The epitope regions of CR3022 and S309 were determined using the published structural data in protein data bank (PDB (40–43)) for the antibody complexed with SARS-CoV-2 viz. PDB id. 6W41 for CR3022 (41) and PDB id. 6WPS for S309 (42). All the amino acids in antigens that are within 5Å contact of amino acids of antibodies were considered as epitope residues. The position of the glycosylation site was determined by in-silico mutation of triplets of amino acids in the epitopes to glycosylation sequon – N-X-T (44) using the FoldX algorithm (43). Briefly, residues succeeding N-X motif, where X can be any amino acid except Pro, were mutated to either Threonine or Serine or residues preceding X-T, where X can be any amino acid except Pro, were mutated to Asn to generate novel N-X-T/S motifs. The mutations with the least energy cost, as calculated by the Build module of FoldX, were selected for designing M7 and M8.

HEK293T cells and DF-1 cells were maintained and grown in Dulbecco’s MEM (DMEM) supplemented with 10% Fetal Calf Serum (FCS) and 1% Penicillin/Streptomycin (Pen/Strep) at 37°C and 5% CO₂ in a humidified incubator. For the generation of recombinant MVAs the AGE1.CR.pIX cell line was used (ProBioGen AG, Berlin). Adherent AGE1.CR.pIX cells were maintained in DMEM-F12 medium supplemented with 5% bovine serum (γ-irradiated, Sigma Aldrich/Merck, 12003C) and 2 mM GlutaMAX I (10565-018)).

Lentiviral pseudotypes were produced by transient transfection of HEK293T/17 cells with packaging plasmids p8.91 (45, 46) and pCSFLW (47) and different SARS-CoV-2 VOC spike-bearing expression plasmids using the Fugene-HD transfection reagent (48, 49). Supernatants were harvested after 48h, passed through a 0.45 µm cellulose acetate filter and titrated on HEK293T/17 cells transiently expressing human ACE-2 and TMPRSS2. Target HEK293T/17 cells were transfected 24h prior with 2 µg pCAGGS-huACE-2 and 75 ng pCAGGS-TMPRSS2 (16, 50).

For live virus experiments and challenge the strain Australia/VIC01/2020 was used (51), representing one of the early strains of SARS-CoV-2 B type. Australia/VIC01/2020 was obtained from the University of Melbourne through Public Health England.

The sequence encoding the full-length SARS-CoV-2 spike gene (EPI_ISL_402119) and the SARS-CoV-2 RBD variants M7 and M8 were codon optimised and synthesised by Geneart/Thermo Fisher (Regensburg, Germany). The antigen encoding the SARS-CoV-2 RBD wt was amplified from the full-length SARS-CoV-2 spike gene by PCR. The antigens expressing SARS-CoV-2 RBD wt, RBD M7 and RBD M8 were cloned into the DNA expression vector pURVac via restriction digestion. The pURVac DNA expression vector includes a strong human cytomegalovirus (CMV) promoter to initiate transcription of the encoded antigen in combination with a human T-cell leukaemia virus-1 (HTLV-1) regulatory element and a bovine growth hormone poly-A terminator. Sequences were verified using Sanger Sequencing. The DNA vaccine vectors were purified using the EndoFree Plasmid Mega kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions.

DNA plasmids expressing SARS-CoV-2 RBD wt and the various SARS-CoV-2 RBD VOC variants were cloned into a modified pcDNA5/FRT/TO encoding a minimal N-terminal tPA signal peptide and a C-terminal avi-hexahistidine tag. Proteins were expressed and purified essentially as described earlier (52). In brief, DNA plasmids encoding the above RBD variants were transfected into Expi293 cells (Thermo Fisher Scientific) using the commercial ExpiFectamineTM protocol according to the manufacturer’s recommendations. Supernatants were harvested after incubation for five days in an orbital shaker (37°C, 8% CO₂, 90 rpm). For harvesting, the culture was centrifuged twice for 20 min at 1000 x g at 4°C. The supernatant was filtered using a 0.22 µm sterile filter and preserved by adding 0.05% (w/v) sodium azide. The soluble RBD protein was purified from the supernatant by immobilised metal ion chromatography (IMAC). The supernatant was loaded twice onto a 5 ml immobilised metal chelate affinity chromatography HisTrap™ Excel column (HisTrap Excel, GE Healthcare) with a flow rate of 1 ml/min followed by recirculation overnight at 4°C using a peristaltic pump. The column was washed with 10 column volumes (50 ml) of 20 mM imidazole in PBS. The protein was eluted by gradually increasing the concentration from 20 mM to 400 mM using a FPLC device (ÄKTA, GE Healthcare). The peak fractions were collected, pooled, and analysed under reducing conditions by SDS (sodium dodecyl sulphate) polyacrylamide gel electrophoresis. For buffer exchange the fractions containing the protein were dialyzed against PBS three times using a Slide-A-Lyzer^® 3,5K Dialysis Cassette (Thermo Fisher). For concentrating the protein, the protein solution was added to ultrafiltration devices (Amicon Ultra-15 centrifugal filters, Merck Millipore) with a molecular cutoff of 10 kDa and centrifuged at 4000 rpm.

For the generation of recombinant MVA expressing SARS-CoV-2 RBD wt and RBD M7 the shuttle vectors pMVA Trans TK-SARS-2 RBD wt and pMVA Trans TK SARS-2 RBD M7 were cloned. The MVA shuttle vectors were designed in a way that the antigens SARS-CoV-2 RBD wt and SARS-CoV-2 RBD M7 antigens can be inserted into the thymidine kinase (TK) locus J2R of the parental virus MVA CR19 TK-GFP under the transcriptional control of the early/late modified H5 promoter (mH5) via homologous recombination. The MVA shuttle vectors also include the reporter gene β-galactosidase (β-Gal) between the two left arm sequences of the TK locus for screening of recombinant MVAs. After several plaque purification rounds the reporter gene is lost by internal homologous recombination events resulting in a pure (reporter-free) recombinant MVA.

The MVA strain used in this study is MVA CR19 (53, 54). For in vivo recombination, adherent AGE1.CR.pIX (1 x 10⁶ cells) were infected with parental MVA CR19 TK-GFP with different MOIs ranging from 0.5 to 0.006, incubated for 2 h, followed by transfection with 0.4 µg of the shuttle vector pMVA Trans-TK-SARS-CoV-2 RBD wt or pMVA Trans-TK SARS-CoV-2 RBD M7 using Effectene (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. After 48 h, the cells were harvested and lysed by three freeze-thaw-cycles and sonication. Pure recombinant MVAs were obtained by sequential agarose plaque purification.

Recombinant MVAs express the SARS-CoV-2 RBD variants and a β-galactosidase reporter gene out of the TK-locus. These viruses were identified and selected for further five plaque purification rounds by staining infected cells with X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside) until no remaining parental MVA-CR19 TK-GFP virus was detected by PCR screening. The coexpressed β-galactosidase reporter gene is placed between two homologous left arm regions of the TK locus. Three additional plaque purification rounds were performed during which the reporter was deleted via internal homologous recombination events. The recombinant MVAs encoding SARS-CoV-2 RBD wt or SARS-CoV-2 RBD M7 were plaque purified for another three rounds and the resulting recombinant MVA virus stock was grown on AGE1.CR.pIX cells, purified via two ultracentrifugation rounds over a 35% sucrose cushion and titrated on DF-1 cells using crystal violet staining. The sequence of the rMVA and absence of non-recombinant MVA was confirmed using PCR amplification, followed by Sanger sequencing. The expression of SARS-CoV-2 RBD wt and SARS-CoV-2 RBD M7 was confirmed by Western blot analysis in HEK 293 T cells infected with a MOI of 2 and harvested after 24 h.

To confirm that the antigen SARS-CoV-2 RBD P521N was inserted correctly into the TK locus of MVA-CR19-TK-GFP, genomic DNA was extracted from infected AGE1.CR.pIX cells in each plaque purification round using the Quick-DNA Miniprep Kit from Zymo Research according to the manufacturer’s instructions. The correct integration into the TK locus was verified by PCR analysis using primers flanking the TK locus. PCR products were separated on a 1% agarose gel, excised, and the expected sequence confirmed by Sanger sequencing.

For expression analysis by Western blot, cells were lysed in TDLB buffer (50 mM Tris, pH 8.0, 150 mM NaCl, 0.1% SDS, 1% Nonidet P-40, 0.5% sodium deoxycholate) supplemented with protease inhibitors (Complete Mini, Roche, Basel, Swiss). Total protein concentration of the supernatants was determined by Bradford assay (Protein Assay, BioRad, Feldkirchen, Germany). For soluble proteins precipitation with trichloroacetic acid solution was performed as described by Koontz et al., 2014 (55). The proteins were separated on SDS-PAGE under reducing conditions and blotted on a nitrocellulose membrane. The membranes were stained with a primary antibody, the anti-SARS-CoV-2 spike antibody, as a primary antibody. An HRP-labelled secondary antibody and Femto ECL (Thermo Fisher, Waltham, USA) were used for detection in a Chemilux Pro device (Intas, Göttingen, Germany).

8–10-week-old BALB/c female mice (Charles River) were immunised with DNA or MVA constructs bearing the gene of interest, and serial bleeds were taken from the saphenous vein. Terminal bleeds were taken via cardiac puncture under isofluorane anaesthesia. For challenge studies, animals were transduced with 1x10⁷ PFU of the ad5-huACE-2 vector in a volume of 75ul by intranasal route (University of Iowa, Viral Vector Core) five days before infection with SARS-CoV-2. Mice were then moved to hermetically sealed isocages at containment level 3 and administered 1x10⁴ PFU of Australia/VIC01/2020 (SARS-CoV-2) by intranasal route under light isofluorane anaesthesia, in a total volume of 40 µl PBS. Animals were weighed and checked twice daily for clinical symptoms and culled on days 3 and 6 post infection by terminal bleed under non recovery anaesthesia. All animal work was approved by the Home Office under project licence P8143424B and approved by the Animal Welfare Ethical Review Body (AWERB). Animal experiments were performed in early 2020 when K18-huACE2 mice colonies were being expanded and were not available.

Mouse lungs frozen in PBS at the time of culling were thawed under containment level 3 conditions and homogenised through a 50 µm cell strainer (Corning) with 1 ml of PBS. The resulting supernatant was centrifuged at 1500 x g for 10 minutes, and 140 µl of the supernatant taken for RNA extraction. RNA extraction from the supernatant was performed using Qiamp viral RNA Mini Kit (Qiagen) following the manufacturer’s instructions. 5 µl of the RNA extraction final elution was reverse-transcribed to cDNA and amplified according to the manufacturer’s protocol using TaqMan™ Fast Virus 1-Step Master Mix (ThermoFisher Scientific). The primer pair was as follows: F-5’CAGGTATATGCGCTAGTTATCAGAC-3’ and R-5’CCAAGTGACATAGTGTAGGAATG3’. The probe used was as follows: 5’[6FAM]AGACTAATTCTCCTCGGCGGGCACG[TAM]3’ (Sigma Aldrich). Analysis was performed using the Rotor-Gene 6000 Series Software 1.7 (Corbett Life Sciences, Qiagen). As controls, RNA standards were produced by cloning a 97 nucleotide fragment of the spike open reading frame into the pJET1.2 vector (Invitrogen). This was linearised with HindIII and RNA transcripts made using T7 Ribomax Express Large Scale RNA production 17, under a CC By 4.0 international licence. Transcripts were purified using RNA Clean and Concentrator (Zymo Research) and integrity confirmed by gel electrophoresis.

Pseudotype based microneutralisation assay was performed as described previously ⁵⁹. Briefly, serial dilutions of serum were incubated with SARS-CoV-2 spike bearing lentiviral pseudotypes for 1h at 37°C, 5% CO₂ in 96-well white cell culture plates. 1.5x10⁴ HEK293T/17 transiently expressing human ACE-2 and TMPRSS2 were then added per well and plates incubated for 48h at 37°C, 5% CO₂ in a humidified incubator. Bright-Glo (Promega) was then added to each well and luminescence was read after a five-minute incubation period. Experimental data points were normalised to 100% and 0% neutralisation controls and non-linear regression analysis performed to produce neutralisation curves and associated IC₅₀ values.

Enzyme linked immunosorbent assay was carried out based on published techniques (52, 56). Briefly, 96-well maxisorp plates were coated with SARS-CoV-2 RBD overnight at 1 µg/ml and 50 µl per well. Plates were blocked with 200 µl of 3% non-fat milk with shaking, at room temperature for 1 h. Serum sample dilution series in 1% non-fat milk were performed in dilution plates, and transferred to blocked plates, then incubated for 2h at room temperature with shaking. Plates were then washed three times with PBST and anti-mouse IgG conjugated to horseradish peroxidase (Jackson Immuno, USA) added at a 1:3000 dilution. Plates were incubated for 1h at room temperature, in the dark with shaking. Plates were then washed three times with PBST and 50 µl TMB solution added per well. Reactions were quenched after 2-3 minutes in the dark using 2N H₂SO₄, and plates read at 450 nm with a Biorad plate reader. AUC values were generated using Prism GraphPad 9.3.1.

All data was processed, and statistical analyses performed using GraphPad Prism 9.2.

Glycan engineering of antigenic epitope regions has been shown to focus and facilitate the induction of immune responses to certain epitopes and enhance the elicitation of neutralising antibodies by either shielding of non-neutralising epitopes and/or exposing and focusing antibodies to conserved neutralising epitope-rich regions (22). To design modified SARS-CoV-2 RBD antigens, we added or removed N-linked glycosylation sites to the SARS-CoV-2 RBD (WA-1/2020) to mask or expose epitopes described by defined mAbs. Three epitope regions of the class 1 monoclonal antibody (mAb) B38 (57) ( Figure 1A , shown in red brown), class 3 mAb CR3022 (41) ( Figure 1A , shown in yellow) and class 4 S309 (42) ( Figure 1A , shown in grey) were selected for glycan masking. The epitope regions of the mAb CR3022 and mAb S309 are outside of the SARS-CoV-2 receptor binding motif (RBM) which is known to be recognised by many antibodies in convalescent sera from SARS-CoV-2 infected individuals (58), while the epitope region of B38 overlaps with the RBM. The S309 mAb has been shown to bind and neutralise SARS-CoV-1 and SARS-CoV-2, whereas the CR3022 mAb will bind to the RBD of both spikes, but only neutralises SARS-CoV-1 (41). The S309 binding epitope has two naturally occurring N-linked glycosylation sites at position 331 and 343 ( Figures 1B, C ), while the CR3022 epitope site is devoid of any glycan. Interestingly, the CR3022 epitope has one glycosylation site in SARS-CoV-1. To understand the effect of glycosylation modifications on the overall immune response to SARS-CoV-2 RBD, two SARS-CoV-2 glycan mutants, namely SARS-CoV-2 RBD M7 (henceforth referred as M7) and SARS-CoV-2 RBD M8 (henceforth referred as M8) ( Figures 1B, C ) were engineered. In M7, an additional glycan was added at position 521(P521N) located in the epitope region of CR3022 ( Figures 1B, C ). The SARS-CoV-2 RBD M8 was engineered by removing the two natural glycans at position 331(N331Q) and 343 (N342Q) located in the S309 epitope and addition of a glycan at position 370 by introducing mutation A372T that is known to be present in the CR3022 epitope of SARS-CoV-1 ( Figures 1B, C ). Multiple sequence alignment of SARS-CoV-2 RBD of WA-1/2020, Alpha, Beta, Gamma, Delta, and Omicron (BA.1) with M7 and M8 shows that the mutations introduced in these two designs have not yet been observed in any of the VOCs ( Figure 1D ).

For in vitro characterisation of the DNA-based glycan engineered M7 and M8, total cell lysates from HEK293T cells were prepared 48 h after transfection, followed by Western blot analysis. Staining of the membrane with a polyclonal SARS-CoV-2 rabbit antibody showed that all the DNA constructs were successfully expressed at the expected band of approximately of 35 kDa. M7 appears in the immunoblot blot slightly higher due to the addition of a glycan, whereas M8 runs slightly lower due to the removal of glycosylation sites compared to the SARS-CoV-2 RBD wt protein ( Figure 2A ). To evaluate the immunogenicity of the DNA vaccine candidates M7 and M8 in comparison to the original SARS-CoV-2 vaccine strain based on the original WA-1/2020 sequence, BALB/c mice (n=6) were vaccinated with 50 µg of the DNA vaccine construct expressing M7, M8 or wild type SARS-CoV-2 RBD subcutaneously four times at two-week intervals ( Figure 2B ). An overview of the SARS-CoV-2 RBD DNA vaccine constructs including the mutations for each construct is provided in Table 1 . Blood samples were collected every two weeks and analysed for both binding antibodies (bAb) and neutralising (nAb) using SARS-CoV-2 RBD based direct ELISA and pseudovirus neutralisation assay against SARS-CoV-2, respectively.

After the first DNA immunisation (2 weeks post immunisation), no significant difference was observed in the levels of bAb ( Figure 2C ) and nAb titres ( Figure 2D ) induced by the M7 and RBD wt vaccine construct, whereas M8 elicited weaker bAb and nAb responses in comparison to both M7 and wt SARS-CoV-2 RBD ( Figures 2C, D ). Interestingly, after the fourth and last DNA immunisation, mice immunised with M7 generated significantly lower bAb titre (p=0.04) in comparison to sera after first immunisation, while M8 generated comparable bAb titre after first and last immunisation ( Supplementary Figure 1A ). However, nAb titres were significantly increased for both RBD M7 (p=0.009) and RBD M8 (p=0.002) after four immunisations in comparison to first immunisation, indicating the impact of four DNA immunizations and affinity maturation ( Supplementary Figure 1B ). Both bAb and nAb titres for M7 were comparable to RBD wt after four immunisations ( Figures 2F, G ), while M8 generated substantially lower bAb ( Figure 2F ) and nAb ( Figure 2G ) in comparison to wt SARS-CoV-2 RBD but comparable bAb to M7. We calculated the ratio of IC₅₀ and AUC values, to enumerate the proportion of nAb for a given bAb titre. The observation of different ratios of bAb and nAb between M7, M8, and wt SARS-CoV-2 RBD at week 2 ( Figure 2E ) and week 8 ( Figure 2H ), suggest that masking of the CR3022 epitope via the addition of a glycan at position 521 induces a trend towards a greater proportion of neutralising antibodies for a given bAb titre while the de-masking of S309 epitope by removing the glycan position at 331 and 343 and simultaneous introduction of glycan at position 372, reduces both the bAb as well as nAb. Taken together, the SARS-CoV-2 RBD wt construct induced homologous bAbs, whereas the SARS-CoV-2 RBD M7 was capable to elicit heterologous bAbs and therefore to focus and direct immune response to the neutralising epitopes through shielding of the CR3022 epitope. As the M8 construct elicited weaker bAbs ( Figure 2F ) and nAbs ( Figure 2G ) the construct was excluded from further studies.

Since MVA as a recombinant viral vector is known to effectively boost DNA-primed specific immune responses against multiple infectious diseases (59, 60), recombinant MVAs were generated encoding the SARS-CoV-2 wt RBD and M7. ( Figure 3A ). The antigens were integrated into the TK locus of the CR19 MVA genome ( Figure 3A ). MVA CR19 is a novel, genetically stable MVA strain that replicates to very high titres (in the range of 10⁹ IU/mL) in the AGE1.CR.pIX production cell line (54). Compared to wild-type MVA, CR19 releases a larger number of infectious particles into the culture supernatant resulting in higher yields (53). MVA-CR19 is furthermore genetically characterized by a recombination where the left terminal region is replaced by the right terminal region. The result is an expansion of terminal homology from 15 kb to 27 kb, loss of three genes previously encoded in the left and duplication of the gene dosis for 9 genes encoded in the right ITR. Expression of the antigens was tested by Western blot analysis in HEK293T cells infected with MVA CR19 TK SARS-CoV-2 wt RBD and MVA CR19 TK M7 at a MOI of 2. Cells were lysed for expression analysis 24 h post infection. The immunoblot stained with a polyclonal SARS-CoV-2 S specific rabbit antibody revealed good antigen expression of both recombinant MVAs with a band around 35 kDa for MVA CR19 TK SARS-CoV-2 RBD wt and a slightly larger band for the glycan engineered MVA CR19 TK M7 ( Figure 3B ).

To evaluate whether a heterologous DNA prime/MVA boost regimen can induce higher and long-lasting broadly neutralising antibodies against VOCs, BALB/c mice (n=6) were immunised subcutaneously with 50 µg of DNA vaccines encoding SARS-CoV-2 RBD wt or SARS-CoV-2 RBD M7 on day 0. At week 4, the mice were either immunised subcutaneously with 50 µg of DNA vaccines encoding SARS-CoV-2 RBD wt or SARS-CoV-2 RBD M7 or were vaccinated intramuscularly with a heterologous MVA boost using MVA SARS-CoV-2 RBD wt or MVA SARS-CoV-2 RBD M7 at with a dose 2x 10⁷ pfu per animal, respectively. The bleeds were collected 2 weeks after each immunisation. To evaluate longevity and durability of binding and neutralising antibodies after homologous and heterologous prime/boost immunisation, the terminal bleed at week 11 was analysed ( Figure 4A ). Therefore, the sera were tested by direct RBD ELISA regarding the induction of bAbs against WA-1/2020 B.1, Alpha B.1.1.7, Beta B.1.351, Gamma P.1, Delta B.1.617.2, and Omicron BA.1 RBD. Interestingly, the titres of anti-SARS-CoV-2 RBD binding antibodies at week 11 were significantly higher across all the tested VOCs in mice that received a boost with MVA ( Figure 4B , Supplementary Figure 2 ). Comparing MVA SARS-CoV-2 RBD wt and RBD M7 across all VOCs, significantly higher binding antibody titres are observed for RBD M7 for WA-1/2020 (p=0.02), Alpha B.1.1.7 (p=0.002), Gamma P.1 (p=0.02) and Delta B.1.617.2 (p=0.02) ( Figure 4B , Supplementary Figure 2 ), while comparable binding antibody titres are observed for Beta B.1.351 and Omicron BA.1.

To measure the impact of a heterologous DNA prime/MVA boost immunisation on the induction of higher, and long lasting broadly neutralising antibody, mice sera from week 11 were evaluated against WA-1/2020 B, Alpha B.1.1.7, Beta B.1.351, Gamma P.1, Delta B.1.617.2 and Omicron BA.1 using lentiviral pseudotype microneutralisation assays. The neutralising antibody response showed same trend as the binding antibody levels measured by direct RBD ELISA, with a significant increase for mice that received a heterologous MVA boost versus mice that were vaccinated two times with DNA vaccine ( Figure 4C , Supplementary Figure 3 ). Higher nAb titres were observed for WA-1/2020, Gamma, and Delta for MVA M7 in comparison to MVA wt but comparable nAb were observed for Alpha, Beta, and Omicron ( Supplementary Figure 3 ). A log fold decrease in the both the bAb and nAb for omicron is expected due to the high number of mutations in RBD region of omicron including the S309 and CR3022 epiotopes.

In conclusion, SARS-CoV-2 RBD M7 DNA prime followed by a MVA boost was clearly superior to two times DNA immunisation and induced higher and more cross-reactive titres binding and neutralising antibodies against all the tested VOCs and were still relatively high 7 weeks after the MVA boost.

To investigate whether a homologous SARS-CoV-2 RBD M7 DNA prime/DNA boost or heterologous SARS-CoV-2 RBD M7 DNA prime/MVA boost regimen can provide protection from SARS-CoV-2 wild type live virus, a challenge study using human ACE2 transduced BALB/c mice was carried out. For immunisation one group of BALB/c mice (n=12) received two doses of 50 µg of the SARS-CoV-2 M7 DNA vaccine subcutaneously, whereas another group of BALB/c mice (n=12) was vaccinated using a heterologous SARS-CoV-2 RBD M7 DNA prime/MVA boost vaccination regimen with 2x10⁷ pfu (plaque forming unit) intramuscularly at day 0 and week 4. The study was set up longitudinally and sera were collected 2 weeks after each immunization, followed by week 16 and 18 and the terminal bleed 6 days post challenge (d.p.c) ( Figure 5A ).

To confirm the durability and waning immunity over time, sera from the longitudinal challenge study were analysed for their binding and neutralising capacity across all variants. After the prime immunisation with DNA, bAb responses were detected in 7/12 mice in the DNA/DNA group whereas 9/12 mice in the DNA/MVA group showed binding antibodies against SARS-CoV-2 ( Figure 5B ). The neutralising antibody response against SARS-CoV-2 was low after priming with DNA ( Figure 5C ). After the boost with either DNA or MVA, both the binding and neutralising antibodies increased with a steady level of nAb till week 16, following which a drop in nAb is observed ( Figures 5B, C ). As previously, both bAb ( Figure 5A ) (p=0.014) and nAb responses ( Figure 5B ) (p=0.003) were significantly higher in the MVA boosted group compared to the DNA boosted group at week 6.

Mice were rendered susceptible to SARS-CoV-2 by intranasal administration of Ad5-huACE-2 construct and challenged five days later with 1x10⁴ pfu SARS-CoV-2 Australia/VIC01/2020. Due to the lack of published disease readouts in wild type mice at the time of challenge, even after Ad5-huACE-2 transduction, the decision was made to cull mice at days 3 and 6 post infection to measure virus replication in the lungs. An increase in nAb titres was observed in the terminal bleed sera, in line with a typical reaction to encountering the virus ( Figure 5C ). Terminal sera from mice were also tested against the SARS-CoV-2 VOCs - Beta, Gamma, Delta, and Omicron, with a subset of mice showing decreases in or abrogation of nAb, as expected based on the published literature, particularly to Gamma and Omicron ( Figure 5D ). In mice that received MVA boost, a significant increase in nAbs could be observed after challenge for WA-1/2020 \(p=0.02), Gamma P.1 (p=0.03) and Delta B.617.2 (p=0.004) compared to animals that were vaccinated twice with DNA ( Figure 5D ). As binding, and neutralising antibodies across all VOCs could be detected 14 weeks after the last immunisation and even just 1 week before challenge at week 18 ( Figure 5C ) suggested that the MVA boost induces a strong, broad, and longer lasting neutralising antibody response.

Mice that received a heterologous MVA boost showed some reduction of viral load in the lungs after challenge. In contrast, the mice that received DNA boost did not show any reduction of SARS-CoV-2 lung genome copies when compared to naïve controls ( Figure 5E ). An inverse correlation was observed between copies of SARS-CoV-2 in the lungs of infected mice and their respective bAb ( Figure 5F ) or nAb ( Figure 5G ) antibody titre (Pearson’s r2= -0.49 and -0.62 respectively, p=<0.0001), confirming a correlation between RBD-directed neutralising antibodies and the reduction of SARS-CoV-2 replication in the lungs. Challenged mice also showed a weak positive correlation between detected nAb and bAb responses (r2 = 0.44, p=<0.0001) ( Figure 5H ). These results confirm that neutralising antibodies generated in mice immunised with the glycan engineered M7 vaccine reduce viral load in the lungs in BALB/c mice in vivo.