<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Immunol.</journal-id>
<journal-title>Frontiers in Immunology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Immunol.</abbrev-journal-title>
<issn pub-type="epub">1664-3224</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fimmu.2023.1092824</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Immunology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Grouper cGAS is a negative regulator of STING-mediated interferon response</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Zhang</surname>
<given-names>Luhao</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhang</surname>
<given-names>Xin</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Liao</surname>
<given-names>Jiaming</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Xu</surname>
<given-names>Linting</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Kang</surname>
<given-names>Shaozhu</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Chen</surname>
<given-names>Hong</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Sun</surname>
<given-names>Mengshi</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1837948"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wu</surname>
<given-names>Siting</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Xu</surname>
<given-names>Zhuqing</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wei</surname>
<given-names>Shina</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/626825"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Qin</surname>
<given-names>Qiwei</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<xref ref-type="aff" rid="aff5">
<sup>5</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/521707"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Wei</surname>
<given-names>Jingguang</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff6">
<sup>6</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/637814"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>College of Marine Sciences, South China Agricultural University, Guangdong Laboratory for Lingnan Modern Agriculture</institution>, <addr-line>Guangzhou</addr-line>, <country>China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Guangdong Provincial Key Laboratory of Aquatic Animal Disease Control and Healthy Culture</institution>, <addr-line>Zhanjiang</addr-line>, <country>China</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Laboratory for Marine Biology and Biotechnology</institution>, <addr-line>Qingdao</addr-line>, <country>China</country>
</aff>
<aff id="aff4">
<sup>4</sup>
<institution>Pilot National Laboratory for Marine Science and Technology</institution>, <addr-line>Qingdao</addr-line>, <country>China</country>
</aff>
<aff id="aff5">
<sup>5</sup>
<institution>Southern Marine Science and Engineering Guangdong Laboratory</institution>, <addr-line>Zhuhai</addr-line>, <country>China</country>
</aff>
<aff id="aff6">
<sup>6</sup>
<institution>Department of Biological Sciences, National University of Singapore</institution>, <addr-line>Singapore</addr-line>, <country>Singapore</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Heng Chi, Ocean University of China, China</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Jian Zhang, Yantai University, China; Jia Cai, Guangdong Ocean University, China</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Qiwei Qin, <email xlink:href="mailto:qinqw@scau.edu.cn">qinqw@scau.edu.cn</email>; Jingguang Wei, <email xlink:href="mailto:weijg@scau.edu.cn">weijg@scau.edu.cn</email>
</p>
</fn>
<fn fn-type="other" id="fn002">
<p>This article was submitted to Molecular Innate Immunity, a section of the journal Frontiers in Immunology</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>07</day>
<month>02</month>
<year>2023</year>
</pub-date>
<pub-date pub-type="collection">
<year>2023</year>
</pub-date>
<volume>14</volume>
<elocation-id>1092824</elocation-id>
<history>
<date date-type="received">
<day>08</day>
<month>11</month>
<year>2022</year>
</date>
<date date-type="accepted">
<day>16</day>
<month>01</month>
<year>2023</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2023 Zhang, Zhang, Liao, Xu, Kang, Chen, Sun, Wu, Xu, Wei, Qin and Wei</copyright-statement>
<copyright-year>2023</copyright-year>
<copyright-holder>Zhang, Zhang, Liao, Xu, Kang, Chen, Sun, Wu, Xu, Wei, Qin and Wei</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>Cyclic GMP-AMP synthase (cGAS) is one of the classical pattern recognition receptors that recognizes mainly intracytoplasmic DNA. cGAS induces type I IFN responses to the cGAS-STING signaling pathway. To investigate the roles of cGAS-STING signaling pathway in grouper, a cGAS homolog (named EccGAS) was cloned and identified from orange-spotted grouper (<italic>Epinephelus coioides</italic>). The open reading frame (ORF) of EccGAS is 1695 bp, encodes 575 amino acids, and contains a Mab-21 typical structural domain. EccGAS is homologous to <italic>Sebastes umbrosus</italic> and humans at 71.8% and 41.49%, respectively. EccGAS mRNA is abundant in the blood, skin, and gills. It is uniformly distributed in the cytoplasm and colocalized in the endoplasmic reticulum and mitochondria. Silencing of EccGAS inhibited the replication of Singapore grouper iridovirus (SGIV) in grouper spleen (GS) cells and enhanced the expression of interferon-related factors. Furthermore, EccGAS inhibited EcSTING-mediated interferon response and interacted with EcSTING, EcTAK1, EcTBK1, and EcIRF3. These results suggest that EccGAS may be a negative regulator of the cGAS-STING signaling pathway of fish.</p>
</abstract>
<kwd-group>
<kwd>
<italic>Epinephelus coioides</italic>
</kwd>
<kwd>CGAS</kwd>
<kwd>SGIV</kwd>
<kwd>virus replication</kwd>
<kwd>STING</kwd>
</kwd-group>
<counts>
<fig-count count="7"/>
<table-count count="2"/>
<equation-count count="0"/>
<ref-count count="44"/>
<page-count count="12"/>
<word-count count="4831"/>
</counts>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>Groupers are one of the main economic fishes on the southeast coast of China and Southeast Asia. With the expansion of grouper aquaculture, the pollution in the water and the corresponding disease outbreaks are detrimental, threatening the aquaculture industry. In particular, the emergence of a major viral pathogen, Singapore Grouper Iridovirus (SGIV) has caused huge losses to aquaculture. SGIV belongs to <italic>Iridoviridae</italic>, the frog iridovirus genus (<italic>Ranavirus</italic>), and is a large cytoplasmic DNA virus, and can cause bleeding and swelling of the spleen of the fish. When grouper infected SGIV, the lethality rate can reach &gt; 90% in a week (<xref ref-type="bibr" rid="B1">1</xref>).</p>
<p>The innate immune system is the host defense mechanism that plays a critical role against damage caused by microorganisms, pathogens, and other harmful agents (<xref ref-type="bibr" rid="B2">2</xref>). When pathogens invade a host, the pattern recognition receptors (PRRs), as part of the host innate immune response, identify pathogen-associated molecular patterns (PAMPs), subsequently activating pro-inflammatory cytokines and interferons through a series of signaling cascades to suppress damage (<xref ref-type="bibr" rid="B2">2</xref>). PRRs are broadly classified into five classes: DNA receptors, Toll-like receptors (TLRs), NOD-like receptors, RIG-I-like receptors (RLRs), and C-type lectin receptors (<xref ref-type="bibr" rid="B3">3</xref>&#x2013;<xref ref-type="bibr" rid="B5">5</xref>). Among them, DNA receptors are an important class of PRRs that recognize foreign cytoplasmic DNA. The genetic material of many organisms, including viruses, is double-stranded DNA (dsDNA), thus DNA receptors recognize this foreign DNA in the cytoplasm, which is important in the intrinsic host immunity against viruses. Several host proteins have been identified as capable of recognizing double-stranded DNA, including TLR9 (<xref ref-type="bibr" rid="B6">6</xref>), Z-nucleic acid binding protein (DAI) (<xref ref-type="bibr" rid="B7">7</xref>), DEAD-box helicase (DDX)60 (<xref ref-type="bibr" rid="B8">8</xref>), DDX41 (<xref ref-type="bibr" rid="B9">9</xref>), Interferon gamma inducible protein 16 (IFI16) (<xref ref-type="bibr" rid="B10">10</xref>), and cGAS (cyclic guanosine-adenylate synthase) (<xref ref-type="bibr" rid="B11">11</xref>).</p>
<p>A widely recognized DNA receptor, cGAS, has been recognized in recent studies as a member of the nucleotidyltransferase (NTase) family (<xref ref-type="bibr" rid="B11">11</xref>). Notably, cGAS recognizes almost all double-stranded DNA as it does not depend on the nucleotide sequence. In mammals, cGAS consists of a nucleotidyltransferase domain and two DNA-binding domains at the N-terminal, the nucleotidyltransferase domain in the middle-conserved fragment, and the C-terminal Mab21 domain (<xref ref-type="bibr" rid="B11">11</xref>, <xref ref-type="bibr" rid="B12">12</xref>). When cGAS recognizes foreign DNA, the DNA is attracted by its positive surface charge and zinc finger structure, forming a 2:2 dimer between two cGAS and two dsDNA (<xref ref-type="bibr" rid="B12">12</xref>). In turn, cGAS is activated, resulting in its conformational change, and thus promoting the production of cGAMP from ATP and GTP (<xref ref-type="bibr" rid="B13">13</xref>). Subsequently, cGAMP binds to the interferon gene-stimulating protein STING, which translocates cGAMP from the endoplasmic reticulum to the Golgi apparatus, and, in turn, recruits TANK-binding kinase 1 (TBK1), phosphorylates IRF3 and nuclear factor-&#x3ba;B (NF-&#x3ba;B) to promote their entry into the nucleus. When IRF3 and NF-&#x3ba;B are translocated from the cytoplasm to the nucleus, IFN-&#x3b2; is expressed, and a large number of inflammatory factors and interleukins are produced (<xref ref-type="bibr" rid="B14">14</xref>, <xref ref-type="bibr" rid="B15">15</xref>).</p>
<p>In previous studies, a large number of expressed sequence tags (EST) were found in the transcriptome of the grouper spleen before and after infection with SGIV (<xref ref-type="bibr" rid="B14">14</xref>, <xref ref-type="bibr" rid="B15">15</xref>). In this study, a cGAS homolog from orange-spotted grouper (EccGAS) was cloned, and its roles in the innate immune response were investigated. The results will provide new and more effective insights for the prevention and treatment of viral infection.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<label>2</label>
<title>Materials and methods</title>
<sec id="s2_1">
<label>2.1</label>
<title>Fish, cells and virus</title>
<p>Juvenile grouper (40-50&#xa0;g in weight) were obtained from the fishery in Yangjiang City, China. They were stored in a recirculating seawater system at 24-28&#xb0;C and fed twice daily for two weeks. Then three groupers were randomly selected to detect whether the fish was infected with bacteria or viruses. Twelve tissues were extracted from 6 healthy fish, immediately frozen in liquid nitrogen, and stored at -80&#xb0;C.</p>
<p>Grouper spleen (GS) cells were constructed in our laboratory and are currently kept in our laboratory. GS cells were grown in Leibovitz L15 medium (Wibco, Waltham, MA, USA) containing 10% fetal bovine serum and placed in a 28&#xb0;C incubator (<xref ref-type="bibr" rid="B14">14</xref>, <xref ref-type="bibr" rid="B15">15</xref>). SGIV was isolated from diseased groupers and cultured as previously described (<xref ref-type="bibr" rid="B1">1</xref>, <xref ref-type="bibr" rid="B16">16</xref>). Viral cultures were maintained at -80&#xb0;C.</p>
</sec>
<sec id="s2_2">
<label>2.2</label>
<title>Antibodies</title>
<p>Rabbit monoclonal anti-green fluorescent protein (GFP) antibody was purchased from Sigma (Burlington, MA, USA), and mouse monoclonal anti-HA antibody was also purchased from Sigma (Burlington, MA, USA). Rabbit monoclonal &#x3b2;-tubulin antibody was purchased from Proteintech (Rosemont, IL, USA). Polyclonal antibody to SGIV protein MCP was prepared in our laboratory. Horseradish peroxidase-labeled goat anti-rabbit antibody as secondary antibody was purchased from KPL (USA).</p>
</sec>
<sec id="s2_3">
<label>2.3</label>
<title>Cloning of EccGAS and bioinformatic analysis</title>
<p>Primers used to amplify the open reading frame (ORF) of EccGAS were designed according to the EST sequences of cGAS in the grouper spleen transcriptome (<xref ref-type="bibr" rid="B1">1</xref>, <xref ref-type="bibr" rid="B16">16</xref>). The ORF of EccGAS was amplified from the tissue cDNA of healthy grouper. Sequences of EccGAS were analyzed using the BLAST program (<uri xlink:href="http://www.ncbi.nlm.nih.gov/blast">http://www.ncbi.nlm.nih.gov/blast</uri>), and the conservative domains were predicted using the conservative domain database (<uri xlink:href="https://www.ncbi.nlm.nih.gov/cdd/">https://www.ncbi.nlm.nih.gov/cdd/</uri>) of NCBI. SignalP 4.1 was used to predict signal peptides and TMHMM Server V. 2.0 was used to predict transmembrane regions. GeneDoc and Clustal X1.83 were used for amino acid sequences alignment of cGAS, and MEGA version 6.0 was used for phylogenetic tree analysis.</p>
</sec>
<sec id="s2_4">
<label>2.4</label>
<title>RNA isolation and qRT-PCR</title>
<p>Total RNA was performed using the SV Total RNA Isolation System (Promega, United States) following the manufacturer&#x2019;s instructions. cDNA synthesis was performed with the ReverTra Ace qPCR RT Kit (Toyobo, Osaka, Japan) according to the manufacturers&#x2019; instructions. SYBR<sup>&#xae;</sup> Green Real-Time PCR Master Mix (Toyobo) was used to perform the quantitative real-time PCR (qRT-PCR) in an Applied Biosystems QuantStudio 5 Real-Time PCR System (Thermo Fisher, Waltham, MA, USA), as previously described (<xref ref-type="bibr" rid="B17">17</xref>). Briefly, each assay was performed in triplicate with the cycling conditions as follows: 95&#xb0;C for 1&#xa0;min for activation, followed by 40 cycles of 95&#xb0;C for 15 s, 60&#xb0;C for 15 s, and 72&#xb0;C for 45 s. The primers of target genes are listed in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>, and &#x3b2;-actin was used as the internal reference gene. The expression levels were calculated using the 2<sup>&#x2013;&#x394;&#x394;CT</sup> method.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Primers used for host and viral genes expression analysis.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="center">Primers</th>
<th valign="middle" align="center">Sequences (5&#xb4;-3&#xb4;)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="center">IRF3-RT-F</td>
<td valign="bottom" align="center">GACAACAAGAACGACCCTGCTAA</td>
</tr>
<tr>
<td valign="middle" align="center">IRF3-RT-R</td>
<td valign="bottom" align="center">GGGAGTCCGCTTGAAGATAGACA</td>
</tr>
<tr>
<td valign="middle" align="center">IRF7-RT-F</td>
<td valign="bottom" align="center">CAACACCGGATACAACCAAG</td>
</tr>
<tr>
<td valign="middle" align="center">IRF7-RT-R</td>
<td valign="bottom" align="center">GTTCTCAACTGCTACATAGGG</td>
</tr>
<tr>
<td valign="middle" align="center">ISG15-RT-F</td>
<td valign="bottom" align="center">CCTATGACATCAAAGCTGACGAGAC</td>
</tr>
<tr>
<td valign="middle" align="center">ISG15-RT-R</td>
<td valign="bottom" align="center">GTGCTGTTGGCAGTGACGTTGTAGT</td>
</tr>
<tr>
<td valign="middle" align="center">ISG56-RT-F</td>
<td valign="bottom" align="center">CAGGCATGGTGGAGTGGAAC</td>
</tr>
<tr>
<td valign="middle" align="center">ISG56-RT-R</td>
<td valign="bottom" align="center">CTCAAGGTAGTGAACAGCGAGGTA</td>
</tr>
<tr>
<td valign="middle" align="center">Viperin-RT-F</td>
<td valign="bottom" align="center">TCTGGGTAAATTAGTCCAGTTC</td>
</tr>
<tr>
<td valign="middle" align="center">Viperin-RT-R</td>
<td valign="bottom" align="center">AGGTGTTGATGACCGAGTTG</td>
</tr>
<tr>
<td valign="middle" align="center">IL-1&#x3b2;-RT&#x2013;PF</td>
<td valign="bottom" align="center">AACCTCATCATCGCCACACA</td>
</tr>
<tr>
<td valign="middle" align="center">IL-1&#x3b2;-RT-PR</td>
<td valign="bottom" align="center">AGTTGCCTCACAACCGAACAC</td>
</tr>
<tr>
<td valign="middle" align="center">IL-8-RT-PF</td>
<td valign="bottom" align="center">GCCGTCAGTGAAGGGAGTCTAG</td>
</tr>
<tr>
<td valign="middle" align="center">IL-8-RT-PR</td>
<td valign="bottom" align="center">ATCGCAGTGGGAGTTTGCA</td>
</tr>
<tr>
<td valign="middle" align="center">TNF&#x3b1;-RT-F</td>
<td valign="bottom" align="center">GTGTCCTGCTGTTTGCTTGGTA</td>
</tr>
<tr>
<td valign="middle" align="center">TNF&#x3b1;-RT-R</td>
<td valign="bottom" align="center">CAGTGTCCGACTTGATTAGTGCTT</td>
</tr>
<tr>
<td valign="middle" align="center">PKR-F</td>
<td valign="bottom" align="center">GACCTTGGCTCTGTTGGACC</td>
</tr>
<tr>
<td valign="middle" align="center">PKR-R</td>
<td valign="bottom" align="center">ATGCTTGGCTTCTTTCTTGT</td>
</tr>
<tr>
<td valign="middle" align="center">IFN1-RT-F</td>
<td valign="bottom" align="center">GTGTCCTTCCCGAATCATCT</td>
</tr>
<tr>
<td valign="middle" align="center">IFN1-RT-R</td>
<td valign="bottom" align="center">ACAGCCTGCCTGCTTACAAC</td>
</tr>
<tr>
<td valign="middle" align="center">IFN2-RT-F</td>
<td valign="bottom" align="center">TACAGCCAGGCGTCCAAAGCATC</td>
</tr>
<tr>
<td valign="middle" align="center">IFN2-RT-R</td>
<td valign="bottom" align="center">CAGTACAGGAGCGAAGGCCGACA</td>
</tr>
<tr>
<td valign="middle" align="center">EccGAS-RT-F</td>
<td valign="middle" align="center">CGGGTTTCATTCTCTCAT</td>
</tr>
<tr>
<td valign="middle" align="center">EccGAS-RT-R</td>
<td valign="middle" align="center">AGGCACTCCAGTCTGTGT</td>
</tr>
<tr>
<td valign="middle" align="center">Actin-RT-R</td>
<td valign="middle" align="center">TACGAGCTGCCTGACGGACA</td>
</tr>
<tr>
<td valign="middle" align="center">Actin-RT-F</td>
<td valign="middle" align="center">GGCTGTGATCTCCTTCTGCA</td>
</tr>
<tr>
<td valign="middle" align="center">MCP-RT-F</td>
<td valign="middle" align="center">GCACGCTTCTCTCACCTTCA</td>
</tr>
<tr>
<td valign="middle" align="center">MCP-RT-R</td>
<td valign="middle" align="center">AACGGCAACGGGAGCACTA</td>
</tr>
<tr>
<td valign="middle" align="center">ICP18-RT-F</td>
<td valign="middle" align="center">ATCGGATCTACGTGGTTGG</td>
</tr>
<tr>
<td valign="middle" align="center">ICP18-RT-R</td>
<td valign="middle" align="center">CCGTCGTCGGTGTCTATTC</td>
</tr>
<tr>
<td valign="middle" align="center">VP19-RT-F</td>
<td valign="middle" align="center">TCCAAGGGAGAAACTGTAAG</td>
</tr>
<tr>
<td valign="middle" align="center">VP19-RT-R</td>
<td valign="middle" align="center">GGGGTAAGCGTGAAGACT</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_5">
<label>2.5</label>
<title>Preparation of antiserum of EccGAS</title>
<p>Primers were designed to amplify the ORF of EccGAS (<xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>). The PCR product was digested with BamH I and EcoR I (Takara) and subsequently subcloned into the expression vector pET-B2M. Positive clones were incubated at 37&#xb0;C, and shaked at 220 rpm in a 150 mL LB medium with 100 mg/mL ampicillin. The vector pET-B2M was used as a negative control. When OD600 of the medium reached 0.6, IPTG inducer (final concentration 0.5 mM) was added, and the culture was shaken at 37&#xb0;C for 3&#xa0;h. Recombinant EccGAS fusion proteins (named rEccGAS) were purified. The concentration of purified rEccGAS protein was determined <italic>via</italic> Bradford&#x2019;s method (<xref ref-type="bibr" rid="B18">18</xref>). The purified rEccGAS proteins were then used to immunize the New Zealand white rabbits to obtain polyclonal antibodies against EccGAS according to conventional methods (<xref ref-type="bibr" rid="B19">19</xref>). Western blot was used to detect the specificity of the antiserum.</p>
</sec>
<sec id="s2_6">
<label>2.6</label>
<title>Cell transfection</title>
<p>Cell transfection was performed with Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer&#x2019;s instructions. Briefly, cells were seeded into plates and changed to serum-free medium after the cell density had spread to 80%. Lipofectamine 2000 and plasmids were diluted with Opti-MEM (Gibco, USA) in two separate sterile tubes. After a 5-min incubation at 25&#xb0;C, Lipofectamine 2000 with the diluted plasmids were mixed gently and thoroughly. The mixture was then incubated at 25&#xb0;C for 25&#xa0;min before being added dropwise to the cells. After 5-6&#xa0;h, the medium was changed to serum medium to continue the culture (<xref ref-type="bibr" rid="B20">20</xref>).</p>
</sec>
<sec id="s2_7">
<label>2.7</label>
<title>Cell localization analysis</title>
<p>GS cells were seeded into 6-well plates containing coverslips (10 mm&#xd7;10 mm). When the cell density is appropriate, the plasmids are transfected. After 24&#xa0;h, cells were washed with phosphate-buffered saline and fixed with 4% paraformaldehyde or methanol for 1&#xa0;h. Cells were permeabilized with anhydrous ethanol for 15&#xa0;min at -20&#xb0;C and then blocked with 2% BAS (ready-to-use) for 2&#xa0;h at 25&#xb0;C. Cells were incubated with 1% BSA diluted with rabbit polyclonal anti-EccGAS antibody (1:150) or mouse monoclonal anti-HA antibody (1:150) for 2&#xa0;h. Cells were incubated for 2&#xa0;h with 1% BSA diluted with rabbit polyclonal anti-EccGAS antibody (1:150) or mouse monoclonal anti-HA antibody (1:150). Cells were then washed with phosphate-buffered saline. FITC-conjugated goat anti-rabbit or goat anti-mouse antibodies were diluted (1:200) with 1% BSA and incubated for 1&#xa0;h. Cells were then washed with phosphate-buffered saline and treated with 6-dibutylamino-2-phenylindole (DAPI) for 10&#xa0;min in the dark, and observed under a fluorescence microscope (Leica, Wetzlar, Germany).</p>
</sec>
<sec id="s2_8">
<label>2.8</label>
<title>Virus infection assay</title>
<p>Three siRNAs targeting EccGAS mRNA were designed to evaluate the mechanism of EccGAS on SGIV infection in GS cells (<xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>). Cells were transfected with the same volume of siRNA or control. The cells were infected with SGIV 24 hours later. The cells were then collected at 24&#xa0;h and 36&#xa0;h after SGIV infection. The expression levels of SGIV ICP18, VP19, and MCP were analyzed using qRT-PCR (<xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>). The expression of SGIV MCP protein was analyzed using western blotting.</p>
<table-wrap id="T2" position="float">
<label>Table&#xa0;2</label>
<caption>
<p>Primers used for silencing EccGAS.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="center">Primers</th>
<th valign="middle" align="center">Sequences (5&#xb4;-3&#xb4;)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="center">NC-F</td>
<td valign="middle" align="center">UUCUUCGAACGUGUCACGUTT</td>
</tr>
<tr>
<td valign="middle" align="center">NC-R</td>
<td valign="middle" align="center">ACGUGACACGUUCGGAGAATT</td>
</tr>
<tr>
<td valign="middle" align="center">EccGAS-siRNA-174-F</td>
<td valign="middle" align="center">GGAGAAGCCGUCUCUUCAATT</td>
</tr>
<tr>
<td valign="middle" align="center">EccGAS-siRNA-174-R</td>
<td valign="middle" align="center">UUGAAGAGACGGCUUCUCCTT</td>
</tr>
<tr>
<td valign="middle" align="center">EccGAS-siRNA-1042-F</td>
<td valign="middle" align="center">GCAGUGACCCUGACCACAATT</td>
</tr>
<tr>
<td valign="middle" align="center">EccGAS-siRNA-1042-R</td>
<td valign="middle" align="center">UUGUGGUCAGGGUCACUGCTT</td>
</tr>
<tr>
<td valign="middle" align="center">EccGAS-siRNA-1191-F</td>
<td valign="middle" align="center">GCGAAUGCCGUAUUAUCUUTT</td>
</tr>
<tr>
<td valign="middle" align="center">EccGAS-siRNA-1191-R</td>
<td valign="middle" align="center">AAGAUAAUACGGCAUUCGCTT</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_9">
<label>2.9</label>
<title>Dual-luciferase reporter assay</title>
<p>GS cells were plated in 24-well plates. When the cell density is appropriate, a total of 200 ng of zebrafish IFN1-LUc, human NF-&#x3ba;B-Luc, or human ISRE-Luc plasmids were co-transfected with 30 ng of the internal control PRL-sv40 reninase vectors and 600 ng of the target plasmids. After 36&#xa0;h, cells were collected, and the luciferase activity was detect by the Dual-Luciferase<sup>&#xae;</sup> Reporter Assay System (Promega).</p>
</sec>
<sec id="s2_10">
<label>2.10</label>
<title>Co-immunoprecipitation assays</title>
<p>GS cells were passaged into cell culture dishes (10cm&#xd7;10cm). When the cell density is appropriate, co-transfected with relevant the target plasmids. After 36&#xa0;h, cells were harvested and lysed in RIPA buffer containing protease and phosphatase inhibitors. Samples were processed using the Double Bead&#x2122; Protein G Immunoprecipitation Kit (Invitrogen).</p>
<p>10% SDS-PAGE was used to separate immunoprecipitates or whole cell extracts. Separated immunoprecipitates or whole cell extracts were then transferred to Immobilon-P polyvinylidene difluoride membranes (Millipore, St. Louis, MO, USA). The membranes were blocked in 5% skim milk incubated with antibodies for 2&#xa0;h at 25&#xb0;C or overnight at 4 &#xb0;C, washed 3 times with PBST, and incubated with secondary antibodies for 1&#xa0;h at 25&#xb0;C. After washing three times with PBST, the immunoreactive protein was visualized by an enhanced chemiluminescence detection kit (Bio-Rad, Irvine, CA, USA). The band intensity was calculated using Quantity-one software (<xref ref-type="bibr" rid="B21">21</xref>).</p>
</sec>
<sec id="s2_11">
<label>2.11</label>
<title>Statistical analysis</title>
<p>GraphPad Prism (version 8.0.2) was used to perform statistical analysis. Data analysis results are shown as mean &#xb1; standard error of the mean of three independent experiments. The statistically significant differences were evaluated by the T-Test with a P value (*P &lt; 0.05 and **P &lt; 0.01).</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<label>3</label>
<title>Results</title>
<sec id="s3_1">
<label>3.1</label>
<title>Amplification and sequence analysis of cGAS gene in grouper</title>
<p>The ORF of grouper cGAS (EccGAS) was 1695 bp in length, encoding 575 amino acids, with a molecular weight of approximately 63.05 kDa and an isoelectric point of 9.47. SMART analysis revealed that EccGAS contains the Mab-21 typical structural domain, while the signal peptide and transmembrane region were absent.</p>
<p>Aligning the cGAS proteins of other organisms with EccGAS revealed that the sequences of each species were relatively conserved in the Mab-21 typical structural domain, indicating that cGAS may have similar functions. The cGAS sequences of 11 species were selected for homology comparison, and the multiple sequence alignments were performed with Clustal X (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>). The phylogenetic tree showed that the EccGAS and cGAS of <italic>Sebastes umbrosus</italic> (XP_037637334.1) were more closely related and clustered together (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref>).</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Sequence analysis and phylogenetic tree construction of EccGAS. <bold>(A)</bold> Multiple sequence comparison of the amino acid of EccGAS and cGAS proteins from other organisms. The predicted conserved structural domain of Mab21 is shown. <bold>(B)</bold> Phylogenetic tree of EccGAS proteins. The numbers on the nodes indicate bootstrap values for 1000 replicates. Scale bars represent 0.1 change per site.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-14-1092824-g001.tif"/>
</fig>
<p>The expression of EccGAS in healthy grouper tissues showed that EccGAS was expressed in all exacted tissues, with higher expression in blood, skin, and gills (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>). After SGIV infection, the transcriptional expression level of EccGAS in GS cells gradually increased and peaked at 36&#xa0;h.p.i (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2B</bold>
</xref>), suggesting that EccGAS may play an important role in the activation of host antiviral innate immunity.</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Expression pattern analysis of EccGAS. <bold>(A)</bold> Expression of EccGAS in different tissues of healthy groupers. Data were expressed as a ratio of the tissue value to the EccGAS mRNA expression in liver. &#x3b2;-actin were used as the internal control for the normalization across tissues. <bold>(B)</bold> Expression profiles of EccGAS in GS cells after SGIV infection. &#x3b2;-actin was used as an internal control. *P &lt; 0.05. ns means no significance.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-14-1092824-g002.tif"/>
</fig>
</sec>
<sec id="s3_2">
<label>3.2</label>
<title>Bioassay of recombinant protein of EccGAS</title>
<p>The recombinant protein of EccGAS was analyzed by SDS-PAGE. A band of 57 kDa was visible using Komas Brilliant Blue staining (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref>). The fused recombinant EccGAS protein (rEccGAS) was purified by affinity chromatography with nickel-nitrilotriacetic acid-agarose (QIAGEN, Germany) according to the manufacturer&#x2019;s instructions (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3B</bold>
</xref>). Immunosera were then prepared by immunizing rabbits with rEccGAS protein. rEccGAS protein was specifically recognized by the EccGAS polyclonal antibody, and no bands were detected in the negative control (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3C</bold>
</xref>), indicating that the anti-EccGAS antibody specifically recognized the purified EccGAS protein.</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Production of recombinant EccGAS and anti-EccGAS serum. <bold>(A)</bold> Expression of recombinant EccGAS. M: protein molecular quality standard; 1: supernatant of pET-EccGAS induced by sonication; 2: microspheres of pET-EccGAS induced by sonication. <bold>(B)</bold> Purification of recombinant EccGAS. M: protein molecular quality standard; 1:purified recombinant pET-EccGAS protein. <bold>(C)</bold> Preparation of anti-EccGAS serum. M: protein molecular quality standard; 1: purified recombinant pET-EccGAS protein incubated with preimmune mouse serum; 2: purified recombinant pET-EccGAS protein incubated with anti-EccGAS serum (1:5000). Bands of EcCGA protein were boxed.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-14-1092824-g003.tif"/>
</fig>
</sec>
<sec id="s3_3">
<label>3.3</label>
<title>Intracellular localization of EccGAS</title>
<p>The expression vectors for full-length EccGAS, structural domain Mab21, and removal of the structural domain were constructed and named EccGAS(EccGAS), EccGAS-Mab21, and EccGAS-delete-mab21. Subsequently, the plasmids were transfected into GS cells, and intracellular localization of EccGAS was determined. The results showed that the green fluorescence of pEGFP-C1 was distributed in the cytoplasm and nucleus of GS cells, while the pEGFP-EccGAS and pEGFP-EccGAS-delete-mab21 were distributed uniformly in the cytoplasm, and pEGFP-EccGAS-Mab21 was distributed in the cytoplasm in an aggregated manner (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4A</bold>
</xref>). We next examined the intracellular localization of EccGAS in GS cells by immunofluorescence assay with anti-EccGAS serum. In GS cells, the green and red fluorescences of EccGAS were mainly localized in the cytoplasm by anti-EccGAS serum (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4B</bold>
</xref>), which is consistent with the results of subcellular localization.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Cellular localization of EccGAS. <bold>(A)</bold> Subcellular localization of the EccGAS structural domain Mab21 and the deletion of the structural domain in GS cells. GS cells were transfected with pEGFP-C1, pEGFP-EccGAS, pEGFP-EccGAS-Mab21 and pEGFP-EccGAS-delete-Mab21 plasmids using Liposome 2000. After transfection for 24&#xa0;h, the cells were fixed with 4% paraformaldehyde for 2&#xa0;h at 25 &#xb0;C, and were stained with DAPI and examined under confocal laser scanning microscopy. Scale bars shown as 20 &#xb5;m. <bold>(B, C)</bold> Immunofluorescence and colocalization with endoplasmic reticulum and mitochondria. GS cells were inoculated and transfected with pcDNA3.1-EccGAS or pDsRed2-ER and pDsRed2-Mito, primary antibody with rabbit polyclonal anti-EccGAS antibody (1:150) or mouse monoclonal anti-HA antibody (1:150) incubated for 2&#xa0;h at 25 &#xb0;C and secondary antibody with FITC-conjugated goat anti-rabbit or goat anti-mouse (1:200). Subsequently, the cells were incubated for 1&#xa0;h and examined by confocal microscopy. Scale bars are shown as 20 &#xb5;m.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-14-1092824-g004.tif"/>
</fig>
<p>To explore whether EccGAS co-localizes with organelles, plasmids pEGFP-EccGAS were co-transfected with pDsRed2-ER (endoplasmic reticulum) or pDsRed2-Mito (mitochondria) into GS cells and their localization was examined. The results showed that EccGAS partially co-localized with the endoplasmic reticulum and mitochondria (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4C</bold>
</xref>).</p>
</sec>
<sec id="s3_4">
<label>3.4</label>
<title>EccGAS affected SGIV replication</title>
<p>We designed three siRNAs based on the ORF sequence of EccGAS. siRNAs were transfected into GS cells, and qRT-PCR was used to detect the expression of endogenous EccGAS after 24 hours. The results showed that all three siRNAs silenced the expression of endogenous EccGAS in GS cells, of which siRNA2 had the highest interference efficiency (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5A</bold>
</xref>). Next, we used siRNA2 to conduct the following experiments. After siRNA2 was transfected into GS cells and infected with SGIV, the expression of SGIV MCP, SGIV ICP18, and SGIV VP19 were examined by qRT-PCR. The expression of SGIV MCP protein was detected by western blot. The results showed that EccGAS knockdown by siRNA2 significantly inhibited the transcript expression of SGIV genes (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5B</bold>
</xref>). Moreover, the results of western blot showed that knockdown EccGAS by siRNA2 significantly reduced the expression of MCP protein (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5C</bold>
</xref>). These results suggest that EccGAS may promote SGIV replication in GS cells.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Effect of EccGAS silencing on viral replication. <bold>(A)</bold> Three siRNA sequences were designed based on the sequence of EccGAS and assayed for interference effects. <bold>(B)</bold> EccGAS knockout and control cells were infected with SGIV and collected at 24&#xa0;h and 36&#xa0;h to measure the relative expression levels of the viral genes. Relative expression levels of the viral genes were measured by qRT-PCR (n = 3, mean &#xb1; SD). *<italic>P</italic> &lt; 0.05. <bold>(C)</bold> Silencing of EccGAS in GS cells infected with SGIV and protein samples collected for 24&#xa0;h and 36&#xa0;h. Expression of MCP protein was detected by western blotting. &#x3b2;-tubulin was used as an internal control. Quantity-one software was used to calculate band intensities and assess the MCP/&#x3b2;-tubulin ratio.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-14-1092824-g005.tif"/>
</fig>
</sec>
<sec id="s3_5">
<label>3.5</label>
<title>EccGAS inhibited interferon immune response</title>
<p>The regulatory effects of EccGAS on host immune factors were evaluated by qRT-PCR. As shown in <xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref>, EccGAS knockdown by siRNA2 potentiated the transcription of IFN1, IFN2, PKR, Viperin, ISG15, ISG56, IL-1&#x3b2;, IL-8, and TNF&#x3b1; in GS cells. Thus, the results suggested that EccGAS negatively regulated the interferon immune response <italic>in vitro</italic>.</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Silencing of EccGAS promoted the expression of host interferon-related genes and inflammation-related factors. Data are expressed as ratio to the control group. Error bars represent mean &#xb1; SD; *<italic>P</italic> &lt; 0.05; **<italic>P</italic> &lt; 0.01.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-14-1092824-g006.tif"/>
</fig>
</sec>
<sec id="s3_6">
<label>3.6</label>
<title>EccGAS inhibits EcSTING-mediated interferon immune response</title>
<p>In mammals, cGAS has been reported to produce cGAMP after DNA sensing to stimulate STING, which in turn activates interferon production and innate immunity. We aimed to determine whether EccGAS is involved in EcSTING-mediated interferon immune response. As shown in <xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7A</bold>
</xref>, when EccGAS was co-transfected with EcSTING, EcTBK1, EcTAK1, and EcIRF3, the activities of IFN1, ISRE, and NF-&#x3ba;B promoters were significantly reduced, suggesting that EccGAS may be involved in EcSTING-mediated interferon immune responses. Next we investigated whether EccGAS interacts with EcSTING, EcTBK1, EcTAK1 and EcIRF3. Confocal microscopy results showed that the green fluorescence of pEGFP-EcSTING, pEGFP-EcTBK1, pEGFP-EcTAK1, and pEGFP-EcIRF3 colocalized with the red fluorescence of EccGAS (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7B</bold>
</xref>). We further verified the experimental results by CO-IP assay. The plamids of pcDNA3.1-EccGAS was co-transfected with pEGFP-EcSTING, pEGFP-EcTBK1, pEGFP-EcTAK1, pEGFP-EcIRF3, and pEGFP-C1, respectively, followed by immunoprecipitation (IP) and immunoblotting (IB) of whole cell lysates (WCLs). The results showed that EccGAS was detected in the IP products of EcSTING, EcTAK1, EcTBK1, and EcIRF3, but not in pEGFP-C1 (<xref ref-type="fig" rid="f7">
<bold>Figures&#xa0;7C&#x2013;E</bold>
</xref>). Therefore, EccGAS inhibited EcSTING-mediated interferon immune response and interacted with EcSTING, EcTAK1, EcTBK1, and EcIRF3.</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>EccGAS negatively regulates EcSTING-mediated immune responses. <bold>(A)</bold> EccGAS inhibits the activation of IFN1, ISRE, and NF-&#x3ba;B promoter induced by EcSTING, EcTBK1, EcTAK1 and EcIRF3. pEGFP-EcSTING, pEGFP-EcTBK1, pEGFP-EcTAK1, and pEGFP-EcIRF3 were transfected into GS cells at a ratio of 1:1:1 with pEGFP-EcGAS and IFN1-Luc, respectively. Cells were harvested for detection of luciferase activity at 36&#xa0;h after transfection.The error bars indicate mean &#xb1; SD; *<italic>P</italic> &lt; 0.05. ISRE and NF-&#x3ba;B promoter activities were tested in the same way. <bold>(B)</bold> EccGAS colocalized with EcSTING, EcTBK1, EcTAK1 and EcIRF3, respectively. The plasmid pcDNA3.1-Red-EccGAS was co-transfected with pEGFP-EcTBK1, pEGFP-EcTAK1 and pEGFP-EcIRF3 in GS cells, respectively. Imaged by confocal microscopy, scale bars are shown at 20 &#x3bc;m. <bold>(C&#x2013;E)</bold> EccGAS interacts with EcSTING, EcTBK1, EcTAK1 and EcIRF3, respectively. pEGFP-C1, pEGFP -EcSTING, pEGFP-EcTAK1, pEGFP-EcTBK1, and pEGFP-EcIRF3 were cotransfected with pcDNA3.1-EccGAS in GS cells, respectively. Samples were processed by immunoprecipitation and western blotting. &#x3b2;-tubulin was used as an internal control.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-14-1092824-g007.tif"/>
</fig>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<label>4</label>
<title>Discussion</title>
<p>Cytoplasmic DNA receptors, as part of the PRRs, play important roles in the innate immune response. One of the major cytoplasmic DNA receptors in humans is cGAS. It is homologous to oligoadenosine synthase, independent of nucleotide sequence, and thus able to recognize a variety of DNA viruses that invade the cytoplasm, including endogenous or threatening exogenous DNA (<xref ref-type="bibr" rid="B22">22</xref>&#x2013;<xref ref-type="bibr" rid="B24">24</xref>). Currently, the function of cGAS is rarely reported in fish. In this study, a cGAS homolog from orange-spotted grouper <italic>Epinephelus coioides</italic> (EccGAS) was cloned and its role in the innate immune system during viral infection was studied. The results showed that cGAS is a negative regulator of STING-mediated IFN response in grouper.</p>
<p>In mammals, only one type of cGAS is typically found and plays an important role in the activation of type I IFN (<xref ref-type="bibr" rid="B25">25</xref>, <xref ref-type="bibr" rid="B26">26</xref>). In fish, due to genome duplication events (<xref ref-type="bibr" rid="B27">27</xref>), two paralogs of cGAS were found in grass carp and zebrafish (<xref ref-type="bibr" rid="B28">28</xref>, <xref ref-type="bibr" rid="B29">29</xref>). However, only one cGAS has been recorded in grouper. Several reports indicate that the C-terminus is highly conserved among cGAS homologs from fish to humans, whereas the N-terminal exhibits great diversity in length and sequence among the cGAS homologs (<xref ref-type="bibr" rid="B30">30</xref>). BLAST analysis showed that EccGAS had the highest similarity (71.8%) with <italic>Sebastes umbrosus</italic> and the lowest similarity with mammals. SMART prediction revealed that EccGAS has a highly conserved Mab21 domain, suggesting that it belongs to the MAB21 family. This domain was originally discovered in <italic>Cryptobacterium showyeri</italic> and plays a key role in DNA binding of cGAS (<xref ref-type="bibr" rid="B31">31</xref>).</p>
<p>Recently, mammalian cGAS was identified as a ubiquitous sensor of cytosolic dsDNA. However, the role of fish cGAS in innate immune regulation has not been elucidated. Previous studies reported that cGAS is widely expressed in different tissues. cGAS was highly expressed in the spleen and intestines of pigs and chickens (<xref ref-type="bibr" rid="B32">32</xref>, <xref ref-type="bibr" rid="B33">33</xref>). cGAS was also highly expressed in the liver and intestine of grass carp (<xref ref-type="bibr" rid="B34">34</xref>). The liver and gut are the major sites of interferon-stimulated gene (ISG) expression during viral infection in fish (<xref ref-type="bibr" rid="B29">29</xref>); therefore, cGAS may play an important role in antiviral innate immunity in fish. In the present study, EccGAS was predominantly expressed in the blood, skin, and gills. Therefore, we speculate that the high expression of cGAS at these sites may be a strategy to balance the antiviral immune response to avoid over-induction of ISGs. After SGIV infection, the expression of EccGAS increased with the time of virus infection, suggesting that EccGAS is involved in the innate immune response. Similarly, grass carp cGASa was up-regulated under GCRV or poly dA:dT treatment (<xref ref-type="bibr" rid="B28">28</xref>), and grass carp cGASb was up-regulated under GCRV, poly dA:dT or poly I:C treatment (<xref ref-type="bibr" rid="B28">28</xref>, <xref ref-type="bibr" rid="B35">35</xref>). Meanwhile, the Japanese medaka cGAS was significantly induced under <italic>Edwardsiella tarda</italic> treatment (<xref ref-type="bibr" rid="B36">36</xref>).</p>
<p>Studies have reported that cGAS activates the intrinsic antimicrobial defenses of cells and promotes autophagic targeting of <italic>Mycobacterium tuberculosis</italic> (<xref ref-type="bibr" rid="B37">37</xref>). Mice deficient in cGAS or STING exhibited lower type I IFN levels and higher viral loads (<xref ref-type="bibr" rid="B38">38</xref>). In crucian carp and grass carp, CacGAS and CicGAS reduced the CiRIG-I-mediated cellular antiviral response and promoted viral replication (<xref ref-type="bibr" rid="B39">39</xref>). After silencing EccGAS, the transcription levels of SGIV genes of MCP, ICP18, and VP19 were significantly inhibited, and the levels of MCP protein were increased, suggesting that EccGAS may promote SGIV replication. Knockdown of EccGAS potentiated the transcription of endogenous IFN1, IFN2, PKR, Viperin, ISG15, ISG56, IL-1&#x3b2;, IL-8, and TNF&#x3b1; in GS cells. EccGAS also inhibited the activation of IFN1, ISRE, and NF-&#x3ba;B promoters in GS cells. These results suggested that EccGAS is involved in the regulation of virus-induced IFN signaling.</p>
<p>Many studies have shown that cGAS is distributed in the cytoplasm of humans, pigs, chickens, and grass carp (<xref ref-type="bibr" rid="B11">11</xref>, <xref ref-type="bibr" rid="B32">32</xref>&#x2013;<xref ref-type="bibr" rid="B34">34</xref>). In our study, EccGAS and Mab21 were uniformly distributed in the cytoplasm, suggesting that grouper cGAS may have similar functions to mammalian cGAS. Several studies have shown that STING proteins in the endoplasmic reticulum were activated to recruit and bind with MAVS located in the mitochondria (<xref ref-type="bibr" rid="B10">10</xref>, <xref ref-type="bibr" rid="B40">40</xref>); thus, they recruit TBK1 and activate IRF3 and NF-&#x3ba;B phosphorylation. In our previous study, EcSTING is distributed in the endoplasmic reticulum (<xref ref-type="bibr" rid="B41">41</xref>). In the present study, EccGAS is highly distributed in both the endoplasmic reticulum and mitochondria. Therefore, EccGAS may play an important role in the innate immune system by interacting with STING. In grass carp, cGASL interacts with STING and inhibits STING-mediated activation of gcIFN1pro (<xref ref-type="bibr" rid="B34">34</xref>). EccGAS can inhibit EcSTING-induced activation of IFN1, ISRE and NF-&#x3ba;B promoter activities. Furthermore, EcCGAS can colocalize with EcSTING. EccGAS and EcSTING can also interact, which is independent of the Mab21 domain. These results suggest that EccGAS could interact with STING and inhibit STING-mediated activation of IFN.</p>
<p>As important components of the cGAS-STING signaling pathway, EcTBK1, EcTAK1, and EcIRF3 are expressed in grouper and play important roles in antiviral innate immunity (<xref ref-type="bibr" rid="B42">42</xref>&#x2013;<xref ref-type="bibr" rid="B44">44</xref>). We then investigated the roles of EccGAS in EcTBK1-, EcTAK1-, and EcIRF3-mediated activation of IFN. The results showed that EccGAS inhibited the activities of IFN1, ISRE and NF-&#x3ba;B promoters induced by EcTBK1, EcTAK1 and EcIRF3. Confocal microscopy showed that EcTBK1, EcTAK1, and EcIRF3 colocalized with EccGAS. Co-IP showed that EccGAS interacted with EcTBK1, EcTAK1, and EcIRF3. Thus, EccGAS inhibits STING-mediated interferon immune responses and interacts with STING, TAK1, TBK1, and IRF3.</p>
<p>In summary, a cGAS homolog of grouper (EccGAS), which contains a typical Mab21 structural domain, was identified for the first time. EccGAS was evenly distributed in the cytoplasm and partially co-located in the endoplasmic reticulum and mitochondria. EccGAS could promote SGIV replication. EccGAS negatively regulates EcSTING-mediated interferon immune responses and interacts with EcSTING, EcTAK1, EcTBK1, and EcIRF3. These findings contribute insights and methods for the prevention and treatment of viral infections.</p>
</sec>
<sec id="s5" sec-type="data-availability">
<title>Data availability statement</title>
<p>The original contributions presented in the study are included in the article/supplementary material. Further inquiries can be directed to the corresponding authors.</p>
</sec>
<sec id="s6" sec-type="ethics-statement">
<title>Ethics statement</title>
<p>The animal study was reviewed and approved by The Animal Care and Use Committee of College of Marine Sciences, South China Agricultural University.</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author contributions</title>
<p>Conceptualization, JW and QQ. Methodology, LZ. Software, LZ. Validation, XZ, JL and LX. Investigation, SK, JL, HC, MS, STW, ZX, SW. Writing-original draft preparation, LZ. Writing-review and editing, JW, QQ. Supervision, QQ. Funding acquisition, QQ, JW, SW. All authors have read and agreed to the published version of the manuscript.</p>
</sec>
</body>
<back>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>This research was funded by the National Key Research and Development Program of China (2022YFD2400501), Key-Area Research and Development Program of Guangdong Province (2021B0202040002), Laboratory of Lingnan Modern Agriculture Project (NT2021008), the China Agriculture Research System of MOF and MARA(CARS-47-G16), the Agricultural Science and Technology Cooperation Project of Institute of New Rural Development of South China Agricultural University (2021XNYNYKJHZGJ042), and Open Fund of Guangdong Provincial Key Laboratory of Aquatic Animal Disease Control and Healthy culture (PBEA2020YB01).</p>
</sec>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s10" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Qin</surname> <given-names>QW</given-names>
</name>
<name>
<surname>Chang</surname> <given-names>SF</given-names>
</name>
<name>
<surname>Ngoh-Lim</surname> <given-names>GH</given-names>
</name>
<name>
<surname>Gibson-Kueh</surname> <given-names>S</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>C</given-names>
</name>
<name>
<surname>Lam</surname> <given-names>TJ</given-names>
</name>
</person-group>. <article-title>Characterization of a novel ranavirus isolated from grouper epinephelus tauvina</article-title>. <source>Dis Aquat Organ</source> (<year>2003</year>) <volume>53</volume>:<fpage>1</fpage>&#x2013;<lpage>9</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3354/dao053001</pub-id>
</citation>
</ref>
<ref id="B2">
<label>2</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Morchikh</surname> <given-names>M</given-names>
</name>
<name>
<surname>Cribier</surname> <given-names>A</given-names>
</name>
<name>
<surname>Raffel</surname> <given-names>R</given-names>
</name>
<name>
<surname>Amraoui</surname> <given-names>S</given-names>
</name>
<name>
<surname>Cau</surname> <given-names>J</given-names>
</name>
<name>
<surname>Severac</surname> <given-names>D</given-names>
</name>
<etal/>
</person-group>. <article-title>HEXIM1 and NEAT1 long non-coding RNA form a multi-subunit complex that regulates DNA-mediated innate immune response</article-title>. <source>Mol Cell</source> (<year>2017</year>) <volume>67</volume>:<page-range>387&#x2013;99</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.molcel.2017.06.020</pub-id>
</citation>
</ref>
<ref id="B3">
<label>3</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>SN</given-names>
</name>
<name>
<surname>Zou</surname> <given-names>PF</given-names>
</name>
<name>
<surname>Nie</surname> <given-names>P</given-names>
</name>
</person-group>. <article-title>Retinoic acid-inducible gene I (RIG-i)-like receptors (RLRs) in fish: current knowledge and future perspectives</article-title>. <source>Immunology</source> (<year>2017</year>) <volume>151</volume>:<fpage>16</fpage>&#x2013;<lpage>25</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/imm.12714</pub-id>
</citation>
</ref>
<ref id="B4">
<label>4</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yoneyama</surname> <given-names>M</given-names>
</name>
<name>
<surname>Onomoto</surname> <given-names>K</given-names>
</name>
<name>
<surname>Jogi</surname> <given-names>M</given-names>
</name>
<name>
<surname>Akaboshi</surname> <given-names>T</given-names>
</name>
<name>
<surname>Fujita</surname> <given-names>T</given-names>
</name>
</person-group>. <article-title>Viral RNA detection by RIG-i-like receptors</article-title>. <source>Curr Opin Immunol</source> (<year>2015</year>) <volume>32</volume>:<fpage>48</fpage>&#x2013;<lpage>53</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.coi.2014.12.012</pub-id>
</citation>
</ref>
<ref id="B5">
<label>5</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hoffmann</surname> <given-names>HH</given-names>
</name>
<name>
<surname>Schneider</surname> <given-names>WM</given-names>
</name>
<name>
<surname>Rice</surname> <given-names>CM</given-names>
</name>
</person-group>. <article-title>Interferons and viruses: an evolutionary arms race of molecular interactions</article-title>. <source>Trends Immunol</source> (<year>2015</year>) <volume>36</volume>:<page-range>124&#x2013;38</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.it.2015.01.004</pub-id>
</citation>
</ref>
<ref id="B6">
<label>6</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hemmi</surname> <given-names>H</given-names>
</name>
<name>
<surname>Takeuchi</surname> <given-names>O</given-names>
</name>
<name>
<surname>Kawai</surname> <given-names>T</given-names>
</name>
<name>
<surname>Kaisho</surname> <given-names>T</given-names>
</name>
<name>
<surname>Sato</surname> <given-names>S</given-names>
</name>
<name>
<surname>Sanjo</surname> <given-names>H</given-names>
</name>
<etal/>
</person-group>. <article-title>A toll-like receptor recognizes bacterial DNA</article-title>. <source>Nature</source> (<year>2000</year>) <volume>408</volume>:<page-range>740&#x2013;5</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/35047123</pub-id>
</citation>
</ref>
<ref id="B7">
<label>7</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Takaoka</surname> <given-names>A</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Choi</surname> <given-names>MK</given-names>
</name>
<name>
<surname>Yanai</surname> <given-names>H</given-names>
</name>
<name>
<surname>Negishi</surname> <given-names>H</given-names>
</name>
<name>
<surname>Ban</surname> <given-names>T</given-names>
</name>
<etal/>
</person-group>. <article-title>DAI (DLM-1/ZBP1) is a cytosolic DNA sensor and an activator of innate immune response</article-title>. <source>Nature</source> (<year>2007</year>) <volume>448</volume>:<page-range>501&#x2013;5</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nature06013</pub-id>
</citation>
</ref>
<ref id="B8">
<label>8</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Miyashita</surname> <given-names>M</given-names>
</name>
<name>
<surname>Oshiumi</surname> <given-names>H</given-names>
</name>
<name>
<surname>Matsumoto</surname> <given-names>M</given-names>
</name>
<name>
<surname>Seya</surname> <given-names>T</given-names>
</name>
</person-group>. <article-title>DDX60, a DEXD/H box helicase, is a novel antiviral factor promoting RIG-i-like receptor-mediated signaling</article-title>. <source>Mol Cell Biol</source> (<year>2011</year>) <volume>31</volume>:<page-range>3802&#x2013;19</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/MCB.01368-10</pub-id>
</citation>
</ref>
<ref id="B9">
<label>9</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Yuan</surname> <given-names>B</given-names>
</name>
<name>
<surname>Bao</surname> <given-names>M</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>N</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>T</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>YJ</given-names>
</name>
</person-group>. <article-title>The helicase DDX41 senses intracellular DNA mediated by the adaptor STING in dendritic cells</article-title>. <source>Nat Immunol</source> (<year>2011</year>) <volume>12</volume>:<page-range>959&#x2013;65</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/ni.2091</pub-id>
</citation>
</ref>
<ref id="B10">
<label>10</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Unterholzner</surname> <given-names>L</given-names>
</name>
<name>
<surname>Keating</surname> <given-names>SE</given-names>
</name>
<name>
<surname>Baran</surname> <given-names>M</given-names>
</name>
<name>
<surname>Horan</surname> <given-names>KA</given-names>
</name>
<name>
<surname>Jensen</surname> <given-names>SB</given-names>
</name>
<name>
<surname>Sharma</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>IFI16 is an innate immune sensor for intracellular DNA</article-title>. <source>Nat Immunol</source> (<year>2010</year>) <volume>11</volume>:<fpage>997</fpage>&#x2013;<lpage>1004</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/ni.1932</pub-id>
</citation>
</ref>
<ref id="B11">
<label>11</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sun</surname> <given-names>L</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Du</surname> <given-names>F</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>X</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>ZJ</given-names>
</name>
</person-group>. <article-title>Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway</article-title>. <source>Science</source> (<year>2013</year>) <volume>339</volume>:<page-range>786&#x2013;91</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1126/science.1232458</pub-id>
</citation>
</ref>
<ref id="B12">
<label>12</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gao</surname> <given-names>P</given-names>
</name>
<name>
<surname>Ascano</surname> <given-names>M</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Barchet</surname> <given-names>W</given-names>
</name>
<name>
<surname>Gaffney</surname> <given-names>BL</given-names>
</name>
<name>
<surname>Zillinger</surname> <given-names>T</given-names>
</name>
<etal/>
</person-group>. <article-title>Cyclic [G(2',5')pA(3',5')p] is the metazoan second messenger produced by DNA-activated cyclic GMP-AMP synthase</article-title>. <source>Cell</source> (<year>2013</year>) <volume>153</volume>:<page-range>1094&#x2013;107</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.cell.2013.04.046</pub-id>
</citation>
</ref>
<ref id="B13">
<label>13</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ablasser</surname> <given-names>A</given-names>
</name>
<name>
<surname>Goldeck</surname> <given-names>M</given-names>
</name>
<name>
<surname>Cavlar</surname> <given-names>T</given-names>
</name>
<name>
<surname>Deimling</surname> <given-names>T</given-names>
</name>
<name>
<surname>Witte</surname> <given-names>G</given-names>
</name>
<name>
<surname>Rohl</surname> <given-names>I</given-names>
</name>
<etal/>
</person-group>. <article-title>cGAS produces a 2'-5'-linked cyclic dinucleotide second messenger that activates STING</article-title>. <source>Nature</source> (<year>2013</year>) <volume>498</volume>:<page-range>380&#x2013;4</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nature12306</pub-id>
</citation>
</ref>
<ref id="B14">
<label>14</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>X</given-names>
</name>
<name>
<surname>Yan</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Cai</surname> <given-names>J</given-names>
</name>
<name>
<surname>Ouyang</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Cui</surname> <given-names>H</given-names>
</name>
<etal/>
</person-group>. <article-title>Transcriptome analysis of orange-spotted grouper (Epinephelus coioides) spleen in response to Singapore grouper iridovirus</article-title>. <source>BMC Genomics</source> (<year>2011</year>) <volume>12</volume>:<fpage>556</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/1471-2164-12-556</pub-id>
</citation>
</ref>
<ref id="B15">
<label>15</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xu</surname> <given-names>D</given-names>
</name>
<name>
<surname>Wei</surname> <given-names>J</given-names>
</name>
<name>
<surname>Cui</surname> <given-names>H</given-names>
</name>
<name>
<surname>Gong</surname> <given-names>J</given-names>
</name>
<name>
<surname>Yan</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Lai</surname> <given-names>R</given-names>
</name>
<etal/>
</person-group>. <article-title>Differential profiles of gene expression in grouper epinephelus coioides, infected with Singapore grouper iridovirus, revealed by suppression subtractive hybridization and DNA microarray</article-title>. <source>J Fish Biol</source> (<year>2010</year>) <volume>77</volume>:<page-range>341&#x2013;60</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1095-8649.2010.02676.x</pub-id>
</citation>
</ref>
<ref id="B16">
<label>16</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Qin</surname> <given-names>QW</given-names>
</name>
<name>
<surname>Lam</surname> <given-names>TJ</given-names>
</name>
<name>
<surname>Sin</surname> <given-names>YM</given-names>
</name>
<name>
<surname>Shen</surname> <given-names>H</given-names>
</name>
<name>
<surname>Chang</surname> <given-names>SF</given-names>
</name>
<name>
<surname>Ngoh</surname> <given-names>GH</given-names>
</name>
<etal/>
</person-group>. <article-title>Electron microscopic observations of a marine fish iridovirus isolated from brown-spotted grouper, epinephelus tauvina</article-title>. <source>J Virol Methods</source> (<year>2001</year>) <volume>98</volume>:<fpage>17</fpage>&#x2013;<lpage>24</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/s0166-0934(01)00350-0</pub-id>
</citation>
</ref>
<ref id="B17">
<label>17</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>X</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Li</surname> <given-names>C</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>L</given-names>
</name>
<name>
<surname>Wei</surname> <given-names>J</given-names>
</name>
<etal/>
</person-group>. <article-title>Grouper TRADD mediates innate antiviral immune responses and apoptosis induced by Singapore grouper iridovirus (SGIV) infection</article-title>. <source>Front Cell Infect Microbiol</source> (<year>2019</year>) <volume>9</volume>:<elocation-id>329</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fcimb.2019.00329</pub-id>
</citation>
</ref>
<ref id="B18">
<label>18</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wei</surname> <given-names>J</given-names>
</name>
<name>
<surname>Gao</surname> <given-names>P</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>P</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>M</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>M</given-names>
</name>
<name>
<surname>Wei</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>Isolation and function analysis of apolipoprotein a-I gene response to virus infection in grouper</article-title>. <source>Fish Shellfish Immunol</source> (<year>2015</year>) <volume>43</volume>:<fpage>396</fpage>&#x2013;<lpage>404</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.fsi.2015.01.006</pub-id>
</citation>
</ref>
<ref id="B19">
<label>19</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sambrook</surname> <given-names>JE</given-names>
</name>
<name>
<surname>Maniatis</surname> <given-names>TE</given-names>
</name>
<name>
<surname>Fritsch</surname> <given-names>EF</given-names>
</name>
</person-group>. <article-title>Molecular cloning: A laboratory manual</article-title>. <edition>2nd</edition> ed (<publisher-loc>New York</publisher-loc>: <publisher-name>Cold Spring Harbor Laboratory Press</publisher-name>). (<year>1989</year>).</citation>
</ref>
<ref id="B20">
<label>20</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>C</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>L</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>X</given-names>
</name>
<name>
<surname>Wei</surname> <given-names>J</given-names>
</name>
<name>
<surname>Qin</surname> <given-names>Q</given-names>
</name>
</person-group>. <article-title>Molecular cloning, expression and functional analysis of Atg16L1 from orange-spotted grouper (Epinephelus coioides)</article-title>. <source>Fish Shellfish Immunol</source> (<year>2019</year>) <volume>94</volume>:<page-range>113&#x2013;21</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.fsi.2019.09.004</pub-id>
</citation>
</ref>
<ref id="B21">
<label>21</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>C</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>X</given-names>
</name>
<name>
<surname>Wei</surname> <given-names>S</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>X</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>Y</given-names>
</name>
<etal/>
</person-group>. <article-title>Fish autophagy protein 5 exerts negative regulation on antiviral immune response against iridovirus and nodavirus</article-title>. <source>Front Immunol</source> (<year>2019</year>) <volume>10</volume>:<elocation-id>517</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2019.00517</pub-id>
</citation>
</ref>
<ref id="B22">
<label>22</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>T</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>ZJ</given-names>
</name>
</person-group>. <article-title>The cGAS-cGAMP-STING pathway connects DNA damage to inflammation, senescence, and cancer</article-title>. <source>J Exp Med</source> (<year>2018</year>) <volume>215</volume>:<page-range>1287&#x2013;99</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1084/jem.20180139</pub-id>
</citation>
</ref>
<ref id="B23">
<label>23</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dhanwani</surname> <given-names>R</given-names>
</name>
<name>
<surname>Takahashi</surname> <given-names>M</given-names>
</name>
<name>
<surname>Sharma</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>Cytosolic sensing of immuno-stimulatory DNA, the enemy within</article-title>. <source>Curr Opin Immunol</source> (<year>2018</year>) <volume>50</volume>:<page-range>82&#x2013;7</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.coi.2017.11.004</pub-id>
</citation>
</ref>
<ref id="B24">
<label>24</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>L</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>ZJ</given-names>
</name>
</person-group>. <article-title>Regulation and function of the cGAS-STING pathway of cytosolic DNA sensing</article-title>. <source>Nat Immunol</source> (<year>2016</year>) <volume>17</volume>:<page-range>1142&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/ni.3558</pub-id>
</citation>
</ref>
<ref id="B25">
<label>25</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gratia</surname> <given-names>M</given-names>
</name>
<name>
<surname>Rodero</surname> <given-names>MP</given-names>
</name>
<name>
<surname>Conrad</surname> <given-names>C</given-names>
</name>
<name>
<surname>Bou</surname> <given-names>SE</given-names>
</name>
<name>
<surname>Maurin</surname> <given-names>M</given-names>
</name>
<name>
<surname>Rice</surname> <given-names>GI</given-names>
</name>
<etal/>
</person-group>. <article-title>Bloom syndrome protein restrains innate immune sensing of micronuclei by cGAS</article-title>. <source>J Exp Med</source> (<year>2019</year>) <volume>216</volume>:<page-range>1199&#x2013;213</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1084/jem.20181329</pub-id>
</citation>
</ref>
<ref id="B26">
<label>26</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Aarreberg</surname> <given-names>LD</given-names>
</name>
<name>
<surname>Esser-Nobis</surname> <given-names>K</given-names>
</name>
<name>
<surname>Driscoll</surname> <given-names>C</given-names>
</name>
<name>
<surname>Shuvarikov</surname> <given-names>A</given-names>
</name>
<name>
<surname>Roby</surname> <given-names>JA</given-names>
</name>
<name>
<surname>Gale</surname> <given-names>MJ</given-names>
</name>
</person-group>. <article-title>Interleukin-1beta induces mtDNA release to activate innate immune signaling <italic>via</italic> cGAS-STING</article-title>. <source>Mol Cell</source> (<year>2019</year>) <volume>74</volume>:<page-range>801&#x2013;15</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.molcel.2019.02.038</pub-id>
</citation>
</ref>
<ref id="B27">
<label>27</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Taylor</surname> <given-names>JS</given-names>
</name>
<name>
<surname>Van de Peer</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Braasch</surname> <given-names>I</given-names>
</name>
<name>
<surname>Meyer</surname> <given-names>A</given-names>
</name>
</person-group>. <article-title>Comparative genomics provides evidence for an ancient genome duplication event in fish</article-title>. <source>Philos Trans R Soc Lond B Biol Sci</source> (<year>2001</year>) <volume>356</volume>:<page-range>1661&#x2013;79</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1098/rstb.2001.0975</pub-id>
</citation>
</ref>
<ref id="B28">
<label>28</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xu</surname> <given-names>X</given-names>
</name>
<name>
<surname>Li</surname> <given-names>M</given-names>
</name>
<name>
<surname>Deng</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Li</surname> <given-names>D</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>cGASa and cGASb from grass carp (Ctenopharyngodon idellus) play opposite roles in mediating type I interferon response</article-title>. <source>Dev Comp Immunol</source> (<year>2021</year>) <volume>125</volume>:<fpage>104233</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.dci.2021.104233</pub-id>
</citation>
</ref>
<ref id="B29">
<label>29</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>ZF</given-names>
</name>
<name>
<surname>Ji</surname> <given-names>JF</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>XF</given-names>
</name>
<name>
<surname>Shao</surname> <given-names>T</given-names>
</name>
<name>
<surname>Fan</surname> <given-names>DD</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>XH</given-names>
</name>
<etal/>
</person-group>. <article-title>Characterization of cGAS homologs in innate and adaptive mucosal immunities in zebrafish gives evolutionary insights into cGAS-STING pathway</article-title>. <source>FASEB J</source> (<year>2020</year>) <volume>34</volume>:<page-range>7786&#x2013;809</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1096/fj.201902833R</pub-id>
</citation>
</ref>
<ref id="B30">
<label>30</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tao</surname> <given-names>J</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>XW</given-names>
</name>
<name>
<surname>Jin</surname> <given-names>J</given-names>
</name>
<name>
<surname>Du</surname> <given-names>XX</given-names>
</name>
<name>
<surname>Lian</surname> <given-names>T</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>J</given-names>
</name>
<etal/>
</person-group>. <article-title>Nonspecific DNA binding of cGAS n terminus promotes cGAS activation</article-title>. <source>J Immunol</source> (<year>2017</year>) <volume>198</volume>:<page-range>3627&#x2013;36</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.4049/jimmunol.1601909</pub-id>
</citation>
</ref>
<ref id="B31">
<label>31</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Civril</surname> <given-names>F</given-names>
</name>
<name>
<surname>Deimling</surname> <given-names>T</given-names>
</name>
<name>
<surname>de Oliveira</surname> <given-names>MC</given-names>
</name>
<name>
<surname>Ablasser</surname> <given-names>A</given-names>
</name>
<name>
<surname>Moldt</surname> <given-names>M</given-names>
</name>
<name>
<surname>Witte</surname> <given-names>G</given-names>
</name>
<etal/>
</person-group>. <article-title>Structural mechanism of cytosolic DNA sensing by cGAS</article-title>. <source>Nature</source> (<year>2013</year>) <volume>498</volume>:<page-range>332&#x2013;7</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nature12305</pub-id>
</citation>
</ref>
<ref id="B32">
<label>32</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Ba</surname> <given-names>G</given-names>
</name>
<name>
<surname>Han</surname> <given-names>YQ</given-names>
</name>
<name>
<surname>Ming</surname> <given-names>SL</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>MD</given-names>
</name>
<name>
<surname>Fu</surname> <given-names>PF</given-names>
</name>
<etal/>
</person-group>. <article-title>Cyclic GMP-AMP synthase is essential for cytosolic double-stranded DNA and fowl adenovirus serotype 4 triggered innate immune responses in chickens</article-title>. <source>Int J Biol Macromol</source> (<year>2020</year>) <volume>146</volume>:<fpage>497</fpage>&#x2013;<lpage>507</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ijbiomac.2020.01.015</pub-id>
</citation>
</ref>
<ref id="B33">
<label>33</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Chu</surname> <given-names>B</given-names>
</name>
<name>
<surname>Du</surname> <given-names>L</given-names>
</name>
<name>
<surname>Han</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>X</given-names>
</name>
<name>
<surname>Fan</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>Molecular cloning and functional characterization of porcine cyclic GMP-AMP synthase</article-title>. <source>Mol Immunol</source> (<year>2015</year>) <volume>65</volume>:<page-range>436&#x2013;45</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.molimm.2015.02.002</pub-id>
</citation>
</ref>
<ref id="B34">
<label>34</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhou</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>L</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>X</given-names>
</name>
<name>
<surname>Li</surname> <given-names>S</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y</given-names>
</name>
</person-group>. <article-title>Grass carp cGASL negatively regulates fish IFN response by targeting MITA</article-title>. <source>Fish Shellfish Immun</source> (<year>2019</year>) <volume>94</volume>:<page-range>871&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.fsi.2019.10.010</pub-id>
</citation>
</ref>
<ref id="B35">
<label>35</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhou</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>LF</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>C</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>DD</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>XY</given-names>
</name>
<name>
<surname>Li</surname> <given-names>ZC</given-names>
</name>
<etal/>
</person-group>. <article-title>Grass carp cGASL negatively regulates interferon activation through autophagic degradation of MAVS</article-title>. <source>Dev Comp Immunol</source> (<year>2021</year>) <volume>115</volume>:<fpage>103876</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.dci.2020.103876</pub-id>
</citation>
</ref>
<ref id="B36">
<label>36</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Murakami</surname> <given-names>S</given-names>
</name>
<name>
<surname>Morimoto</surname> <given-names>N</given-names>
</name>
<name>
<surname>Kono</surname> <given-names>T</given-names>
</name>
<name>
<surname>Sakai</surname> <given-names>M</given-names>
</name>
<name>
<surname>Hikima</surname> <given-names>JI</given-names>
</name>
</person-group>. <article-title>Molecular characterization and expression of the teleost cytosolic DNA sensor genes cGAS, LSm14A, DHX9, and DHX36 in Japanese medaka, oryzias latipes</article-title>. <source>Dev Comp Immunol</source> (<year>2019</year>) <volume>99</volume>:<fpage>103402</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.dci.2019.103402</pub-id>
</citation>
</ref>
<ref id="B37">
<label>37</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Watson</surname> <given-names>RO</given-names>
</name>
<name>
<surname>Bell</surname> <given-names>SL</given-names>
</name>
<name>
<surname>MacDuff</surname> <given-names>DA</given-names>
</name>
<name>
<surname>Kimmey</surname> <given-names>JM</given-names>
</name>
<name>
<surname>Diner</surname> <given-names>EJ</given-names>
</name>
<name>
<surname>Olivas</surname> <given-names>J</given-names>
</name>
<etal/>
</person-group>. <article-title>The cytosolic sensor cGAS detects mycobacterium tuberculosis DNA to induce type I interferons and activate autophagy</article-title>. <source>Cell Host Microbe</source> (<year>2015</year>) <volume>17</volume>:<page-range>811&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.chom.2015.05.004</pub-id>
</citation>
</ref>
<ref id="B38">
<label>38</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cheng</surname> <given-names>WY</given-names>
</name>
<name>
<surname>He</surname> <given-names>XB</given-names>
</name>
<name>
<surname>Jia</surname> <given-names>HJ</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>GH</given-names>
</name>
<name>
<surname>Jin</surname> <given-names>QW</given-names>
</name>
<name>
<surname>Long</surname> <given-names>ZL</given-names>
</name>
<etal/>
</person-group>. <article-title>The cGas-sting signaling pathway is required for the innate immune response against ectromelia virus</article-title>. <source>Front Immunol</source> (<year>2018</year>) <volume>9</volume>:<elocation-id>1297</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2018.01297</pub-id>
</citation>
</ref>
<ref id="B39">
<label>39</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhou</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Lei</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>LF</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>DD</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>C</given-names>
</name>
<name>
<surname>Li</surname> <given-names>ZC</given-names>
</name>
<etal/>
</person-group>. <article-title>cGAS is a negative regulator of RIG-I-Mediated IFN response in cyprinid fish</article-title>. <source>J Immunol</source> (<year>2021</year>) <volume>207</volume>:<page-range>784&#x2013;98</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.4049/jimmunol.2100075</pub-id>
</citation>
</ref>
<ref id="B40">
<label>40</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kato</surname> <given-names>H</given-names>
</name>
<name>
<surname>Takahasi</surname> <given-names>K</given-names>
</name>
<name>
<surname>Fujita</surname> <given-names>T</given-names>
</name>
</person-group>. <article-title>RIG-i-like receptors: cytoplasmic sensors for non-self RNA</article-title>. <source>Immunol Rev</source> (<year>2011</year>) <volume>243</volume>:<page-range>91&#x2013;8</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1600-065X.2011.01052.x</pub-id>
</citation>
</ref>
<ref id="B41">
<label>41</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Ouyang</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>W</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Li</surname> <given-names>P</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>Antiviral role of grouper STING against iridovirus infection</article-title>. <source>Fish Shellfish Immun</source> (<year>2015</year>) <volume>47</volume>:<page-range>157&#x2013;67</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.fsi.2015.09.014</pub-id>
</citation>
</ref>
<ref id="B42">
<label>42</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Qin</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>X</given-names>
</name>
</person-group>. <article-title>TBK1 from orange-spotted grouper exerts antiviral activity against fish viruses and regulates interferon response</article-title>. <source>Fish Shellfish Immunol</source> (<year>2018</year>) <volume>73</volume>:<page-range>92&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.fsi.2017.12.010</pub-id>
</citation>
</ref>
<ref id="B43">
<label>43</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>X</given-names>
</name>
<name>
<surname>Cai</surname> <given-names>J</given-names>
</name>
<name>
<surname>OuYang</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Wei</surname> <given-names>S</given-names>
</name>
<name>
<surname>Wei</surname> <given-names>J</given-names>
</name>
<etal/>
</person-group>. <article-title>Identification of orange-spotted grouper (Epinephelus coioides) interferon regulatory factor 3 involved in antiviral immune response against fish RNA virus</article-title>. <source>Fish Shellfish Immunol</source> (<year>2015</year>) <volume>42</volume>:<page-range>345&#x2013;52</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.fsi.2014.11.025</pub-id>
</citation>
</ref>
<ref id="B44">
<label>44</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>L</given-names>
</name>
<name>
<surname>Kang</surname> <given-names>S</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>H</given-names>
</name>
<name>
<surname>Liao</surname> <given-names>J</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>M</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>The roles of grouper TAK1 in regulating the infection of Singapore grouper iridovirus</article-title>. <source>Fish Shellfish Immunol</source> (<year>2022</year>) <volume>124</volume>:<page-range>164&#x2013;73</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.fsi.2022.04.006</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>