1529</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pntd.0001529</pub-id>
</citation>
</ref>
<ref id="B17">
<label>17</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gommet</surname> <given-names>C</given-names>
</name>
<name>
<surname>Billecocq</surname> <given-names>A</given-names>
</name>
<name>
<surname>Jouvion</surname> <given-names>G</given-names>
</name>
<name>
<surname>Hasan</surname> <given-names>M</given-names>
</name>
<name>
<surname>Zaverucha do Valle</surname> <given-names>T</given-names>
</name>
<name>
<surname>Guillemot</surname> <given-names>L</given-names>
</name>
<etal/>
</person-group>. <article-title>Tissue tropism and target cells of NSs-deleted rift valley fever virus in live immunodeficient mice</article-title>. <source>PloS Negl Trop Dis</source> (<year>2011</year>) <volume>5</volume>:<fpage>e1421</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pntd.0001421</pub-id>
</citation>
</ref>
<ref id="B18">
<label>18</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Terasaki</surname> <given-names>K</given-names>
</name>
<name>
<surname>Makino</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>Interplay between the virus and host in rift valley fever pathogenesis</article-title>. <source>J Innate Immun</source> (<year>2015</year>) <volume>7</volume>:<page-range>450&#x2013;8</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1159/000373924</pub-id>
</citation>
</ref>
<ref id="B19">
<label>19</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bouloy</surname> <given-names>M</given-names>
</name>
<name>
<surname>Janzen</surname> <given-names>C</given-names>
</name>
<name>
<surname>Vialat</surname> <given-names>P</given-names>
</name>
<name>
<surname>Khun</surname> <given-names>H</given-names>
</name>
<name>
<surname>Pavlovic</surname> <given-names>J</given-names>
</name>
<name>
<surname>Huerre</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Genetic evidence for an interferon-antagonistic function of rift valley fever virus nonstructural protein NSs</article-title>. <source>J Virol</source> (<year>2001</year>) <volume>75</volume>:<page-range>1371&#x2013;7</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/JVI.75.3.1371-1377.2001</pub-id>
</citation>
</ref>
<ref id="B20">
<label>20</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>McGavran</surname> <given-names>MH</given-names>
</name>
<name>
<surname>Easterday</surname> <given-names>BC</given-names>
</name>
</person-group>. <article-title>Rift valley fever virus hepatitis: light and electron microscopic studies in the mouse</article-title>. <source>Fort Belvoir VA: Defense Tech Inf Center</source> (<year>1963</year>). doi: <pub-id pub-id-type="doi">10.21236/AD0410394</pub-id>
</citation>
</ref>
<ref id="B21">
<label>21</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Byrne</surname> <given-names>J</given-names>
</name>
<name>
<surname>Baker</surname> <given-names>K</given-names>
</name>
<name>
<surname>Houston</surname> <given-names>A</given-names>
</name>
<name>
<surname>Brint</surname> <given-names>E</given-names>
</name>
</person-group>. <article-title>IL-36 cytokines in inflammatory and Malignant diseases: not the new kid on the block anymore</article-title>. <source>Cell Mol Life Sci</source> (<year>2021</year>) <volume>78</volume>:<page-range>6215&#x2013;27</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00018-021-03909-4</pub-id>
</citation>
</ref>
<ref id="B22">
<label>22</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Elias</surname> <given-names>M</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>S</given-names>
</name>
<name>
<surname>Le</surname> <given-names>HT</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Neurath</surname> <given-names>MF</given-names>
</name>
<name>
<surname>Neufert</surname> <given-names>C</given-names>
</name>
<etal/>
</person-group>. <article-title>IL-36 in chronic inflammation and fibrosis - bridging the gap</article-title>? <source>J Clin Invest</source> (<year>2021</year>) <volume>131</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.1172/JCI144336</pub-id>
</citation>
</ref>
<ref id="B23">
<label>23</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kanda</surname> <given-names>T</given-names>
</name>
<name>
<surname>Nishida</surname> <given-names>A</given-names>
</name>
<name>
<surname>Takahashi</surname> <given-names>K</given-names>
</name>
<name>
<surname>Hidaka</surname> <given-names>K</given-names>
</name>
<name>
<surname>Imaeda</surname> <given-names>H</given-names>
</name>
<name>
<surname>Inatomi</surname> <given-names>O</given-names>
</name>
<etal/>
</person-group>. <article-title>Interleukin(IL)-36&#x3b1; and IL-36&#x3b3; Induce proinflammatory mediators from human colonic subepithelial myofibroblasts</article-title>. <source>Front Med (Lausanne)</source> (<year>2015</year>) <volume>2</volume>:<elocation-id>69</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fmed.2015.00069</pub-id>
</citation>
</ref>
<ref id="B24">
<label>24</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>X</given-names>
</name>
<name>
<surname>Yi</surname> <given-names>P</given-names>
</name>
<name>
<surname>Liang</surname> <given-names>Y</given-names>
</name>
</person-group>. <article-title>The role of IL-36 in infectious diseases: potential target for COVID-19</article-title>? <source>Front Immunol</source> (<year>2021</year>) <volume>12</volume>:<elocation-id>662266</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2021.662266</pub-id>
</citation>
</ref>
<ref id="B25">
<label>25</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Palomo</surname> <given-names>J</given-names>
</name>
<name>
<surname>Mastelic-Gavillet</surname> <given-names>B</given-names>
</name>
<name>
<surname>Woldt</surname> <given-names>E</given-names>
</name>
<name>
<surname>Troccaz</surname> <given-names>S</given-names>
</name>
<name>
<surname>Rodriguez</surname> <given-names>E</given-names>
</name>
<name>
<surname>Palmer</surname> <given-names>G</given-names>
</name>
<etal/>
</person-group>. <article-title>IL-36-induced toxicity in neonatal mice involves TNF-&#x3b1; Production by liver myeloid cells</article-title>. <source>J Immunol</source> (<year>2016</year>) <volume>197</volume>:<page-range>2239&#x2013;49</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.4049/jimmunol.1600700</pub-id>
</citation>
</ref>
<ref id="B26">
<label>26</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Winkle</surname> <given-names>SM</given-names>
</name>
<name>
<surname>Throop</surname> <given-names>AL</given-names>
</name>
<name>
<surname>Herbst-Kralovetz</surname> <given-names>MM</given-names>
</name>
</person-group>. <article-title>IL-36&#x3b3; Augments host defense and immune responses in human female reproductive tract epithelial cells</article-title>. <source>Front Microbiol</source> (<year>2016</year>) <volume>7</volume>:<elocation-id>955</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fmicb.2016.00955</pub-id>
</citation>
</ref>
<ref id="B27">
<label>27</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tsutsui</surname> <given-names>H</given-names>
</name>
<name>
<surname>Cai</surname> <given-names>X</given-names>
</name>
<name>
<surname>Hayashi</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>Interleukin-1 family cytokines in liver diseases</article-title>. <source>Mediators Inflammation</source> (<year>2015</year>) <volume>2015</volume>:<elocation-id>630265</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1155/2015/630265</pub-id>
</citation>
</ref>
<ref id="B28">
<label>28</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Towne</surname> <given-names>JE</given-names>
</name>
<name>
<surname>Renshaw</surname> <given-names>BR</given-names>
</name>
<name>
<surname>Douangpanya</surname> <given-names>J</given-names>
</name>
<name>
<surname>Lipsky</surname> <given-names>BP</given-names>
</name>
<name>
<surname>Shen</surname> <given-names>M</given-names>
</name>
<name>
<surname>Gabel</surname> <given-names>CA</given-names>
</name>
<etal/>
</person-group>. <article-title>Interleukin-36 (IL-36) ligands require processing for full agonist (IL-36&#x3b1;, IL-36&#x3b2;, and IL-36&#x3b3;) or antagonist (IL-36Ra) activity</article-title>. <source>J Biol Chem</source> (<year>2011</year>) <volume>286</volume>:<page-range>42594&#x2013;602</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1074/jbc.M111.267922</pub-id>
</citation>
</ref>
<ref id="B29">
<label>29</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>X</given-names>
</name>
<name>
<surname>Liang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>H</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>B</given-names>
</name>
<name>
<surname>Soong</surname> <given-names>L</given-names>
</name>
<name>
<surname>Cai</surname> <given-names>J</given-names>
</name>
<etal/>
</person-group>. <article-title>The protective role of IL-36/IL-36R signal in con A-induced acute hepatitis</article-title>. <source>J Immunol</source> (<year>2022</year>) <volume>208</volume>:<page-range>861&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.4049/jimmunol.2100481</pub-id>
</citation>
</ref>
<ref id="B30">
<label>30</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Yin</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>X</given-names>
</name>
<name>
<surname>Yan</surname> <given-names>X</given-names>
</name>
<name>
<surname>Xia</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>L</given-names>
</name>
<etal/>
</person-group>. <article-title>IL-36 induces cytokine IL-6 and chemokine CXCL8 expression in human lung tissue cells: Implications for pulmonary inflammatory responses</article-title>. <source>Cytokine</source> (<year>2017</year>) <volume>99</volume>:<page-range>114&#x2013;23</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.cyto.2017.08.022</pub-id>
</citation>
</ref>
<ref id="B31">
<label>31</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Foster</surname> <given-names>AM</given-names>
</name>
<name>
<surname>Baliwag</surname> <given-names>J</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>CS</given-names>
</name>
<name>
<surname>Guzman</surname> <given-names>AM</given-names>
</name>
<name>
<surname>Stoll</surname> <given-names>SW</given-names>
</name>
<name>
<surname>Gudjonsson</surname> <given-names>JE</given-names>
</name>
<etal/>
</person-group>. <article-title>IL-36 promotes myeloid cell infiltration, activation, and inflammatory activity in skin</article-title>. <source>J Immunol</source> (<year>2014</year>) <volume>192</volume>:<page-range>6053&#x2013;61</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.4049/jimmunol.1301481</pub-id>
</citation>
</ref>
<ref id="B32">
<label>32</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Queen</surname> <given-names>D</given-names>
</name>
<name>
<surname>Ediriweera</surname> <given-names>C</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>L</given-names>
</name>
</person-group>. <article-title>Function and regulation of IL-36 signaling in inflammatory diseases and cancer development</article-title>. <source>Front Cell Dev Biol</source> (<year>2019</year>) <volume>7</volume>:<elocation-id>317</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fcell.2019.00317</pub-id>
</citation>
</ref>
<ref id="B33">
<label>33</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vigne</surname> <given-names>S</given-names>
</name>
<name>
<surname>Palmer</surname> <given-names>G</given-names>
</name>
<name>
<surname>Lamacchia</surname> <given-names>C</given-names>
</name>
<name>
<surname>Martin</surname> <given-names>P</given-names>
</name>
<name>
<surname>Talabot-Ayer</surname> <given-names>D</given-names>
</name>
<name>
<surname>Rodriguez</surname> <given-names>E</given-names>
</name>
<etal/>
</person-group>. <article-title>IL-36R ligands are potent regulators of dendritic and T cells</article-title>. <source>Blood</source> (<year>2011</year>) <volume>118</volume>:<page-range>5813&#x2013;23</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1182/blood-2011-05-356873</pub-id>
</citation>
</ref>
<ref id="B34">
<label>34</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gabay</surname> <given-names>C</given-names>
</name>
<name>
<surname>Towne</surname> <given-names>JE</given-names>
</name>
</person-group>. <article-title>Regulation and function of interleukin-36 cytokines in homeostasis and pathological conditions</article-title>. <source>J Leukoc Biol</source> (<year>2015</year>) <volume>97</volume>:<page-range>645&#x2013;52</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1189/jlb.3RI1014-495R</pub-id>
</citation>
</ref>
<ref id="B35">
<label>35</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lian</surname> <given-names>L-H</given-names>
</name>
<name>
<surname>Milora</surname> <given-names>KA</given-names>
</name>
<name>
<surname>Manupipatpong</surname> <given-names>KK</given-names>
</name>
<name>
<surname>Jensen</surname> <given-names>LE</given-names>
</name>
</person-group>. <article-title>The double-stranded RNA analogue polyinosinic-polycytidylic acid induces keratinocyte pyroptosis and release of IL-36&#x3b3;</article-title>. <source>J Invest Dermatol</source> (<year>2012</year>) <volume>132</volume>:<page-range>1346&#x2013;53</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/jid.2011.482</pub-id>
</citation>
</ref>
<ref id="B36">
<label>36</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mitani</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Takaoka</surname> <given-names>A</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>SH</given-names>
</name>
<name>
<surname>Kato</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Yokochi</surname> <given-names>T</given-names>
</name>
<name>
<surname>Tanaka</surname> <given-names>N</given-names>
</name>
<etal/>
</person-group>. <article-title>Cross talk of the interferon-alpha/beta signalling complex with gp130 for effective interleukin-6 signalling</article-title>. <source>Genes Cells</source> (<year>2001</year>) <volume>6</volume>:<page-range>631&#x2013;40</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1046/j.1365-2443.2001.00448.x</pub-id>
</citation>
</ref>
<ref id="B37">
<label>37</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Waibler</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Anzaghe</surname> <given-names>M</given-names>
</name>
<name>
<surname>Ludwig</surname> <given-names>H</given-names>
</name>
<name>
<surname>Akira</surname> <given-names>S</given-names>
</name>
<name>
<surname>Weiss</surname> <given-names>S</given-names>
</name>
<name>
<surname>Sutter</surname> <given-names>G</given-names>
</name>
<etal/>
</person-group>. <article-title>Modified vaccinia virus Ankara induces Toll-like receptor-independent type I interferon responses</article-title>. <source>J Virol</source> (<year>2007</year>) <volume>81</volume>:<page-range>12102&#x2013;10</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/JVI.01190-07</pub-id>
</citation>
</ref>
<ref id="B38">
<label>38</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Malmgaard</surname> <given-names>L</given-names>
</name>
</person-group>. <article-title>Induction and regulation of IFNs during viral infections</article-title>. <source>J Interferon Cytokine Res</source> (<year>2004</year>) <volume>24</volume>:<page-range>439&#x2013;54</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1089/1079990041689665</pub-id>
</citation>
</ref>
<ref id="B39">
<label>39</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kochs</surname> <given-names>G</given-names>
</name>
<name>
<surname>Bauer</surname> <given-names>S</given-names>
</name>
<name>
<surname>Vogt</surname> <given-names>C</given-names>
</name>
<name>
<surname>Frenz</surname> <given-names>T</given-names>
</name>
<name>
<surname>Tschopp</surname> <given-names>J</given-names>
</name>
<name>
<surname>Kalinke</surname> <given-names>U</given-names>
</name>
<etal/>
</person-group>. <article-title>Thogoto virus infection induces sustained type I interferon responses that depend on RIG-I-like helicase signaling of conventional dendritic cells</article-title>. <source>J Virol</source> (<year>2010</year>) <volume>84</volume>:<page-range>12344&#x2013;50</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/JVI.00931-10</pub-id>
</citation>
</ref>
<ref id="B40">
<label>40</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Scheiermann</surname> <given-names>P</given-names>
</name>
<name>
<surname>Bachmann</surname> <given-names>M</given-names>
</name>
<name>
<surname>H&#xe4;rdle</surname> <given-names>L</given-names>
</name>
<name>
<surname>Pleli</surname> <given-names>T</given-names>
</name>
<name>
<surname>Piiper</surname> <given-names>A</given-names>
</name>
<name>
<surname>Zwissler</surname> <given-names>B</given-names>
</name>
<etal/>
</person-group>. <article-title>Application of IL-36 receptor antagonist weakens CCL20 expression and impairs recovery in the late phase of murine acetaminophen-induced liver injury</article-title>. <source>Sci Rep</source> (<year>2015</year>) <volume>5</volume>:<elocation-id>8521</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/srep08521</pub-id>
</citation>
</ref>
<ref id="B41">
<label>41</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Akira</surname> <given-names>S</given-names>
</name>
<name>
<surname>Uematsu</surname> <given-names>S</given-names>
</name>
<name>
<surname>Takeuchi</surname> <given-names>O</given-names>
</name>
</person-group>. <article-title>Pathogen recognition and innate immunity</article-title>. <source>Cell</source> (<year>2006</year>) <volume>124</volume>:<fpage>783</fpage>&#x2013;<lpage>801</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.cell.2006.02.015</pub-id>
</citation>
</ref>
<ref id="B42">
<label>42</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Takeuchi</surname> <given-names>O</given-names>
</name>
<name>
<surname>Akira</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>Pattern recognition receptors and inflammation</article-title>. <source>Cell</source> (<year>2010</year>) <volume>140</volume>:<page-range>805&#x2013;20</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.cell.2010.01.022</pub-id>
</citation>
</ref>
<ref id="B43">
<label>43</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Petrasek</surname> <given-names>J</given-names>
</name>
<name>
<surname>Bala</surname> <given-names>S</given-names>
</name>
<name>
<surname>Csak</surname> <given-names>T</given-names>
</name>
<name>
<surname>Lippai</surname> <given-names>D</given-names>
</name>
<name>
<surname>Kodys</surname> <given-names>K</given-names>
</name>
<name>
<surname>Menashy</surname> <given-names>V</given-names>
</name>
<etal/>
</person-group>. <article-title>IL-1 receptor antagonist ameliorates inflammasome-dependent alcoholic steatohepatitis in mice</article-title>. <source>J Clin Invest</source> (<year>2012</year>) <volume>122</volume>:<page-range>3476&#x2013;89</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1172/JCI60777</pub-id>
</citation>
</ref>
<ref id="B44">
<label>44</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Walsh</surname> <given-names>PT</given-names>
</name>
<name>
<surname>Fallon</surname> <given-names>PG</given-names>
</name>
</person-group>. <article-title>The emergence of the IL-36 cytokine family as novel targets for inflammatory diseases</article-title>. <source>Ann N Y Acad Sci</source> (<year>2018</year>) <volume>1417</volume>:<fpage>23</fpage>&#x2013;<lpage>34</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/nyas.13280</pub-id>
</citation>
</ref>
<ref id="B45">
<label>45</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kovach</surname> <given-names>MA</given-names>
</name>
<name>
<surname>Singer</surname> <given-names>BH</given-names>
</name>
<name>
<surname>Newstead</surname> <given-names>MW</given-names>
</name>
<name>
<surname>Zeng</surname> <given-names>X</given-names>
</name>
<name>
<surname>Moore</surname> <given-names>TA</given-names>
</name>
<name>
<surname>White</surname> <given-names>ES</given-names>
</name>
<etal/>
</person-group>. <article-title>IL-36&#x3b3; is secreted in microparticles and exosomes by lung macrophages in response to bacteria and bacterial components</article-title>. <source>J Leukoc Biol</source> (<year>2016</year>) <volume>100</volume>:<page-range>413&#x2013;21</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1189/jlb.4A0315-087R</pub-id>
</citation>
</ref>
<ref id="B46">
<label>46</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wein</surname> <given-names>AN</given-names>
</name>
<name>
<surname>Dunbar</surname> <given-names>PR</given-names>
</name>
<name>
<surname>McMaster</surname> <given-names>SR</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Z-RT</given-names>
</name>
<name>
<surname>Denning</surname> <given-names>TL</given-names>
</name>
<name>
<surname>Kohlmeier</surname> <given-names>JE</given-names>
</name>
</person-group>. <article-title>IL-36&#x3b3; Protects against severe influenza infection by promoting lung alveolar macrophage survival and limiting viral replication</article-title>. <source>J Immunol</source> (<year>2018</year>) <volume>201</volume>:<page-range>573&#x2013;82</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.4049/jimmunol.1701796</pub-id>
</citation>
</ref>
<ref id="B47">
<label>47</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>S</given-names>
</name>
<name>
<surname>Li</surname> <given-names>H</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Li</surname> <given-names>H</given-names>
</name>
<name>
<surname>Du</surname> <given-names>S</given-names>
</name>
<name>
<surname>Zou</surname> <given-names>X</given-names>
</name>
<etal/>
</person-group>. <article-title>High expression of IL-36&#x3b3; in influenza patients regulates interferon signaling pathway and causes programmed cell death during influenza virus infection</article-title>. <source>Front Immunol</source> (<year>2020</year>) <volume>11</volume>:<elocation-id>552606</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2020.552606</pub-id>
</citation>
</ref>
<ref id="B48">
<label>48</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gong</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Tingxi</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Qing</surname> <given-names>L</given-names>
</name>
<name>
<surname>Guozhen</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Bing</surname> <given-names>T</given-names>
</name>
<name>
<surname>Xiaoliang</surname> <given-names>Y</given-names>
</name>
<etal/>
</person-group>. <article-title>Elevated production of IL-36&#x3b1; in chronic hepatitis B virus-infected patients correlates with viral load</article-title>. <source>Microb Pathog</source> (<year>2017</year>) <volume>113</volume>:<page-range>412&#x2013;5</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.micpath.2017.11.023</pub-id>
</citation>
</ref>
<ref id="B49">
<label>49</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Peng</surname> <given-names>X</given-names>
</name>
<name>
<surname>Pan</surname> <given-names>X</given-names>
</name>
<name>
<surname>Tan</surname> <given-names>J</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Li</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Protective effect of interleukin-36 receptor antagonist on liver injury induced by concanavalin A in mice</article-title>. <source>Iran J Basic Med Sci</source> (<year>2020</year>) <volume>23</volume>:<page-range>623&#x2013;8</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.22038/ijbms.2020.35614.8492</pub-id>
</citation>
</ref>
<ref id="B50">
<label>50</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>H-X</given-names>
</name>
<name>
<surname>Li</surname> <given-names>X</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>N</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>X-L</given-names>
</name>
<etal/>
</person-group>. <article-title>Modulation of interleukin-36 based inflammatory feedback loop through the hepatocyte-derived IL-36R-P2X7R axis improves steatosis in alcoholic steatohepatitis</article-title>. <source>Br J Pharmacol</source> (<year>2022</year>) <volume>179</volume>:<page-range>4378&#x2013;99</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/bph.15858</pub-id>
</citation>
</ref>
<ref id="B51">
<label>51</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pinto</surname> <given-names>AK</given-names>
</name>
<name>
<surname>Ramos</surname> <given-names>HJ</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>X</given-names>
</name>
<name>
<surname>Aggarwal</surname> <given-names>S</given-names>
</name>
<name>
<surname>Shrestha</surname> <given-names>B</given-names>
</name>
<name>
<surname>Gorman</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Deficient IFN signaling by myeloid cells leads to MAVS-dependent virus-induced sepsis</article-title>. <source>PloS Pathog</source> (<year>2014</year>) <volume>10</volume>:<elocation-id>e1004086</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.ppat.1004086</pub-id>
</citation>
</ref>
<ref id="B52">
<label>52</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dutta</surname> <given-names>M</given-names>
</name>
<name>
<surname>Robertson</surname> <given-names>SJ</given-names>
</name>
<name>
<surname>Okumura</surname> <given-names>A</given-names>
</name>
<name>
<surname>Scott</surname> <given-names>DP</given-names>
</name>
<name>
<surname>Chang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Weiss</surname> <given-names>JM</given-names>
</name>
<etal/>
</person-group>. <article-title>A systems approach reveals MAVS signaling in myeloid cells as critical for resistance to ebola virus in murine models of infection</article-title>. <source>Cell Rep</source> (<year>2017</year>) <volume>18</volume>:<page-range>816&#x2013;29</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.celrep.2016.12.069</pub-id>
</citation>
</ref>
<ref id="B53">
<label>53</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Catapano</surname> <given-names>M</given-names>
</name>
<name>
<surname>Vergnano</surname> <given-names>M</given-names>
</name>
<name>
<surname>ROmano</surname> <given-names>M</given-names>
</name>
<name>
<surname>Mahil</surname> <given-names>SK</given-names>
</name>
<name>
<surname>Choon</surname> <given-names>S-E</given-names>
</name>
<name>
<surname>Burden</surname> <given-names>AD</given-names>
</name>
<etal/>
</person-group>. <article-title>IL-36 promotes systemic IFN-I responses in severe forms of psoriasis</article-title>. <source>J Invest Dermatol</source> (<year>2020</year>) <volume>140</volume>:<fpage>816</fpage>&#x2013;<lpage>826.e3</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jid.2019.08.444</pub-id>
</citation>
</ref>
<ref id="B54">
<label>54</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>P</given-names>
</name>
<name>
<surname>Gamero</surname> <given-names>AM</given-names>
</name>
<name>
<surname>Jensen</surname> <given-names>LE</given-names>
</name>
</person-group>. <article-title>IL-36 promotes anti-viral immunity by boosting sensitivity to IFN-&#x3b1;/&#x3b2; in IRF1 dependent and independent manners</article-title>. <source>Nat Commun</source> (<year>2019</year>) <volume>10</volume>:<fpage>4700</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41467-019-12318-y</pub-id>
</citation>
</ref>
</ref-list>
<glossary>
<title>Glossary</title>
<table-wrap position="anchor">
<table frame="hsides">
<tbody>
<tr>
<td>ALT</td>
<td>alanine aminotransferase</td>
</tr>
<tr>
<td>APAP</td>
<td>acetaminophen</td>
</tr>
<tr>
<td>CD</td>
<td>cluster of differentiation</td>
</tr>
<tr>
<td>cl</td>
<td>clone</td>
</tr>
<tr>
<td>ConA</td>
<td>concanavalin A</td>
</tr>
<tr>
<td>DC</td>
<td>dendritic cell(s)</td>
</tr>
<tr>
<td>D-GalN</td>
<td>d-galactosamine</td>
</tr>
<tr>
<td>ELISA</td>
<td>enzyme-linked immunosorbent assay</td>
</tr>
<tr>
<td>Figure</td>
<td>figure(s)</td>
</tr>
<tr>
<td>GFP</td>
<td>green fluorescent protein</td>
</tr>
<tr>
<td>HBV</td>
<td>hepatits B virus</td>
</tr>
<tr>
<td>hpi</td>
<td>hours post infection</td>
</tr>
<tr>
<td>HSV</td>
<td>herpes simplex virus</td>
</tr>
<tr>
<td>IAV</td>
<td>influenza A virus</td>
</tr>
<tr>
<td>IFN</td>
<td>type I interferon(s)</td>
</tr>
<tr>
<td>IFNAR</td>
<td>type I interferon receptor</td>
</tr>
<tr>
<td>IL</td>
<td>interleukin</td>
</tr>
<tr>
<td>IL-1RA</td>
<td>interleukin-1 receptor antagonist</td>
</tr>
<tr>
<td>IL-1RAcP</td>
<td>interleukin-1 receptor accessory protein</td>
</tr>
<tr>
<td>IL-36RA</td>
<td>interleukin-36 receptor antagonist</td>
</tr>
<tr>
<td>i.p.</td>
<td>intraperitoneal</td>
</tr>
<tr>
<td>ISG</td>
<td>IFN-stimulated gene(s)</td>
</tr>
<tr>
<td>i.v.</td>
<td>intravenously</td>
</tr>
<tr>
<td>LPS</td>
<td>lipopolysaccharide</td>
</tr>
<tr>
<td>MAVS</td>
<td>mitochondrial antiviral-signaling protein</td>
</tr>
<tr>
<td>MyD88</td>
<td>myeloid differentiation primary response 88</td>
</tr>
<tr>
<td>RVFV</td>
<td>Rift Valey fever virus</td>
</tr>
<tr>
<td>PAMP</td>
<td>pathogen associated molecular pattern</td>
</tr>
<tr>
<td>PBMC</td>
<td>peripheral mononuclear cells</td>
</tr>
<tr>
<td>PEC</td>
<td>peritoneal exudate cells</td>
</tr>
<tr>
<td>poly(I:C)</td>
<td>polyinosinic-polycytidylic acid</td>
</tr>
<tr>
<td>PRR</td>
<td>pattern recognition receptor(s)</td>
</tr>
<tr>
<td>RIG</td>
<td>retinoic acid-inducible gene</td>
</tr>
<tr>
<td>RLR</td>
<td>retinoic acid-inducible gene RIG-I-like receptors</td>
</tr>
<tr>
<td>SLE</td>
<td>systemic lupus erythematosus</td>
</tr>
<tr>
<td>TLR</td>
<td>toll like receptor(s)</td>
</tr>
<tr>
<td>WT</td>
<td>wildtype</td>
</tr>
</tbody>
</table>
</table-wrap>
</glossary>
</back>
</article>