pDONR221-223-CBH-gcGFP, pAdenoG, and pcDNA3.1 (+) were all preserved in our laboratory. HEK293A and Primary ovine fetal turbinate (OFTu) cells were cultured in DMEM (Gibco, Grand Island, USA) supplemented with 10% fetal bovine serum (FBS), penicillin (100 U/mL) and streptomycin (100 mg/mL) at 37°C and 5% CO₂.

Based on the ORFV B2L-P2A-F1L PCR product from our previous studies (22), forward and reverse primers for B2L and F1L gene sequences were designed and added appropriate restriction sites as follows: 011-F: 5′- CTTTGTACAAAAAAGTTGGCCCTAGGGCCACC ATGTGGCCGTTCTCCTCCATC; 059-R: CATTTGTCGTCATCATCCTTATAGTCGAC TTATCACACGATGGCCGTGACC. Then, the amplified fusion gene was cloned into pDONR221-223-CBH-gcGFP shuttle plasmid using Tranzyme MasterMix (abm, Zhenjiang, China), and the fusion gene was subsequently transferred into pAdenoG vector using Fuzyme Cloning Kit (abm, Zhenjiang, China) to construct a recombinant adenoviruses vector named rAdV-B2L-P2A-F1L. The pAdenoG as the control adenovirus vector.

To produce the recombinant virus. The HEK293A cells were passaged into T25 cell culture flasks and incubated at 37°C in 5% CO₂. When the cell confluence is about 70-80%, the recombinant adenovirus plasmid was digested with restriction endonuclease PacI (NEB, Boston, USA), and 4 μg recombinant plasmid was transfected into HEK293A cells using Lipofectamine 3000 (Invitrogen, Carlsbad, USA) transfection reagent, and the cytopathic effect (CPE) was observed. When the cells showed CPE, the supernatant was collected, which was the F1 generation adenovirus, and the F1 generation virus was taken to infect 293A cells. When about 80% of the cells were diseased, the virus was collected and continued to be transmitted to the F3 generation. Until the 20th generation of recombinant adenovirus, the virus DNA was extracted with the innuPREP Virus DNA Kit (Analytik, Jena, Germany) as a template for identification. Adenovirus was purified from HEK293A cell extract by CsCl (Sigma, Maryland, Germany) density gradient centrifugation. CsCl was removed by size exclusion chromatography using a PD-10 column (GE Healthcare, Pittsburgh, UK) and the adenovirus was stored in an adenovirus storage buffer (10 mM Tris, pH 8.0, 2 mM MgCl₂, 5% sucrose) at -80°C. IFU/mL = [(number of positive signals/each field of vision) × (Number of visual fields/each cell pore)] ÷ [Amount of virus added (mL) × (dilution ratio)].

OFTU cells were infected with recombinant adenovirus (MOI = 100) cells were harvested after 48 h, PMSF and RIPA lysis buffer (Beyotime, Shanghai, China) were mixed (1:100) and added separately to prevent protein degradation. Proteins were electrophoresed on a 10% separating gel; proteins were transferred to nitrocellulose membranes; mouse polyclonal antibodies (22) in the ratio of 1:500 or GAPDH mouse monoclonal antibody (1:5000) (Proteintech, Chicago, USA) was used as the primary antibody and incubate overnight at 4°C. HRP-conjugated goat anti-mouse IgG (1:5000) (Abcam, Cambridgeshire, UK) was used as the secondary antibody and incubated at 37°C for 1 h. Record results using a gel imaging system (Tanon, Shanghai, China).

The fusion gene also was cloned into pcDNA3.1 (+) to construct a DNA vaccine vector named 3.1-B2L-P2A-F1L. In our previous study, it has been demonstrated in vitro that this fusion gene can be expressed in eukaryotic cells OFTu. The Purified B2L and F1L proteins as subunit vaccine were described in our previous article (22), the identified recombinant plasmid pET-32a-B2L and pET-30a-cF1L were transformed into BL21(DE3) pLysS chemically competent cell; monoclonal colonies in solid medium were picked up and added to 4 mL liquid LB medium for culture; after 12 h, the total starter culture was transferred into 400 mL fresh liquid LB medium; when OD₆₀₀ value was reached 0.4-0.6, isopropyl β-D-thiogalactoside (IPTG) with a final concentration of 0.2 mM was added to induce for 12 h; the bacterial solution was centrifuged at 8000 rpm for 10 min; then, the soluble binding buffer (20 mM pH7.9 Tris-HCl, 10 mM imidazole, 0.5M NaCl) was used to resuspended mycelium, lysed by sonication under the condition of ice water mixture; the suspension was centrifuged at 8000 rpm for 10 min at 4°C; the supernatant and sediment were collected for detection of soluble and inclusion body proteins; B2L protein was identified as inclusion body protein, and truncated cF1L protein was soluble protein; the inclusion body binding buffer (20 mM pH7.9 Tris-HCl, 5 mM imidazole, 0.5 M NaCl, 8 M urea) was used to dissolved the inclusion body protein; load all supernatant or dissolved the inclusion body protein into Ni column (ComWin, Beijing, China); finally, the B2L bound protein was eluted with elution buffer (20 mM pH7.9 Tris-HCl, 500 mM imidazole, 0.5M NaCl, 8 M urea), the F1L bound protein was eluted with elution buffer (20 mM pH7.9 Tris-HCl, 500 mM imidazole, 0.5 M NaCl) and analyzed by 10% SDS-PAGE or western blotting. The concentration of purified B2L and F1L proteins was 1 mg/mL and 2 mg/mL, respectively, which was detected by BCA (Beyotime, Shanghai, China).

All vaccines were mixed in a volume of 1:1 with complete Freund’s adjuvant for the first immunization; in all vaccine immunization groups, booster immunized were mixed in a volume of 1:1 with incomplete Freund’s adjuvant except rAdV vaccine and DNA/rAdV vaccine groups, shaken and emulsified at 4°C overnight to prepare a water-in-oil emulsion.

6-8 weeks old female BALB/c mice (n = 70) were purchased from the Center of Experimental Animals Changsheng Biotechnology Co., Ltd. in Liaoning, China. Sheep (n = 15) were purchased from Longsheng Experimental Animal Science and Technology Co., Ltd. in Jilin Changchun, China. All animals in the experiment were raised under specific-pathogen-free conditions in a light/dark cycle of about 12 h; temperature was around 27°C; humidity was around 42%, with food and water ad libitum. All animal experiments were conducted according to the Guidelines for the Care and Use of Research Animals provided by Jilin University. Institutional Review Board Statement: All animal experiments were approved by the Institutional Animal Care and Use Committee of the College of Veterinary Medicine, Jilin University, China.

Seven groups of BALB/c mice (n = 10/per group) were immunized twice at 21-day intervals. Mice were vaccinated with the DNA vaccines (3.1-B2L-P2A-F1L plasmids; 100 μg each); subunit vaccine (B2L/F1L proteins, the total of 40 μg each); recombinant adenovirus (rAdV) vaccine (rAdV-B2L-P2A-F1L virus, 1 × 10⁹ PFU each); the combination of DNA vaccine (3.1-B2L-P2A-F1L plasmids; 100 μg each) and rAdV vaccine (rAdV-B2L-P2A- F1L virus, 1 × 10⁹ PFU each); the combination of DNA vaccine (3.1-B2L-P2A-F1L plasmids; 100 μg each) and subunit vaccine (B2L/F1L proteins, the total of 40 μg each); The control group mice injected with PBS (100 μL each) and pAdenoG (an empty adenovirus; 1 × 10⁹ PFU each) separately. In the experiment, the immune mode of DNA and adenovirus vaccine is intramuscular injection, and the immune mode of the subunit vaccine is a subcutaneous injection. The details as shown in Table 1 .

Three groups of sheep (n = 5/per group) were immunized twice via intramuscular injection at 21-day intervals. Sheep were injected with PBS (1 mL each) as the control group; the combination of DNA vaccine (3.1-B2L-P2A-F1L plasmids; 500 μg each) and rAdV vaccine (rAdV-B2L-P2A-F1L virus, 1 × 10¹¹ PFU each); the combination of DNA vaccine (3.1-B2L-P2A-F1L plasmids; 500 μg each) and subunit vaccine (B2L/F1L proteins, the total of 200 μg each). The details as shown in Table 1 .

Serum samples from immunized mice and sheep were collected on days 0, 7, 14, 21, 28, and 35 after primary immunization. Serum IgG antibodies specific for ORFV B2L and F1L were detected using an indirect enzyme-linked immunosorbent assay (ELISA). The purified 3 µg/mL ORFV 011 and 059 proteins (100 µL per well) were diluted with 0.05 M carbonate buffer (pH 9.6) and coated overnight at 4°C; the next day, the plates were washed three times with phosphate-buffered saline (PBS) containing 0.1% Tween-20 (PBS-T), blocked with 5% non-fat milk in PBS-T for 1 h at 37°C; the plates were washed with PBS-T, the mouse serum was diluted to 1:100 and then 2-fold multiple dilutions. 100 μL of serum diluted was added to each well and incubated at 37°C for 1 h; the plates were washed with PBS-T, the secondary antibodies of goat anti-mouse IgG or rabbit anti-sheep IgG antibody conjugated with HRP (Proteintech, Chicago, USA) which diluted 1:5000 was added and incubated at 37°C for 1 h; the plates were washed with PBS-T, added 100 μL of two-component TMB chromogenic solution (Solarbio, Beijing, China) and incubated for 15 min in the dark at RT; Finally, 50 μL of 2 M H₂SO₄ was added to stop the reaction; the optical density (OD) was measured at 450 nm by a microplate reader. Values 2.1-fold higher than the control group were considered to be positive. The end-point titer was determined as the highest dilution.

IgG1 and IgG2a expression in mouse serum were detected by goat anti mouse IgG1, IgG2a secondary antibody (Sigma, Saint Louis, USA); IgG1 and IgG2a expression in sheep serum were detected by sheep IgG1 and IgG2a ELISA Kit (Jiang Lai, Shanghai, China), and all of them detected according to the reagent instructions.

On the 14th day after the boost immunization, the mice spleen was aseptically removed, ground using a 10 mL syringe, and filtered through a cell mesh filter to prepare a single-cell suspension. The spleen lymphocytes were isolated by mouse lymphocyte separation medium (Solarbio, Beijing, China), added an appropriate amount of separating liquid was put into the centrifuge tube, and spread the cell suspension over the liquid level of the separating liquid; 1000 g, centrifugation for 30 min; after centrifugation, there has been an obvious stratification, the white membrane layer between the plasma and the separating liquid is the lymphocyte layer, carefully sucked lymphocyte cells into 15 mL clean centrifuge tube, and washed lymphocyte cells with 10 mL PBS. 250 g, centrifugation for 10 min; discarded the supernatant, resuspension cells with 5 mL PBS, 250 g, centrifugation for 10min. The cell concentration was adjusted to 1 × 10⁶/ml with 10% RPMI 1640 (10% FBS, 2 mM L-glutamine, 100 U/ml of penicillin, 100 μg/ml of streptomycin) complete medium (Gibco, Grand Island, USA), and the cells were mixed and added to a 96-well plate, add 100 μL of cell suspension to each well. 5 μg/mL purified B2L and cF1L proteins were used as specific antigens, 1640 complete medium was used as a negative control, and ConA was stimulated at a final concentration of 5 μg/mL as a positive control. After 68 h, 10 μL MTT (5 mg/mL) was added to each well and cultured for 4 h, removed the supernatant, added 100 μL DMSO into each well, and placed in the dark at RT for 15 min. The OD value of each well was determined at 450 nm.

To detect changes in specific T cell subsets in sheep after vaccine immunization. On days 0 and 35, blood collection from sheep jugular vein, and the erythrocytes were lysed with erythrocyte lysate (Solarbio, Beijing, China); the cells were washed three times with PBS; FITC-conjugated anti-sheep CD4 (AbD Seratec, Kidlington, Britain), PE-conjugated anti-sheep CD8a (AbD Seratec, Kidlington, Britain) were incubated at 4°C for 30 min; washed cells 3 times with PBS; finally resuspended in flow buffer. Antibody-stained cells were analyzed on a BD FACSAria II flow cytometer using FlowJo software (Tree Star, Ashland, OR, USA).

On day 14, after the boost immunization, the production of cytokines was determined using splenocytes from immunized groups. The spleen cells were stimulated with 5 μg/mL purified B2L and cF1L proteins and the cultures were collected after 48 h and kept at -80°C pending assaying of the cytokines. Cytokines in the culture supernatant were quantified using mouse IL-2, IL-4, IL-6, IFN-γ, and TNF-α ELISA Kits (Biolegend, San Diego, CA, USA) following the manufacturer’s instructions.

On day 14, after the boost immunization, the levels of cytokines production in sheep serum were determined using sheep IL-2, IL-4, IL-6, IFN-γ, and TNF-α ELISA Kits (Jiang Lai, Shanghai, China) following the manufacturer’s instructions.

All experimental data were performed at least three times. Data analysis was performed using t-test and one-way ANOVA in GraphPad Prism 6.0 software (San Diego, CA, USA); the data are presented as the means ± standard deviation (SD), and statistical significance was assumed when the P value was < 0.05.

To generate recombinant adenovirus expressing B2L/F1L fusion protein, the recombinant plasmid of rAdV-B2L-P2A-F1L was constructed ( Figure 1A ). The PacI linearized recombinant plasmids pAdenoG and rAdV-B2L-P2A-F1L were transfected into HEK293A cells. The cytopathic effect (CPE) was observed about 14 days after transfection ( Figure 1B ). Compared with the control group, both HEK293A cells in pAdenoG adenovirus vector group and recombinant adenovirus rAdV-B2L-P2A-F1L group showed roundness and abscission. Under fluorescence microscope, HEK293A cells of adenovirus vector group showed green fluorescence. Purification of recombinant adenovirus by cesium chloride density gradient centrifugation, and the presence of the B2L/F1L gene in the virus DNA was detected by RT-PCR ( Figure 1C ). To detect whether B2L/F1L fusion protein could be independently expressed in OFTu cells under the cleavage of P2A peptide, OFTu cells were infected with recombinant adenovirus (MOI = 100) and were collected after 24 h. Western blotting was performed to examine the protein level in the cell lysates ( Figure 1D, E ). The B2L protein (42 kDa) could be detected when the anti-B2L mouse polyclonal antibodies were incubated with the lysates from recombinant adenovirus rAdV-B2L-P2A-F1L-infected cells ( Figure 1D ); The F1L protein (37 kDa) could be detected when anti-cF1L mouse polyclonal antibodies were incubated with the lysates from recombinant adenovirus rAdV-B2L-P2A-F1L infected OFTu cells ( Figure 1E ). No obvious protein band was found in non-infected or recombinant adenovirus pAdenoG infected OFTu cells. The results showed that the B2L and F1L proteins could be independently expressed in recombinant adenovirus rAdV-B2L-P2A-F1L-infected OFTu cells.

We have previously constructed Orf DNA vaccine expressing B2L/F1L fusion protein and subunit vaccines with B2L and cF1L proteins (22). Then, we evaluated the capacity of different vaccines that could induce a humoral response in mice. The end-point titer of B2L and F1L-specific IgG in the mice serum was examined through indirect ELISA on days 0, 7, 14, 21, 28 and 35 after the first immunization ( Figure 2 ). The results showed that all immunized mice displayed significant humoral responses (p < 0.0001) when compared with the PBS and pAdenoG groups from day 7 after the boost immunization; the B2L ( Figure 2A ) and F1L ( Figure 2B ) specific IgG titers in the DNA/Protein group were the highest, which was significantly higher (p < 0.01 or p < 0.001) than those from the DNA/DNA, Protein/Protein, rAdV/rAdV and DNA/rAdV groups, it can reach 1:1933 and 1:2116 respectively. Notably, on day 35, although the end-point titer of B2L and F1L-specific IgG in all vaccine-immunized mice was slightly lower than on day 28, the B2L and F1L-specific IgG titers in the DNA/Protein group were the highest, which was significantly higher (p < 0.01 or p < 0.001) than those of the DNA/DNA, Protein/Protein, rAdV/rAdV and DNA/rAdV groups, it can reach 1:1850 and 1:2026 respectively. As expected, control mice immunized with pAdenoG or PBS had no specific antibodies. Of note, the data indicate that DNA prime-protein boost immunization strategy could induce stronger specific antibodies than both rAdV/rAdV and DNA/rAdV immunization strategy.

On day 14, after the boost immunization, the levels of specific antibodies IgG subclasses IgG1 and IgG2a were examined by indirect ELISA, as shown in Figure 2C . The IgG1 and IgG2a levels of all vaccine immunization groups were significantly higher (p < 0.01 or p < 0.001) than the PBS and the pAdenoG groups; of note, the IgG1 and IgG2a levels from DNA/Protein group mice were significantly higher than those of the DNA/DNA (p < 0.01), Protein/Protein (p < 0.01), rAdV/rAdV (p < 0.01) and DNA/rAdV groups (p < 0.05 or p < 0.01); In addition, the IgG2a: IgG1 ratio of all vaccine-immunized groups were higher than 1 except Protein/Protein group. These results indicate that most vaccine immunization mainly induced Th1-type immune responses.

To evaluate the cellular immune response after the vaccination, the lymphocyte proliferative response was examined. The mice were euthanized on the 14th day after the boost vaccination, and splenocytes were isolated from the spleen of the mice and measured by MTT colorimetry. As shown in Figure 3 , the stimulation index (SI) of mice splenocytes in all immunized groups were significantly higher (p < 0.01 or p < 0.001) than those of the PBS and pAdenoG groups; The SI value of DNA/Protein group was the highest among all immunization groups. Of note, it was significantly higher than those of the DNA/DNA (p < 0.01), rAdV/rAdV (p < 0.01), Protein/Protein (p < 0.05), and DNA/rAdV groups (p < 0.05). These results proved that the DNA prime-protein boost strategy induces higher proliferation of splenic lymphocytes compared to other vaccines, especially rAdV-based immunization.

On day 14, after the boost immunization, the cytokine concentrations in the supernatant of splenic lymphocytes were measured by ELISA, as shown in Figure 4 . The levels of Th1-type cytokines (IFN-γ, TNF-α, and IL-2) ( Figures 4A–C ) in the group immunized with vaccines showed significantly higher levels (p < 0.001 or p < 0.0001) than the groups immunized with PBS and pAdenoG. The DNA/Protein group had highest IFN-γ, TNF-α, and IL-2 levels than (p < 0.01) those of the DNA/DNA, Protein/Protein, rAdV/rAdV, and DNA/rAdV groups. The IFN-γ, TNF-α, and IL-2 levels in the DNA/DNA group were significantly higher (p < 0.05 or p < 0.01) than in the Protein/Protein group.

Moreover, as shown in Figures 4D, E , Th2-type cytokine concentration of IL-4 and IL-6 among the vaccine immunization groups showed significantly higher (p < 0.05, p < 0.01, and p < 0.001) than those of the groups immunized with PBS and pAdenoG. The DNA/Protein group had significantly higher IL-4 levels than those of the DNA/DNA (p < 0.01), Protein/Protein (p < 0.01), rAdV/rAdV (p < 0.01), and DNA/rAdV groups (p < 0.05); Higher IL-6 levels in the DNA/Protein group were found compared to the DNA/DNA, Protein/Protein, rAdV/rAdV and DNA/rAdV groups (p < 0.01). IL-4 and IL-6 levels in the Protein/Protein were significantly higher than (p < 0.05) that of the DNA/DNA group. The above data demonstrate that DNA prime-protein boost strategy induces higher levels of cytokine responses compared to the immunization with rAdV-based immunization.

To evaluate the humoral response elicited by the two heterologous immunization strategies in sheep, we chose to perform the immunization with both DNA prime-protein vaccine boost and DNA prime-rAdV boost strategies. Serum samples were collected at days 0, 7, 14, 21, 28 and 35 after the first immunization, and the end-point titer of B2L and F1L-specific IgG in the sheep serum was measured by indirect ELISA method as shown in Figure 5 . From day 7 after the booster immunization, the B2L and F1L-specific IgG titers in the DNA/Protein and DNA/rAdV groups were significantly higher (P < 0.0001) when compared with the PBS group. Importantly, the B2L and F1L-specific IgG titers from DNA/Protein immunized sheep were significantly higher (P < 0.001) than that from DNA/rAdV group, which was in line with the observation in mice, it can reach 1: 2583 and 1: 2710 respectively. In addition, on day 35, the B2L and F1L-specific IgG titers in the DNA/Protein group was also the highest, which was significantly higher (p < 0.001) than that of the DNA/rAdV group, it can reach 1:2493 and 1:2656 respectively. No corresponding specific antibodies were detected in the PBS group throughout the experiment. The above data suggested that both kinds of heterologous immunization strategies induce a high humoral response in sheep, and the DNA prime-protein boost vaccination strategy shows a stronger humoral immune response.

On day 14, after the boost immunization, the levels of specific antibodies IgG subclasses IgG1 and IgG2a were examined by ELISA Kit, as shown in Figure 5 . The IgG1 and IgG2a levels in DNA/rAdV and DNA/Protein groups were significantly higher (p < 0.01 or p < 0.001) than that of the PBS group. Of note, the IgG1 and IgG2a levels in the DNA/Protein immunized sheep were significantly higher than that of the DNA/rAdV group (p < 0.05 or p < 0.01); Moreover, the ratio of IgG2a: IgG1 in the two vaccine-immunized groups were higher than 1. These results indicated that DNA prime-protein boost-induced Th1-type cytokine immune response is higher than the induction by DNA prime-rAdV boost strategies.

On day14, after boost immunization, to examine whether or not immunized sheep by two heterologous immunization strategies could induce a T-cell response. We analyzed the percentage of CD4⁺ and CD8⁺ T cells in the peripheral blood of sheep by flow, as shown in Figure 6 . On day 35, the proportion of CD4⁺ and CD8⁺ T cells in the DNA/Protein and DNA/rAdV groups were significantly higher than that in the PBS control group (P < 0.01 or P < 0.001); the proportion of CD4⁺ and CD8⁺ T cells in the DNA/Protein group was significantly higher than (P < 0.05) that in the DNA/rAdV group. These results indicate that the DNA Prime-Protein boost strategy could induce a T-cell response in sheep.

On day14, after the boost immunization, to further identify the Th1-type cytokines (IFN-γ, TNF-α, and IL-2) and Th2-type cytokines (IL-4 and IL-6) produced in response to the vaccines, as shown in Figure 7 . The data revealed that IFN-γ, TNF-α, and IL-2 levels immunized with vaccines were significantly higher than (p < 0.001, p < 0.0001) that immunized with PBS. Notably, Th1-type cytokines from DNA/Protein immunized sheep induced the highest levels compared to the DNA/rAdV (p < 0.05, p < 0.001) immunized sheep ( Figures 7A–C ).

In addition, the IL-4 and IL-6 levels in the DNA/Protein and DNA/rAdV groups were significantly higher (p < 0.001) than the PBS group. Importantly, IL-4 and IL-6 levels from DNA/Protein immunized sheep elicited significantly higher than (p < 0.01) those from the DNA/rAdV immunized sheep ( Figure 7 ). This data suggested that both of these two immunization strategies could induce a Th1/Th2 mix type cytokine immune response, while the DNA prime-subunit boost immunization strategy could induce a better response.