<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Immunol.</journal-id>
<journal-title>Frontiers in Immunology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Immunol.</abbrev-journal-title>
<issn pub-type="epub">1664-3224</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fimmu.2022.887602</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Immunology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Lnc90386 Sponges miR-33-5p to Mediate <italic>Mycoplasma gallisepticum-</italic>Induced Inflammation and Apoptosis in Chickens <italic>via</italic> the JNK Pathway</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Sun</surname>
<given-names>Yingfei</given-names>
</name>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Yingjie</given-names>
</name>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zou</surname>
<given-names>Mengyun</given-names>
</name>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Tengfei</given-names>
</name>
<uri xlink:href="https://loop.frontiersin.org/people/1220749"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Lulu</given-names>
</name>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Peng</surname>
<given-names>Xiuli</given-names>
</name>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/538136"/>
</contrib>
</contrib-group>
<aff id="aff1">
<institution>Key Laboratory of Agricultural Animal Genetics, Breeding and Reproduction, Ministry of Education, Huazhong Agricultural University</institution>, <addr-line>Wuhan</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Martin James Holland, University of London, United Kingdom</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Jianjun Sun, The University of Texas at El Paso, United States; Tatiana A. Semashko, Research Institute for Systems Biology and Medicine, Russia; Muhammad Ishfaq, Huanggang Normal University, China</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Xiuli Peng, <email xlink:href="mailto:xlpengsishun@mail.hzau.edu.cn">xlpengsishun@mail.hzau.edu.cn</email>
</p>
</fn>
<fn fn-type="other" id="fn002">
<p>This article was submitted to Microbial Immunology, a section of the journal Frontiers in Immunology</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>27</day>
<month>06</month>
<year>2022</year>
</pub-date>
<pub-date pub-type="collection">
<year>2022</year>
</pub-date>
<volume>13</volume>
<elocation-id>887602</elocation-id>
<history>
<date date-type="received">
<day>01</day>
<month>03</month>
<year>2022</year>
</date>
<date date-type="accepted">
<day>20</day>
<month>05</month>
<year>2022</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2022 Sun, Wang, Zou, Wang, Wang and Peng</copyright-statement>
<copyright-year>2022</copyright-year>
<copyright-holder>Sun, Wang, Zou, Wang, Wang and Peng</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>
<italic>Mycoplasma gallisepticum</italic> (MG) is one of the most important pathogens, that causes chronic respiratory disease (CRD) in chickens. Long non-coding RNAs (lncRNAs) are emerging as new regulators for many diseases and some lncRNAs can function as competing endogenous RNAs (ceRNAs) to regulate mRNAs by competitively binding to miRNAs. Here, we found that miR-33-5p was significantly up-regulated both in MG-infected chicken embryonic lungs and chicken embryo fibroblast cells (DF-1), and Lnc90386 negatively correlated with miR-33-5p. miR-33-5p, as a new regulator for MG infection, repressed apoptosis, inflammatory factors in DF-1 cells by targeting JNK1. Further analyses showed that Lnc90386 sponged miR-33-5p to weaken its inhibitory effect on JNK1, forming the ceRNA regulatory network. Furthermore, knockdown of Lnc90386 significantly inhibited apoptosis and inflammatory factors, and promoted DF-1 cells proliferation. However, co-treatment with miR-33-5p inhibitor and Lnc90386 siRNA showed that knockdown of Lnc90386 could partially eliminate the inhibiting effect of miR-33-5p inhibitor on inflammation, cell apoptosis and proliferation. In conclusion, Lnc90386 sponges miR-33-5p to defend against MG infection by inhibiting the JNK signaling pathway.</p>
</abstract>
<kwd-group>
<kwd>
<italic>Mycoplasma gallisepticum</italic> (MG)</kwd>
<kwd>miR-33-5p</kwd>
<kwd>JNK signaling pathway</kwd>
<kwd>Lnc90386</kwd>
<kwd>ceRNA</kwd>
</kwd-group>    <contract-sponsor id="cn001">National Natural Science Foundation of China<named-content content-type="fundref-id">10.13039/501100001809</named-content>
</contract-sponsor>    <contract-sponsor id="cn002">National Key Research and Development Program of China<named-content content-type="fundref-id">10.13039/501100012166</named-content>
</contract-sponsor>
<counts>
<fig-count count="10"/>
<table-count count="2"/>
<equation-count count="0"/>
<ref-count count="66"/>
<page-count count="18"/>
<word-count count="7909"/>
</counts>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<title>Introduction</title>
<p>
<italic>Mycoplasma gallisepticum</italic> (MG) infection causes chronic respiratory disease (CRD), which is a major infectious disease that endangers the development of the poultry industry worldwide (<xref ref-type="bibr" rid="B1">1</xref>&#x2013;<xref ref-type="bibr" rid="B3">3</xref>). Many studies have shown that MG adheres to the epithelial cells of the respiratory tract through its adhesion protein (pMGA), and then crosses the cell membrane through microtubules. Upon these processes, MG can induce inflammation damage and apoptosis by releasing genetic material and enzymes into the host cell (<xref ref-type="bibr" rid="B4">4</xref>, <xref ref-type="bibr" rid="B5">5</xref>). MG can exist for a long time and be difficult to be eliminated from infected birds, leading to serious economic losses in the poultry industry worldwide (<xref ref-type="bibr" rid="B6">6</xref>&#x2013;<xref ref-type="bibr" rid="B8">8</xref>). Therefore, it is urgent to find a new and effective way to block the transmission of MG or treat MG-induced inflammatory damage and apoptosis (<xref ref-type="bibr" rid="B9">9</xref>&#x2013;<xref ref-type="bibr" rid="B11">11</xref>). MG-HS, a virulent strain, is used in this study. pMGA1.2, the crucial adhesion protein on the surface of MG-HS, is responsible for MG-HS to propagate in animal tissues through binding to apolipoprotein A&#x2013;I (ApoA&#x2013;I) on the host (<xref ref-type="bibr" rid="B12">12</xref>).</p>
<p>miRNAs are a group of abundant non-coding small RNAs found in plants and animals. They can repress the expression of target genes by binding to their 3&#x2019;UTR sequences through seed sequences (<xref ref-type="bibr" rid="B13">13</xref>). Growing evidence has demonstrated that miRNAs play a significant role in avian diseases. For example, miRNAs can regulate avian influenza, Marek&#x2019;s disease, infectious bursal disease and avian mycoplasmosis (<xref ref-type="bibr" rid="B14">14</xref>). In addition, our previous studies have also highlighted the critical role of miRNAs (such as miR-181a-5p, miR-223 and miR-24) during MG infection (<xref ref-type="bibr" rid="B13">13</xref>, <xref ref-type="bibr" rid="B15">15</xref>, <xref ref-type="bibr" rid="B16">16</xref>). miR-33-5p belongs to the miR-33 family and is highly conserved among species (<xref ref-type="bibr" rid="B17">17</xref>, <xref ref-type="bibr" rid="B18">18</xref>). Several studies reveal that miR-33 is differentially expressed in a variety of poultry diseases, such as avian influenza (<xref ref-type="bibr" rid="B19">19</xref>), and Newcastle disease (<xref ref-type="bibr" rid="B20">20</xref>), suggesting that miR-33 may play an important role in various pathogenic microorganism infections. Our previous miRNAs deep sequencing showed that miR-33-5p was significantly up-regulated in MG-HS infection, indicating its potentially significant role in MG-HS infection (<xref ref-type="bibr" rid="B21">21</xref>).</p>
<p>C-jun N-terminal kinase 1 (JNK1) is a member of the mitogen-activated protein kinase (MAPK) family which is widely expressed in various tissue cells. The JNK signaling pathway centered on JNK1 can be activated by a variety of factors, and plays a crucial role in cell apoptosis and immune response. In addition, this pathway is closely related to the occurrence and development of various respiratory diseases. Numerous studies have shown that JNK1 is involved in the regulation of lung diseases, inflammation and apoptosis (<xref ref-type="bibr" rid="B22">22</xref>). According to these reports, JNK1 is inhibited by viral NS1 protein thus blocking apoptosis of infected cells (<xref ref-type="bibr" rid="B23">23</xref>). JNK1-deficient mice can decrease influenza A burden in viral pneumonia, yet display worsened morbidity (<xref ref-type="bibr" rid="B24">24</xref>). Furthermore, peptidoglycan from Staphylococcus aureus requires JNK1 to drive IL-8 production in lung type II cells (<xref ref-type="bibr" rid="B25">25</xref>). However, the role of JNK1 in MG-induced CRD remains unclear.</p>
<p>Long non-coding RNAs (lncRNAs), a type of ncRNAs longer than 200nt, have been demonstrated to be involved in the regulation of lung disease progression (<xref ref-type="bibr" rid="B26">26</xref>). For example, lncRNA HOTTIP inhibits the expression of miR-774-5p and thus promotes lung tissue fibrosis (<xref ref-type="bibr" rid="B27">27</xref>). lncRNA FEZF1-AS1, as an oncogenic regulator, binds to miR-516b-5p to promote proliferation and invasion of lung cancer cells (<xref ref-type="bibr" rid="B28">28</xref>). And the silencing of lncRNA MEG3 enhances the binding between miR-7b and NLRP3 to ameliorate LPS-induced acute lung injury (<xref ref-type="bibr" rid="B29">29</xref>). These findings suggest that lncRNAs, as sponges for miRNAs, play important roles in a variety of biological processes (lung diseases). However, it is unclear whether miR-33-5p mediates MG infection and whether lncRNAs could interact with miR-33-5p to influence the expression of miR-33-5p target genes and thus regulate the infection process of MG.</p>
<p>In this study, DF-1 cells spread throughout the body were used as an <italic>in vitro</italic> model to investigate the mechanism of operation of Lnc90386-miR-33-5p during the infection of MG. We identified that miR-33-5p inhibits JNK signaling pathway <italic>via</italic> targeting JNK1 to repress MG-induced inflammation and apoptosis, and Lnc90386 as a ceRNA to alleviate the effect of miR-33-5p on negatively regulating JNK1 in MG infection. Our results reveal a novel MG-induced CRD regulatory model that is composed of miR-33-5p, Lnc90386 and JNK1, and explore their ceRNA system in MG-induced inflammation and apoptosis.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<title>Materials and Methods</title>
<sec id="s2_1">
<title>Mycoplasma Strains and Infection Experiments</title>
<p>MG-HS, a virulent strain, is reported in detail in our previous studies (<xref ref-type="bibr" rid="B30">30</xref>). The concentration of MG-HS in this study was 10<sup>10</sup>CCU/mL. DF-1 cells and CP-II cells were cultured in a 6-wells plate and treated MG. After 24h infection, we isolated the total RNA or protein from infected cells. In addition, White Leghorn specific-pathogen-free (SPF) chicken embryos were used for MG-HS infection experiments. The experimental method was detailed in our previous reports (<xref ref-type="bibr" rid="B31">31</xref>). In short, the chick embryo allantoic cavity was injected with 300 ul of MG on 9-day of incubation. Then, samples of chicken embryonic lung tissue were collected at 6, 7, 8, and 9 days post-infection (15, 16, 17 and 18 days after hatching).</p>
</sec>
<sec id="s2_2">
<title>Construction of Plasmid and Dual-Luciferase Reporter Assay</title>
<p>The wild-type and mutant 3&#x2019;UTR DNA fragments of JNK1 covering the predicted binding sites of miR-33-5p were successfully replicated. The psiCHECK&#x2122;-2-JNK1-3&#x2019;UTR (wild type and mutant) vector was constructed by combining the luciferase vector psi-CHECK&#x2122;-2 (Promega, Madison, WI, USA) with JNK1-3&#x2019;UTR (wild type and mutant). Similarly, we cloned the CDS of JNK1 or Lnc90386 into the pcDNA3.1 vector. The primers are described in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Sequences of DNA primers.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Name</th>
<th valign="top" align="center">Primer Sequence (5&#x2032;-3&#x2032;)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left"/>
<td valign="top" align="left">
<bold>Primers for CDS Cloning</bold>
</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>JNK1-CDS-F</bold>
</td>
<td valign="top" align="left">CAAGCTGGCTAGCGTTTAAACTTAAGCTTATGAGCAGAAGCAAGCGTGAC</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>JNK1-CDS-R</bold>
</td>
<td valign="top" align="left">GGTTTAAACGGGCCCTCTAGACTCGAGTCATTGCTGCACCTGTGCTA</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Lnc90386-CDS-F</bold>
</td>
<td valign="top" align="left">GGCTAGCGTTTAAACTTAAGCTTGGTACCAAGAAAACCTATGATCGTGCAATTA</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Lnc90386-CDS-R</bold>
</td>
<td valign="top" align="left">CTGGACTAGTGGATCCGAGCTCGGTACCACATCAATATATTTTTATTTTTATAAATTATTCC</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Mut-Lnc90386-CDS-F</bold>
</td>
<td valign="top" align="left">TATAATCACGATAAACTTGTAATTGAAGAACAGTCT</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Mut-Lnc90386-CDS-R</bold>
</td>
<td valign="top" align="left">TACAAGTTTATCGTGATTATATATATCTTCTAAGCTATCTCCTT</td>
</tr>
<tr>
<td valign="top" align="left"/>
<td valign="top" align="left">
<bold>Primers for Dual-Luciferase Reporter</bold>
</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>JNK1 3&#x2019;UTR-F</bold>
</td>
<td valign="top" align="left">TTCCTCGAGTTCGAAGTTTTATGCTTGGTC</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>JNK1 3&#x2019;UTR-R</bold>
</td>
<td valign="top" align="left">AATGCGGCCGCCTAGACGTCCTGGATACACC</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Mut-JNK1 3&#x2019;UTR-F</bold>
</td>
<td valign="top" align="left">GAATAATACATTACAGCATAAATAAACTGTTTACTTCTAGCTTG</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Mut-JNK1 3&#x2019;UTR-R</bold>
</td>
<td valign="top" align="left">GTAAACAGTTTATTTATGCTGTAATGTATTATTCATGAAGTATCCTC</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Luc-Lnc90386-F</bold>
</td>
<td valign="top" align="left">AGCAGTAATTCTAGGCGATCGCTCGAGGAAAACCTATGATCGTGCAATTAAG</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Luc-Lnc90386-R</bold>
</td>
<td valign="top" align="left">GTTTAAACGAATTCCCGGGCTCGAGTATACCTACAACTGGTGCTTTCAGC</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Mut-Luc-Lnc90386-F</bold>
</td>
<td valign="top" align="left">TATAATCACGATAAACTTGTAATTGAAGAACAGTCT</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Mut-Luc-Lnc90386-R</bold>
</td>
<td valign="top" align="left">TACAAGTTTATCGTGATTATATATATCTTCTAAGCTATCTCCTT</td>
</tr>
<tr>
<td valign="top" align="left"/>
<td valign="top" align="left">
<bold>Primers for RT-qPCR</bold>
</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>RT-gga-miR-5S</bold>
</td>
<td valign="top" align="left">AACTGGTGTCGTGGAGTCGGC</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>gga-5s-rRNA-F</bold>
</td>
<td valign="top" align="left">CCATACCACCCTGGAAACGC</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>gga-5s-rRNA-R</bold>
</td>
<td valign="top" align="left">TACTAACCGAGCCCGACCCT</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>RT-gga-miR-33</bold>
</td>
<td valign="top" align="left">CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGCAATGCA</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>gga-miR-33-F</bold>
</td>
<td valign="top" align="left">GGGTGCATTGTAGTTGCATTGC</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>gga-miR-33-R</bold>
</td>
<td valign="top" align="left">ACTGGTGTCGTGGAGTCGGC</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>IL-1&#x3b2;-F</bold>
</td>
<td valign="top" align="left">CTACACCCGCTCACAGTCCT</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>IL-1&#x3b2;-R</bold>
</td>
<td valign="top" align="left">TCGGTGCCGCTCATCACACA</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>TNF-&#x3b1;-F</bold>
</td>
<td valign="top" align="left">GGACAGCCTATGCCAACAAG</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>TNF-&#x3b1;-R</bold>
</td>
<td valign="top" align="left">ACACGACAGCCAAGTCAACG</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>GAPDH-F</bold>
</td>
<td valign="top" align="left">CCTCTCTGGCAAAGTCCAAG</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>GAPDH-R</bold>
</td>
<td valign="top" align="left">TTGATGTTGCTGGGGTCACG</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>JNK1-F</bold>
</td>
<td valign="top" align="left">CAATAGGATCGGGAGCGCAA</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>JNK1-R</bold>
</td>
<td valign="top" align="left">TCGTTCATGGTCTAGCTCCA</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>JUN-F</bold>
</td>
<td valign="top" align="left">CTCAGCAACTTCAACCCCAA</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>JUN-R</bold>
</td>
<td valign="top" align="left">CTTTGATTCTCTCCTGCGAC</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>FOS-F</bold>
</td>
<td valign="top" align="left">GACAGCCTCACCTACTACCC</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>FOS-R</bold>
</td>
<td valign="top" align="left">AAATCCTGCGAGTTGACGGG</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>FAS-F</bold>
</td>
<td valign="top" align="left">CTGCTCCTCGTCATTGTGTT</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>FAS-R</bold>
</td>
<td valign="top" align="left">CTCCACAGGTAATTTCTCGC</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>BCL-2-F</bold>
</td>
<td valign="top" align="left">AAGCAAGCGTGACAAC</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>BCL-2-R</bold>
</td>
<td valign="top" align="left">ATCATAGGCTGCACATAC</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>CASP8-F</bold>
</td>
<td valign="top" align="left">GGGTGTCTCCGTTCAGGTAT</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>CASP8-R</bold>
</td>
<td valign="top" align="left">CATCTCTCCTTCACCAAGTAAGT</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>CASP9-F</bold>
</td>
<td valign="top" align="left">TGCCGACGTTCCATAGAGTC</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>CASP9-R</bold>
</td>
<td valign="top" align="left">ACGATGTCTGACACCCGAAG</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Lnc90386-F</bold>
</td>
<td valign="top" align="left">CTTGATTCTGCAAGGCGCTC</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Lnc90386-R</bold>
</td>
<td valign="top" align="left">TCCACCTCCCAGTCAAGTCA</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Lnc56449-F</bold>
</td>
<td valign="top" align="left">TTACAGAGCTCAGCTGCACC</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Lnc56449-R</bold>
</td>
<td valign="top" align="left">GCACGCATCGAAATTCCCTC</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Lnc66351-F</bold>
</td>
<td valign="top" align="left">CTCCTCTCCCTCTGGCTTCT</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Lnc66351-R</bold>
</td>
<td valign="top" align="left">ATTTGCAAAGAACACCGGGC</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Lnc68634-F</bold>
</td>
<td valign="top" align="left">CCACAGCTGCCTGAACTACA</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Lnc68634-R</bold>
</td>
<td valign="top" align="left">GACTGACCTGCCCAGTTTGA</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Lnc71825-F</bold>
</td>
<td valign="top" align="left">CGGCGCACACAAATTTAGCT</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Lnc71825-R</bold>
</td>
<td valign="top" align="left">GGCATTTGTAGGCCCTCACT</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Lnc81972-F</bold>
</td>
<td valign="top" align="left">TGCAGAAAGGCTTGCCAAAC</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Lnc81972-R</bold>
</td>
<td valign="top" align="left">AGCCCAGCTCCTTCTAGGAA</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Lnc86360-F</bold>
</td>
<td valign="top" align="left">GTTTGCACGTTTCCCACCTC</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Lnc86360-R</bold>
</td>
<td valign="top" align="left">CCCACGGGAAGCTTTCAGAT</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Lnc88478-F</bold>
</td>
<td valign="top" align="left">CCCACTGCCTCCTAACGTTT</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>Lnc88478-R</bold>
</td>
<td valign="top" align="left">GGTTGACTTCGCGAGTTTCG</td>
</tr>
</tbody>
</table>
</table-wrap>
<p>Dual-luciferase reporter assay is detailed in our previous reports (<xref ref-type="bibr" rid="B16">16</xref>). In a nutshell, when cells reached 80-90% confluence, using Lipofectamine 2000 (Invitrogen Life Technologies, USA) each co-transfected cells with wild-type or mutant reporter plasmid (200 ng) and 10 pmol of the indicated RNA oligonucleotides. Then, the luciferase activity in each group was detected by using an automatic microplate reader (Bio-Rad, Hercules, CA, USA) in accordance with the dual luciferase reporter gene detection kit instructions (Promega, Madison, WI, USA) according to the manufacturer&#x2019;s protocol.</p>
</sec>
<sec id="s2_3">
<title>DNA Primers and RNA Oligonucleotides</title>
<p>In this experiment, total sequences of DNA primers were adopted, which are presented in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>. In addition, miR-33-5p mimics (denoted as miR-33-5p) are double-stranded RNAs synthesized to simulate naturally occurring mature miR-33-5p, whereas the inhibitor (denoted as miR-33-5p-Inh) are chemically modified antisense single-stranded RNAs that silence the endogenous miRNAs by sequence complementarity. A random miRNA mimics that had not been found to suppress any chicken target genes (denoted as miR-33-5p-NC), and a random miRNA inhibitor that had not been found to promote any chicken target genes (denoted as miR-33-5p-Inh-NC) were also designed and synthesized to serve as the negative controls. All RNA oligonucleotides were designed and synthesized by GenePharm (Shanghai, China). The RNA oligonucleotides sequences are shown in <xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>.</p>
<table-wrap id="T2" position="float">
<label>Table&#xa0;2</label>
<caption>
<p>Sequences of RNA oligonucleotides.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Name</th>
<th valign="top" align="center">Sequences (5&#x2032;&#x2013;3&#x2032;)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" rowspan="2" align="left">
<bold>miR-33-5p mimics</bold>
</td>
<td valign="top" align="left">GUGCAUUGUAGUUGCAUUGC</td>
</tr>
<tr>
<td valign="top" align="left">AAUGCAACUACAAUGCACUU</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="left">
<bold>miR-33-5p NC</bold>
</td>
<td valign="top" align="left">UUCUCCGAACGUGUCACGUTT</td>
</tr>
<tr>
<td valign="top" align="left">ACGUGACACGUUCGGAGAATT</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>miR-33-5p inhibitor</bold>
</td>
<td valign="top" align="left">GCAAUGCAACUACAAUGCAC</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>miR-33-5p inhibitor-NC</bold>
</td>
<td valign="top" align="left">CAGUACUUUUGUGUAGUACAA</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="left">
<bold>Si-Lnc90386</bold>
</td>
<td valign="top" align="left">GGGCUUAAGCGUUCAGCUATT</td>
</tr>
<tr>
<td valign="top" align="left">UAGCUGAACGCUUAAGCCCTT</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="left">
<bold>siRNA NC</bold>
</td>
<td valign="top" align="left">UUCUCCGAACGUGUCACGUTT</td>
</tr>
<tr>
<td valign="top" align="left">ACGUGACACGUUCGGAGAATT</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_4">
<title>Overexpression or Inhibition of miR-33-5p, Lnc90386 and JNK1</title>
<p>Once 80-90% confluence was achieved, each group of cells was transfected with mimics, inhibitor, plasmids and siRNA respectively. At 48h after transfection, TRNzol (TIANGEN, Beijing, China) was used to harvest total cells.</p>
</sec>
<sec id="s2_5">
<title>RNA Isolation and Quantitative Real-Time PCR</title>
<p>According to the manufacturer&#x2019;s instructions, total RNA was isolated from post-infected and non-infected cells <italic>via</italic> TRNzol Universal Reagent kit (TIANGEN, Beijing, China). Then, RNA was inverse transcribed to cDNA with the first strand cDNA synthesis kit (Cat No.11119-11141; Yeasen, Shanghai, China) and reverse transcription PCR (RT-PCR).</p>
</sec>
<sec id="s2_6">
<title>Cell Proliferation and Apoptosis Assays</title>
<p>The Cell Counting Kit-8 (CCK-8, DOJINDO, Shanghai, China) was used for cell proliferation experiments. Cells were inoculated on a 96-well plate at 2x10<sup>4</sup> cells per well. Each group of cells was separately transfected with different oligonucleotides or plasmids using Lipofectamine&#x2122;3000 and each group had 6 biological replicates. Next, MG-HS (7&#xb5;L, 10<sup>10</sup> CCU/mL) was utilized to infect DF-1 cells for 2 hours. At 12h, 24h, and 36h post-transfection, the cell proliferation curve was measured by the CCK-8 kit according to the manufacturer&#x2019;s instructions. Transfection treatments were described above. Annexin V, FITC apoptosis detection kit (DOJINDO) was used to test the cell apoptosis. Each group was repeated three times.</p>
</sec>
<sec id="s2_7">
<title>ELISA</title>
<p>The grouping of transfection treatments was described above. Forty-eight hours after transfection, the supernatants were collected and the pro-inflammatory cytokines (IL-1&#x3b2; and TNF-&#x3b1;) levels were detected with enzyme-linked immunosorbent assay kits (Bio Legend, San Diego, CA) according to the manufacturer&#x2019;s directions.</p>
</sec>
<sec id="s2_8">
<title>Western Blot</title>
<p>Forty-eight hours after transfection, DF-1 cells were lysed in RIPA buffer (Beyotime, Nantong, China) supplemented with 100 mM phenyl methane sulfonyl fluoride (PMSF) to exact total protein. Protein concentrations were measured by the Pierce BCA Protein Assay Kit (Transgen, Shanghai, China). An equal amount of protein was separated by 12% SDS-polyacrylamide gel electrophoresis (Beyotime, China) and blocked with 5% skim milk for 1h. Then, the membranes were separately probed with p-JUN (ABclonal, AP0048), p-FOS (ABclonal, AP0038), p-JNK1 (ABclonal, AP0631), Bcl-2 (ABclonal, A19693), Caspase8 (ABclonal, A0215), Caspase9 (ABclonal, A18676), Caspase3(ABclonal, A19654), GAPDH (Abmart, M20024) overnight at 4&#xb0;C with a final dilution of 1:5000 (v/v). Finally, the membrane was incubated with the secondary antibody for 1h after TBST washing. The enhanced chemiluminescence (ECL) detection system (Bio-Rad) was used to detect protein expression.</p>
</sec>
<sec id="s2_9">
<title>Statistical Analysis</title>
<p>Data were presented as the mean &#xb1; SD. Student&#x2019;s t-test was used to determine significant differences between groups. A value of <italic>p</italic> &lt; 0.05 was considered statistically significant and <italic>p</italic> &lt; 0.01 considered extremely significant. (*<italic>p</italic> &lt; 0.05, **<italic>p</italic> &lt; 0.01).</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<title>Results</title>
<sec id="s3_1">
<title>miR-33-5p Is Remarkably Increased in MG Infection</title>
<p>Previous studies found that miR-33-5p was significantly up-regulated in MG infection by deep sequencing (<xref ref-type="bibr" rid="B21">21</xref>). The qPCR result showed that miR-33-5p was remarkably up-regulated both in DF-1 cells and CP-II cells with MG infection compared with the control group (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>). In addition, we observed that miR-33-5p expression was significantly higher in the lungs of the MG-infected chicken embryos than in the non-infected group on the 7th&#x2013;9th days of post-infection (equivalent to the 16th&#x2013;18th days of egg hatching) (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref>).</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Relative miR-33-5p expression level in MG-infected cells and chicken embryonic lung tissue. <bold>(A)</bold> The relative level of miR-33-5p in MG-infected DF-1 cells and CP-II cells. Cells cultivated in 6-well culture dishes were treated with MG. After 24h treatment, total RNA of infected cells were extracted using TRNzol Universal. The level of miR-33-5p-infected cells was detected by qPCR; <bold>(B)</bold> The relative level of miR-33-5p in MG-infected chicken embryo lungs. Total RNA were extracted from infected chicken embryo lungs on days 6-9 post-infection (equivalent to days 15-18 of eggs hatching) using TRNzol Universal. Then, the level of miR-33-5p in MG infected embryo chicken lungs was determined through qPCR. Above data was corrected <italic>via</italic> 5s-RNA as the internal quantitative control gene. All measurements shown were the mean &#xb1; SD from three independent experiments, each with three replicates. (*<italic>p</italic> &lt; 0.05, **<italic>p</italic> &lt; 0.01).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-887602-g001.tif"/>
</fig>
</sec>
<sec id="s3_2">
<title>miR-33-5p Affects pMGA1.2 Expression</title>
<p>pMGA1.2, the major adhesin protein of MG-HS, is required for MG-HS infection (<xref ref-type="bibr" rid="B12">12</xref>). To further evaluate the effect of miR-33-5p on the MG infection in DF-1 cells, miR-33-5p, miR-33-5p-NC, miR-33-5p-Inh or miR-33-5p-Inh-NC were transfected into DF-1 cells. Then, the DF-1 cells were treated with 200 &#xb5;L of MG at 10<sup>10</sup> CCU/mL for 24h. qPCR and Western blot were used to respectively determine the expression levels of miR-33-5p and pMGA1.2. As expected, miR-33-5p mimics had further up-regulated the expression of miR-33-5p induced by MG infection, whereas miR-33-5p inhibitor diminished its expression (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>). Furthermore, we found that overexpression of miR-33-5p led to a down-regulation of pMGA1.2 protein expression in DF-1 cells, while the opposite result was obtained when miR-33-5p was suppressed (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2B</bold>
</xref>).</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>miR-33-5p inhibits pMGA1.2 expression in DF-1 cells. DF-1 cells were transfected with miR-33-5p, miR-33-5p-NC, miR-33-5p-Inh or miR-33-5p-Inh-NC and were incubated for 24h and then infected MG for 24h. <bold>(A)</bold> qPCR was used to detect the expression of miR-33-5p, 5s-RNA was used as the internal control; <bold>(B)</bold> Western blot was used to detect the adhesion protein pMGA1.2 of MG. GAPDH was used as the internal control. (*<italic>p</italic> &lt; 0.05, **<italic>p</italic> &lt; 0.01).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-887602-g002.tif"/>
</fig>
</sec>
<sec id="s3_3">
<title>miR-33-5p Inhibits MG-Induced Inflammation and Apoptosis</title>
<p>Next, we further explored the biological functions of miR-33-5p on MG infection. qPCR and ELISA results showed that the expressions of pro-inflammatory cytokines IL-1<italic>&#x3b2;</italic> and TNF-<italic>&#x3b1;</italic> were significantly down-regulated in the miR-33-5p mimics group compared with the miR-33-5p NC group (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref>). Conversely, when the expression of endogenous miR-33-5p was inhibited, the release of pro-inflammatory cytokines was significantly increased (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3B</bold>
</xref>). In the MG-infected group, transfection with miR-33-5p mimic significantly down-regulated the expressions of MG-induced IL-1<italic>&#x3b2;</italic> and TNF-<italic>&#x3b1;</italic>, but transfection with miR-33-5p inhibitor showed the opposite results (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3A, B</bold>
</xref>).</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>miR-33-5p inhibits MG infection-induced inflammation and apoptosis. DF-1 cells were transfected with the indicated RNA oligonucleotides and infected with MG. <bold>(A)</bold> The expression levels of pro-inflammatory cytokines (TNF-&#x3b1; and IL-1&#x3b2;) after treatment with miR-33-5p mimics were detected by qPCR and Elisa; <bold>(B)</bold> The expression levels of pro-inflammatory cytokines (TNF-&#x3b1; and IL-1&#x3b2;) after treatment with miR-33-5p inhibitor were detected by qPCR and Elisa; <bold>(C)</bold> CCK-8 kit was used to detect cell proliferation at 12, 24, 48h post-infection; <bold>(D)</bold> The cells were stained with Annexin V- PI and analyzed by flow cytometer after 24h post-infection; <bold>(E)</bold> The expression of apoptosis marker genes after treatment with miR-33-5p mimics was detected by Western blot and qPCR; <bold>(F)</bold> The expression of apoptosis marker genes treatment with miR-33-5p inhibitor was detected by Western blot and qPCR. GAPDH was used as the internal control. Data was expressed as the mean &#xb1; SD of three independent experiments, each with three replicates. (*<italic>p</italic> &lt; 0.05, **<italic>p</italic> &lt; 0.01).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-887602-g003.tif"/>
</fig>
<p>In addition, we examined the effect of miR-33-5p on cell proliferation by using the CCK-8 kit. Data showed that MG infection significantly inhibited DF-1 cell proliferation. Overexpression of miR-33-5p alleviated the inhibition of MG-induced cell proliferation, whereas suppression of miR-33-5p exacerbated the loss of MG-induced cell proliferation (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3C</bold>
</xref>). Furthermore, cell apoptosis assay showed that upon MG infection, overexpression of miR-33-5p resulted in a reduction in apoptosis, while inhibition of miR-33-5p led to an opposite result (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3D</bold>
</xref>). To further explore how miR-33-5p regulates MG-induced cell apoptosis, the expression of apoptosis-related genes (including pro-apoptotic and anti-apoptotic genes) were examined by qPCR and Western blot. We found that pro-apoptotic genes including FAS, Casp3, Casp8 and Casp9 were significantly increased, while the anti-apoptotic gene BCL-2 was significantly suppressed after MG infection. Overexpression of miR-33-5p inhibited the expression of MG-induced FAS, Casp3, Casp8 and Casp9, but up-regulated the BCL-2 expression (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3E</bold>
</xref>). However, in the miR-33-5p inhibitor group, the opposite trend was observed (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3F</bold>
</xref>).</p>
</sec>
<sec id="s3_4">
<title>JNK1 Is a Direct Target of miR-33-5p</title>
<p>It is well known that miRNAs mediate complex biological processes by partially binding to the 3&#x2019;UTR of target genes (<xref ref-type="bibr" rid="B32">32</xref>). In order to explore the function of miR-33-5p in MG infection, potential target genes were predicted by TargetScan (<uri xlink:href="http://www.targetscan.org">http://www.targetscan.org</uri>) and miRDB (<uri xlink:href="http://www.mirdb.org/miRDB/index.html">http://www.mirdb.org/miRDB/index.html</uri>). Analysis of the KEGG database identified that the target genes of miR-33-5p were mainly enriched in the MAPK pathway (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4A</bold>
</xref>). The prediction result of TargetScan showed that the target site&#x2019;s sequence in the 3&#x2019;UTR of JNK1 is highly conserved across species (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4B</bold>
</xref>). The minimum free energy (MFE) of the RNA duplex was -19.2 kcal/mol (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4C</bold>
</xref>) by RNAhybrid, which suggested a powerful combination between miR-33-5p and JNK1. Meanwhile, we also found that JNK1 expression was down-regulated in both MG-infected cells and chicken embryo lungs, which was exactly opposite to the expression pattern of miR-33-5p (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4D, E</bold>
</xref>). To further confirm the targeting relationship between miR-33-5p and JNK1, the dual-luciferase reporter vectors containing either the wild-type or the mutant 3&#x2019;UTR of JNK1 were constructed (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4F</bold>
</xref>). Compared with the control group, miR-33-5p mimics could significantly reduce the luciferase activity of the reporter vector containing wild-type 3&#x2019;UTR, but had no obvious effect on the luciferase activity of mutant 3&#x2019;UTR reporter vector (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4G</bold>
</xref>). These results indicated that miR-33-5p could be complementarily bound to 3&#x2019;UTR of JNK1. In addition, the results of qPCR and Western blot showed that miR-33-5p mimics significantly inhibited JNK1 expression in both MG-infected and uninfected DF-1 cells, while miR-33-5p inhibitor markedly up-regulated JNK1 expression compared with the control group (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4H</bold>
</xref>).</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>miR-33-5p negatively regulates JNK1 in DF-1 cells. <bold>(A)</bold> The KEGG enrichment result of target genes of miR-33-5p; <bold>(B)</bold> Alignment of JNK1 3&#x2032;UTR in different species; <bold>(C)</bold> The secondary structure of the RNA duplex of miR-33-5p and the JNK1 3&#x2019;UTR target site; <bold>(D)</bold> The JNK1 expression was detected by qPCR and Western blot in MG-infected DF-1 cells and CP-II cells, GAPDH was used as the internal control; <bold>(E)</bold> The relative expression level of JNK1 in chicken embryo lungs from chicken embryo lungs on days 6-9 post-infection (equivalent to days 15-18 of eggs hatching) using qPCR, GAPDH was used as the internal control; <bold>(F)</bold> psiCHECK-2 dual-luciferase reporter vector containing the 3&#x2032;UTR (wild-type or mutant) of JNK1; <bold>(G)</bold> DF-1 cells were co-transfected with Luc-JNK1 3&#x2032;UTR (wild-type or mutant) and miR-33-5p mimics. At 24h post-transfection, the cells were assayed for both firefly and renilla activity through a dual-luciferase glow assay; <bold>(H)</bold> The mRNA and protein expression of JNK1 after treatment with miR-33-5p mimic/miR-33-5p inhibitor, GAPDH was used as the internal control. (*<italic>p</italic> &lt; 0.05, **<italic>p</italic> &lt; 0.01).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-887602-g004.tif"/>
</fig>
</sec>
<sec id="s3_5">
<title>miR-33-5p Inhibits the JNK Pathway by Targeting JNK1</title>
<p>Next, we further studied the functional mechanism of miR-33-5p in MG infection. It has been well reported that the JNK signaling pathway is the core pathway through which JNK1 exerts a regulatory role (<xref ref-type="bibr" rid="B33">33</xref>, <xref ref-type="bibr" rid="B34">34</xref>). The results of qPCR and Western blot showed that the mRNA and phosphorylated protein expressions of JUN and FOS in the MG infection group were significantly decreased compared with the normal group. Overexpression of miR-33-5p reduced the expression of JUN and FOS after MG infection (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5A, C</bold>
</xref>), while transfection with miR-33-5p inhibitor resulted in an opposite result (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5B, D</bold>
</xref>). These results show that miR-33-5p inhibits the JNK signaling pathway.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>miR-33-5p suppresses the JNK pathway by directly inhibiting the expression of JNK1. DF-1 cells were transfected with the indicated RNA oligonucleotides and infected with MG. JNK1, JUN and FOS mRNA levels and protein levels were measured by qPCR and Western blotting, respectively. <bold>(A)</bold> The relative mRNA expression level of JNU and FOS after treatment with miR-33-5p mimics; <bold>(B)</bold> The relative mRNA expression level of JNU and FOS after treatment with miR-33-5p inhibitor; <bold>(C)</bold> The protein expression of JNU and FOS after treatment with miR-33-5p mimics; <bold>(D)</bold> The protein expression of JNU and FOS after treatment with miR-33-5p inhibitor; <bold>(E)</bold> The relative mRNA expression level of JNK1, JUN and FOS after co-transfection of overexpression JNK1 vector and miR-33-5p mimics; <bold>(F)</bold> The relative mRNA expression level of JNK1, JUN and FOS after co-transformation of SP600125 and miR-33-5p inhibitor; <bold>(G)</bold> The protein expression of JNK1, JUN and FOS after co-transfection of overexpression JNK1 vector and miR-33-5p mimics; <bold>(H)</bold> The protein expression of JNK1, JUN and FOS after co-transformation of SP600125 and miR-33-5p inhibitor. GAPDH was used as the internal control. (*<italic>p</italic> &lt; 0.05, **<italic>p</italic> &lt; 0.01).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-887602-g005.tif"/>
</fig>
<p>To further confirm that miR-33-5p mediates the JNK signaling pathway by negatively regulating JNK1, we assessed the effects of JNK1, JNK1 inhibitor (SP600125) and JNK1 over-expressing pcDNA3.1 vector. First, we confirmed that overexpression of JNK1 substantially increased mRNA and protein expression of JNK1, but SP600125 significantly inhibited JNK1 expression in DF-1 cells (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5E, F</bold>
</xref>). The results of Western blot and qPCR showed that overexpression of JNK1 up-regulated the expressions of JUN and FOS to activate the JNK pathway in both MG-infected and uninfected DF-1 cells (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5E, G</bold>
</xref>). Consistently, overexpression of miR-33-5p significantly reversed the elevated expression levels of p-JUN and p-FOS caused by overexpression of JNK1, whereas knockdown of JNK1 resulted in opposite results (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5F, H</bold>
</xref>).</p>
</sec>
<sec id="s3_6">
<title>miR-33-5p Inhibits MG-Induced Inflammation and Apoptosis, and Reduces pMGA1.2 Expression Through JNK1</title>
<p>To further understand the regulatory role of miR-33-5p/JNK1 on MG infection, we over-expressed or down-regulated JNK1 in MG-infected DF-1 cells through the transfection of JNK1 overexpression vector or the treatment of JNK1 inhibitor (SP600125) respectively. The results of qPCR and Western blot showed that upon MG infection, overexpression of JNK1 led to the release of pro-inflammatory factors TNF-&#x3b1; and IL-1&#x3b2;, which was opposed by the overexpression of miR-33-5p (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6A</bold>
</xref>). As expected, downregulation of JNK1 by SP600125 obviously decreased the expressions of pro-inflammatory cytokines. Interestingly, the up-regulation of TNF-&#x3b1; and IL-1&#x3b2; induced by miR-33-5p inhibitor were counteracted when co-transfected with SP600125 in MG infection groups (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6B</bold>
</xref>), indicating that miR-33-5p down-regulates the inflammation by decreasing JNK1 expression.</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>miR-33-5p inhibits MG infection-induced inflammation and apoptosis and reduces pMGA1.2 expression through JNK1. DF-1 cells were transfected with the indicated RNA oligonucleotides and infected with MG. <bold>(A)</bold> The expression levels of pro-inflammatory cytokines (TNF-&#x3b1; and IL-1&#x3b2;) after treatment with co-transfection of overexpression JNK1 vector and miR-33-5p mimics were detected by qPCR and Elisa; <bold>(B)</bold> The expression levels of pro-inflammatory cytokines (TNF-&#x3b1; and IL-1&#x3b2;) after treatment with co-transformation of SP600125 and miR-33-5p inhibitor were detected by qPCR and Elisa; <bold>(C)</bold> CCK-8 kit was used to detect cell proliferation at 12, 24, 48h post-infection; <bold>(D)</bold> The cells were stained with Annexin V- PI and analyzed by flow cytometer after 24h post-infection; <bold>(E)</bold> The relative mRNA expression level of apoptosis marker genes after treatment with co-transfection of overexpression JNK1 vector and miR-33-5p mimics or co-transformation of SP600125 and miR-33-5p inhibitor was detected by qPCR; <bold>(F)</bold> The protein expression of apoptosis marker genes treatment with co-transfection of overexpression JNK1 vector and miR-33-5p mimics or co-transformation of SP600125 and miR-33-5p inhibitor was detected by Western blot; <bold>(G)</bold> Western blot was used to detect the adhesion protein pMGA1.2 of MG treatment with co-transfection of overexpression JNK1 vector and miR-33-5p mimics or co-transformation of SP600125 and miR-33-5p inhibitor. GAPDH was used as the internal control. Data was expressed as the mean &#xb1; SD of three independent experiments, each with three replicates. (*<italic>p</italic> &lt; 0.05, **<italic>p</italic> &lt; 0.01).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-887602-g006.tif"/>
</fig>
<p>In addition, we examined the effect of JNK1 on cell proliferation by using the CCK-8 kit. Results showed that overexpression of JNK1 inhibited the MG-infected cell proliferation, which was partly counteracted by transfection of miR-33-5p mimics (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6C</bold>
</xref>). Then, we also examined the effect of JNK1 on cell apoptosis induced by MG infection. Flow cytometry results found that overexpression of JNK1 aggravated MG-induced apoptosis, but miR-33-5p significantly reversed this pro-apoptotic effect (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6D</bold>
</xref>). Besides, the results of Western blot and qPCR showed that JNK1 promoted the expressions of pro-apoptotic genes including FAS, Casp3, Casp8 and Casp9, but suppressed the expression of anti-apoptotic BCL-2 (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6E, F</bold>
</xref>). These results demonstrate that miR-33-5p binds to JNK1 to inhibit MG-induced cellular inflammation and apoptosis.</p>
<p>To further investigate the regulatory role of miR-33-5p/JNK1 on MG infection, DF-1 cells were transfected with oligonucleotides and then co-cultured with MG for 48h. As shown in <xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6G</bold>
</xref>, apart from the blank group, pMGA1.2 expression was significantly high in all infected groups. Compared with the control group, overexpression of JNK1 distinctly increased the pMGA1.2 expression, but knockdown of JNK1 had an inverse effect. Importantly, miR-33-5p mimics significantly reversed the elevated pMGA1.2 expression caused by JNK1 overexpression, while the miR-33-5p inhibitor attenuated the inhibitory effect of SP600125 on pMGA1.2 expression.</p>
</sec>
<sec id="s3_7">
<title>Lnc90386 Is Significantly Reduced Both in MG-Infected Cells and Chicken Embryonic Lung Tissue</title>
<p>LncRNAs have been recently identified as ceRNAs that sponge miRNAs by complementary base pairing in animal diseases (<xref ref-type="bibr" rid="B35">35</xref>). To determine whether lncRNA is associated with miR-33-5p and regulates miR-33-5p expression, we obtained 14,674 chicken-related lncRNA sequences from LncRBase V.2 (<uri xlink:href="http://dibresources.jcbose.ac.in/zhumur/lncrbase2/start2.php">http://dibresources.jcbose.ac.in/zhumur/lncrbase2/start2.php</uri>). Next, we analyzed and identified overlapping 1533 potential lncRNAs that were predicted to target miR-33-5p by both miRanda and TargetScan (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7A</bold>
</xref>). Then, eight lincRNAs were screened for candidate lncRNAs by a series of indicators including the length of lncRNAs, the score of miRanda and the localization of lncRNAs (<xref ref-type="fig" rid="f7">
<bold>Figures&#xa0;7B, C</bold>
</xref>). qPCR results showed that Lnc90386, Lnc56449, Lnc68634, Lnc86360, Lnc88478 and Lnc71825 were significantly down-regulated in MG-infected DF-1 cells (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7D</bold>
</xref>). Moreover, the results in MG-infected chicken embryo lung tissues showed that only Lnc90386 was extremely decreased in all MG-infected groups compared with the blank groups (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7E</bold>
</xref>). Therefore, Lnc90386 was selected for this study.</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>Relative lncRNA expression level in cells and chicken embryonic lung tissue. <bold>(A)</bold> A venn diagram depicting 1533 lncRNAs that were predicted to target miR-33-5p both by TargetScan and miRanda; <bold>(B)</bold> Candidate LncRNAs; <bold>(C)</bold> Bioinformatic database showing bindings sites of both JNK1 3&#x2019;UTR and 8 lncRNAs to miR-33-5p; <bold>(D)</bold> DF-1 cells and CP-II cells were cultured in a 6-wells plate and treated MG. After 24h infection, we isolated the total RNA from infected cells <italic>via</italic> TRNzol Universal and detected the lncRNA expression by RT-qPCR; <bold>(E)</bold> On the 9th day of the chicken embryo hatching, MG was injected into the allantoic fluid, and the expression of lncRNA was measured by qPCR on the 15th, 16th, 17th and 18th day of the chicken embryo hatching. All data was corrected <italic>via</italic> GAPDH as the internal quantitative control gene. All measurements shown were the means &#xb1; SD from three independent experiments, each with three replicates. (*<italic>p</italic> &lt; 0.05, **<italic>p</italic> &lt; 0.01).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-887602-g007.tif"/>
</fig>
</sec>
<sec id="s3_8">
<title>Competitive Binding Between Lnc90386 and JNK1 for miR-33-5p</title>
<p>To investigate whether Lnc90386 could function as a ceRNA in MG infection, we first constructed a luciferase construct of wild-type Lnc90386 (Luc-Lnc90386) and a mutated form [Luc-Lnc90386(Mut)] to verify the binding relationship between miR-33-5p and Lnc90386 (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8A</bold>
</xref>). Results showed that miR-33-5p mimics significantly reduced the luciferase activity of Luc-Lnc90386, yet had no effect on mutant Luc-Lnc90386(Mut) (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8B</bold>
</xref>). These results reveal that Lnc90386 might interact with miR-33-5p by this putative binding site.</p>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>Competitive binding between Lnc90386 and JNK1 for miR-33-5p. <bold>(A)</bold> psiCHECK-2 dual-luciferase reporter vector containing (wild-type or mutant) Lnc90386; <bold>(B)</bold> DF-1 cells were co-transfected with Luc- Lnc90386 (wild-type or mutant) and the indicated RNA activity through a dual-luciferase glow assay; <bold>(C)</bold> DF-1 cells were co-transfected with Over-Lnc90386 (wild-type or mutant), Luc-JNK1 3&#x2032;UTR and the indicated RNA. At 24h post-transfection. The expression levels of Lnc90386 after treatment with Over- Lnc90386 were detected by qPCR. The cells were assayed for both firefly and renilla activity through a dual-luciferase glow assay; <bold>(D)</bold> DF-1 cells were co-transfected with Si-Lnc90386, Luc-JNK1 3&#x2032;UTR and the indicated RNA. At 24h post-transfection. The expression levels of Lnc90386 after treatment with Si-Lnc90386 were detected by qPCR. The cells were assayed for both firefly and renilla activity through a dual-luciferase glow assay; <bold>(E)</bold> The mRNA of miR-33-5p after treatment with Over- Lnc90386/Si-Lnc90386. 5s-RNA were used as the internal control; <bold>(F)</bold> The mRNA of JNK1 after treatment with Over- Lnc90386/Si-Lnc90386; <bold>(G)</bold> The protein expression of JNK1 after treatment with Over- Lnc90386/Si-Lnc90386. GAPDH was used as the internal control. (*<italic>p</italic> &lt; 0.05, **<italic>p</italic> &lt; 0.01).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-887602-g008.tif"/>
</fig>
<p>Subsequently, to further verify the relationship between Lnc90386 and miR-33-5p-JNK1, wild-type/mutant vectors overexpressing Lnc90386 [named Over-Lnc90386/Over-Lnc90386(Mut)] were successfully constructed. The Lnc90386 overexpression vector had an excellent overexpression effect (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8C</bold>
</xref>). Over-Lnc90386 or Over-Lnc90386(Mut) was co-transfected with miR-33-5p mimics and JNK1-3&#x2019;UTR into DF-1 cells for 24h, respectively. The results showed that the activity of JNK1-3&#x2019;UTR was significantly increased when Lnc90386 was overexpressed. However, upon mutation of the miR-33-5p and Lnc90386 binding site, the fluorescence activity of JNK1-3&#x2019;UTR was significantly reduced to the point where there was no statistical difference with the miR-33-5p/JNK1-3&#x2019;UTR co-transfection group (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8C</bold>
</xref>). Meanwhile, the Lnc90386 knockdown (Si-Lnc90386) experiment was also performed. Si-Lnc90386 significantly decreased the relative fluorescence activity of JNK1-3&#x2019;UTR. However, Over-Lnc90386 counteracted the reduced relative fluorescence activity of JNK1-3&#x2019;UTR by Si-Lnc90386 (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8D</bold>
</xref>). Thus, these results show that the presence of Lnc90386 hinders the inhibitory effect of miR-33-5p on JNK1-3&#x2019;UTR.</p>
<p>To demonstrate that Lnc90386 can act as a ceRNA to regulate JNK1 expression by competitively binding miR-33-5p. miR-33-5p mimics, miR-33-5p inhibitor, miR-33-5p mimics + Over-Lnc90386, miR-33-5p inhibitor + Si-Lnc90386 were transfected into DF-1 cells, respectively. Subsequently, DF-1 cells were infected with 200 &#xb5;L of MG at 10<sup>10</sup> CCU/mL at 24h post-transfection. As expected, overexpression of Lnc90386 significantly repressed the expression of miR-33-5p, but this inhibitory effect could be partially counteracted by the co-transfection of miR-33-5p. In contrast, the Si-Lnc90386 group significantly increased the expression of miR-33-5p, while the Si-Lnc90386+miR-33-5p inhibitor group significantly down-regulated the miR-33-5p expression (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8E</bold>
</xref>). Meanwhile, we also tested the JNK1 expression under the same treatment by qPCR and Western blot. As shown in <xref ref-type="fig" rid="f8">
<bold>Figures&#xa0;8F, G</bold>
</xref>, overexpression of Lnc90386 significantly enhanced the JNK1 expression, while knockdown of Lnc90386 had the opposite effect. When cells were co-transfected with miR-33-5p mimics and Lnc90386, miR-33-5p mimics reduced the effect of over-Lnc90386, but knockdown of Lnc90386 had the opposite effect (<xref ref-type="fig" rid="f8">
<bold>Figures&#xa0;8F, G</bold>
</xref>). Interestingly, compared with all uninfected groups, miR-33-5p was significantly up-regulated while JNK1 was down-regulated in all infected groups, which indicated that down-regulated Lnc90386 could promote the miR-33-5p expression and inhibit the JNK1 expression during the MG infection. The above results indicate that Lnc90386 regulates JNK1 expression by sponging miR-33-5p.</p>
</sec>
<sec id="s3_9">
<title>Lnc90386 Regulates MG Infection Through miR-33-5p/JNK1</title>
<p>As Lnc90386 can interact with miR-33-5p, we then tested whether Lnc90386 was capable of regulating MG infection. DF-1 cells were transfected with Over-Lnc90386, Si-Lnc90386 or co-transfected with Lnc90386 plasmid and miR-33-5p oligonucleotide, and MG was infected after 24h of the treatment. The results of qPCR and ELISA showed that overexpression of Lnc90386 resulted in up-regulation of IL-1&#x3b2; and TNF-&#x3b1; (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9A</bold>
</xref>). Interestingly, after MG infection, the up-regulation of pro-inflammatory factors induced by overexpression of Lnc90386 was partially offset by overexpression of miR-33-5p (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9A</bold>
</xref>). In contrast, knockdown of Lnc90386 down-regulated the expressions of MG-induced pro-inflammatory factors, but this trend was significantly attenuated by the miR-33-5p inhibitor (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9B</bold>
</xref>). These results indicate that Lnc90386 affects the secretion of pro-inflammatory factors by adsorbing miR-33-5p.</p>
<fig id="f9" position="float">
<label>Figure&#xa0;9</label>
<caption>
<p>Lnc90386 regulates MG infection through miR-33-5p/JNK1. DF-1 cells were transfected with oligonucleotides and infected with MG. <bold>(A)</bold>The expression levels of pro-inflammatory cytokines (TNF-&#x3b1; and IL-1&#x3b2;) after treatment with co-transfection of overexpression Lnc90386 vector and miR-33-5p mimics were detected by qPCR and Elisa; <bold>(B)</bold> The expression levels of pro-inflammatory cytokines (TNF-&#x3b1; and IL-1&#x3b2;) after treatment with co-transformation of Si-Lnc90386 and miR-33-5p inhibitor were detected by qPCR and Elisa; <bold>(C)</bold> CCK-8 kit was used to detect cell proliferation at 12, 24, 48h post-infection; <bold>(D)</bold> The cells were stained with Annexin V- PI and analyzed by flow cytometer after 24h post-infection; <bold>(E)</bold> The relative mRNA expression level of apoptosis marker genes after treatment with co-transfection of overexpression Lnc90386 vector and miR-33-5p mimics or co-transformation of Si-Lnc90386 and miR-33-5p inhibitor was detected by qPCR; <bold>(F)</bold> The protein expression of apoptosis marker genes treatment with co-transfection of overexpression Lnc90386 vector and miR-33-5p mimics or co-transformation of Si-Lnc90386 and miR-33-5p inhibitor was detected by Western blot and qPCR; <bold>(G)</bold> Western blot was used to detect the adhesion protein pMGA1.2 of MG treatment with co-transfection of overexpression Lnc90386 vector and miR-33-5p mimics or co-transformation of Si-Lnc90386 and miR-33-5p inhibitor. GAPDH was used as the internal control. Data was expressed as the mean &#xb1; SD of three independent experiments, each with three replicates. (*<italic>p</italic> &lt; 0.05, **<italic>p</italic> &lt; 0.01).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-887602-g009.tif"/>
</fig>
<p>Subsequently, we further analyzed the effect of Lnc90386 on cell proliferation and apoptosis. As shown in <xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9C</bold>
</xref>, overexpression of Lnc90386 aggravated the loss of the MG-induced cell viability, which was attenuated by miR-33-5p mimic. Consistently, knockdown of Lnc90386 had an opposite effect (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9C</bold>
</xref>). Furthermore, enforced expression of Lnc90386 aggravated MG-induced apoptosis (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9D</bold>
</xref>), increased the expression of pro-apoptotic genes including FAS, Casp3, Casp8 and Casp9, and decreased the expression of the anti-apoptotic gene BCL-2 (<xref ref-type="fig" rid="f9">
<bold>Figures&#xa0;9E, F</bold>
</xref>). As expected, Lnc90386 siRNA had an exactly opposite effect (<xref ref-type="fig" rid="f9">
<bold>Figures&#xa0;9D&#x2013;F</bold>
</xref>). It is worth mentioning that the miR-33-5p mimics partially reversed Lnc90386-induced cell apoptosis. Similarly, the miR-33-5p inhibitor attenuated the Lnc90386 siRNA-induced cell apoptosis inhibition.</p>
<p>More importantly, overexpressed Lnc90386 facilitated the expression of the MG adhesion protein pMGA1.2, while the opposite result was obtained when Lnc90386 was suppressed (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9G</bold>
</xref>). As expected, miR-33-5p inhibited the promotion effect of Lnc90386 on pMGA1.2.</p>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<title>Discussion</title>
<p>MG infection mainly causes CRD in chicken, inducing serious inflammatory reactions and immune responses through colonization of the respiratory mucosa (<xref ref-type="bibr" rid="B36">36</xref>, <xref ref-type="bibr" rid="B37">37</xref>). Inflammatory damage and apoptosis are MG-infected important pathogenic mechanisms. Accumulating evidence suggests that miRNAs play important regulatory roles during MG-HS infection (<xref ref-type="bibr" rid="B15">15</xref>). Furthermore, in recent years, lncRNAs, especially lncRNAs as ceRNAs, have been extensively documented in multiple studies including poultry diseases and immune responses (<xref ref-type="bibr" rid="B38">38</xref>&#x2013;<xref ref-type="bibr" rid="B40">40</xref>). However, detailed studies regarding roles of lncRNAs and their regulatory mechanism in MG infection are still insufficient. Therefore, it would be valuable to explore the functions and underlying mechanisms of the lncRNA-miRNA-mRNA axis in MG-infected chickens.</p>
<p>miR-33 has been reported to regulate inflammatory responses, cellular function and gene expression (<xref ref-type="bibr" rid="B41">41</xref>, <xref ref-type="bibr" rid="B42">42</xref>). Importantly, dysregulation of miR-33 has been frequently reported to be closely associated with respiratory disease and pathogenic microbial infections (<xref ref-type="bibr" rid="B43">43</xref>, <xref ref-type="bibr" rid="B44">44</xref>). For example, miR-33 suppresses LPS-stimulated production of pro-inflammatory factor (TNF-&#x3b1; and IL-1&#x3b2;) in macrophages by inhibiting RIP140 expression (<xref ref-type="bibr" rid="B45">45</xref>). miR-33-5p regulates Angpt2-inducing mesangial cell apoptosis <italic>via</italic> targeting SOCS5 (<xref ref-type="bibr" rid="B46">46</xref>). And miR-33 inhibitor can inhibit the replication of vesicular stomatitis virus (VSV) and potentiate antiviral immune response through interacting with target gene AMPK (<xref ref-type="bibr" rid="B47">47</xref>). Moreover, miR-33a is negatively associated with exacerbation severity in asthmatic children, indicating their potential prognostic power for asthma management (<xref ref-type="bibr" rid="B48">48</xref>). Previous studies found that miR-33-5p was significantly up-regulated in MG infection by RNA-Seq (<xref ref-type="bibr" rid="B21">21</xref>, <xref ref-type="bibr" rid="B31">31</xref>). This study showed that miR-33-5p was remarkably up-regulated both in MG-infected cells and chicken embryos. Here, we confirmed that miR-33-5p was up-regulated both in MG-infected chicken embryo lung tissue and cells, and overexpression of miR-33-5p suppressed the expression of pMGA1.2 protein, while its inhibitor resulted in the opposite result. In addition, we found that miR-33-5p inhibited MG-induced inflammation and apoptosis.</p>
<p>Typically, miRNAs exert regulatory effects on the gene expression and cellular processes by negatively regulating target genes at the post-transcriptional level (<xref ref-type="bibr" rid="B49">49</xref>). In addition, in our previous RNA-Seq study, differential miRNAs were enriched to the MAPK pathway and apoptosis pathway. It is predicted that MAPK pathway and apoptosis pathway may be the key pathways of miRNAs involved in the regulation of MG infection (<xref ref-type="bibr" rid="B21">21</xref>). These two pathways are consistent with this study. Meanwhile, our results also confirmed that JNK1 was a direct target of miR-33-5p. JNK1 is a member of the MAPK family. A major target of JNK1 is the transcription factor AP1 (activator protein-1, AP-1) which consists of a JNU family member and a FOS family member (<xref ref-type="bibr" rid="B50">50</xref>). External stimulus leads to the activation of JNK1, and then the activated p-JNK1 translocates from the cytoplasm to the nucleus and rapidly phosphorylates c-Jun to activate the activity of AP-1 (<xref ref-type="bibr" rid="B51">51</xref>). Activated AP-1 initiates transcription, promotes gene expression and protein synthesis, and exerts corresponding biological effects (<xref ref-type="bibr" rid="B52">52</xref>). In our study, we found that phosphorylated JUN and FOS were significantly up-regulated through overexpression of JNK1 and these results were consistent with the miR-33-5p inhibitor. More interestingly, overexpression of miR-33-5p could significantly reverse the increased levels of p-JNU and p-FOS induced by the overexpression of JNK1 compared with the over-JNK1 group. The above results were similar to the previous theoretical and experimental studies. Thus, it is rational to prove the role of miR-33-5p in MG infection by inhibiting JNK signaling pathway <italic>via</italic> directly inhibiting JNK1.</p>
<p>The JNK signaling pathway is known to play a role in cellular stress responses (<xref ref-type="bibr" rid="B53">53</xref>) and apoptosis (<xref ref-type="bibr" rid="B54">54</xref>), and is recently shown to modulate lung remodeling following injury (<xref ref-type="bibr" rid="B55">55</xref>). For instance, the activated LPS-TLR4 complex promotes the activation of JNK1 into p-JNK1, which regulates the activity of AP-1. Activated AP-1 initiates the transcription of inflammatory factors, causing the uncontrolled expression of factors such as TNF-&#x3b1;, ICAM-1 and nitric oxide (<xref ref-type="bibr" rid="B56">56</xref>). It is reported that ROS activates JNK kinase and activated JNK subsequently phosphorylates its substrate c-Jun, and then phosphorylated c-Jun further induces the activation of the caspase-3 protein, leading to apoptosis (<xref ref-type="bibr" rid="B57">57</xref>). Consistently, activated JNK also reduces BCL-2 expression (<xref ref-type="bibr" rid="B58">58</xref>). Importantly, JNK1 plays an important role in the occurrence and development of pulmonary fibrosis by affecting the phosphorylation level of JNK and lung fibroblasts proliferation. Therefore, inhibiting JNK1 will become a new strategy for anti-asthmatic airway remodeling (<xref ref-type="bibr" rid="B59">59</xref>). Moreover, knockdown of JNK reduces the levels of TNF-&#x3b1;, IL6 and IL8, and inhibits apoptosis during NDV infection. Notably, inhibition of JNK significantly suppresses NDV virus proliferation (<xref ref-type="bibr" rid="B60">60</xref>). These studies are similar to our findings. Specifically, we found that knockdown of JNK1 had reduced MG-induced inflammatory responses and apoptosis, and also decreased the level of pMGA1.2. In addition, miR-33-5p mimics could significantly reverse the various responses caused by overexpression of JNK1. Collectively, it is reasonable to conclude that miR-33-5p resists the MG infection through negatively regulating the JNK1/JUN/FOS pathway.</p>
<p>Recent studies suggest that lncRNAs are highly diverse in regulating gene expression. lncRNAs, possibly acting as endogenous sponges or ceRNAs, interact with miRNAs and influence the expression of target genes. For instance, LINC01939 directly binds to miR-17-5p and functions as a sponge of miR-17-5p to up-regulate the expression of EGR2 (the target of miR-17-5p) protein in gastric cancer (<xref ref-type="bibr" rid="B61">61</xref>). lncRNA LHFPL3-AS1-long directly interacts with miR-181a-5p to inhibit the mRNA degradation of BCL-2 (the target of miR-181) in melanoma stem cells (<xref ref-type="bibr" rid="B62">62</xref>). In addition, lncRNA HOTAIR sponges miR-326, leading to the accumulation of the miR-326 target PLAF2 in cutaneous squamous cell carcinoma (<xref ref-type="bibr" rid="B63">63</xref>). Similar to the above reports, in this study, we confirmed that Lnc90386 was significantly decreased in both MG-infected chicken embryos and DF-1 cells. And Lnc90386 directly bound to miR-33-5p and the presence of Lnc90386 hindered the inhibitory effect of miR-33-5p on JNK1-3&#x2019;UTR. However, knockdown of Lnc90386 stimulated the expression of miR-33-5p and consequently decreased the expression of JNK1. Furthermore, lncRNAs have been systematically studied as important regulators of cell apoptosis, inflammation and pathogenic microbial infection <italic>via</italic> their ceRNAs function. In the model of LPS-induced lung injury, lncRNA SNHG16 is highly expressed, effectively binds to miR-146a-5p and restores CCL 5 expression, thereby promoting the inflammatory response and apoptosis (<xref ref-type="bibr" rid="B64">64</xref>). Wang et&#xa0;al. observed that lncRNA NORAD inhibits the proliferation, inflammation and fibrosis of human mesangial cells under high-glucose conditions by acting as a molecular sponge of miR-485 to modulate NRF1 expression (<xref ref-type="bibr" rid="B65">65</xref>). And Chu et&#xa0;al. found that lncRNA MARL functions as a ceRNA for miR-122 to control protein abundance of MAVS, thereby inhibiting the SCRV replication and promoting antiviral responses (<xref ref-type="bibr" rid="B66">66</xref>). Taken together, these findings promote us to investigate the role of Lnc90386 during MG infection. Our study found that knockdown of Lnc90386 could counteract MG infection by regulating miR-33-5p to promote cell proliferation and inhibit MG-induced inflammation and apoptosis. Collectively, Lnc90386 exerts its function by regulating miR-33-5p/JNK1 expression, implying an important role for a lncRNA&#x2013;miRNA&#x2013;mRNA functional network in MG infection and showing a new light on the understanding of the complex molecular mechanisms of MG-induced CRD.</p>
</sec>
<sec id="s5">
<title>Conclusion</title>
<p>In conclusion, as shown in <xref ref-type="fig" rid="f10">
<bold>Figure&#xa0;10</bold>
</xref>, we confirm that miR-33-5p is an anti-MG infection miRNA through targeting JNK1. Upon MG infection, down-regulated Lnc90386 acts as a ceRNA and enhances miR-33-5p expression. In MG-infected DF-1 cells, down-regulated Lnc90386 released miR-33-5p to enhance the inhibition of JNK1 by miR-33-5p, promoted cell proliferation and attenuated MG-induced inflammatory response and apoptosis to resist MG infection. Our results provide new insights into the pathogenesis of MG-induced CRD. It is possible that the regulation of miR-33-5p and Lnc90386 may provide an interesting pathway for anti-MG infection.</p>
<fig id="f10" position="float">
<label>Figure&#xa0;10</label>
<caption>
<p>Schematic diagram of the potential roles of Lnc90386/miR-33-5p in DF-1 cells after MG infection.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-887602-g010.tif"/>
</fig>
</sec>
<sec id="s6" sec-type="data-availability">
<title>Data availability Statement</title>
<p>The original contributions presented in the study are included in the article/supplementary material. Further inquiries can be directed to the corresponding author.</p>
</sec>
<sec id="s7" sec-type="ethics-statement">
<title>Ethics Statement</title>
<p>The animal study protocol was approved by the Ethics Committee of Huazhong Agricultural University (HZAUCH-2020-0003).</p>
</sec>
<sec id="s8" sec-type="author-contributions">
<title>Author Contributions</title>
<p>YS performed experiments, wrote the manuscript and analyzed the data. YW and MZ helped to write and revise the manuscript. TW and LW provided advice for the study. XP conceived and designed the study and helped to revise the discussion. All authors contributed to the article and approved the submitted version.</p>
</sec>
<sec id="s9" sec-type="funding-information">
<title>Funding</title>
<p>This study was supported by the National Natural Science Foundation of China (Grant No. 31972681), the National Key Research and Development Program of China (2017YFD0501500).</p>
</sec>
<sec id="s10" sec-type="COI-statement">
<title>Conflict of Interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s11" sec-type="disclaimer">
<title>Publisher&#x2019;s Note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
</body>
<back>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>L</given-names>
</name>
<name>
<surname>Luo</surname> <given-names>R</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zou</surname> <given-names>M</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>T</given-names>
</name>
<etal/>
</person-group>. <article-title>Glycyrrhizic Acid Against Mycoplasma Gallisepticum-Induced Inflammation and Apoptosis Through Suppressing the MAPK Pathway in Chickens</article-title>. <source>J Agric Food Chem</source> (<year>2022</year>) <volume>70</volume>:<fpage>1996</fpage>&#x2013;<lpage>2009</lpage>. doi: <pub-id pub-id-type="doi">10.1021/acs.jafc.1c07848</pub-id>
</citation>
</ref>
<ref id="B2">
<label>2</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zou</surname> <given-names>M</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>W</given-names>
</name>
<name>
<surname>Niu</surname> <given-names>L</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Luo</surname> <given-names>R</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y</given-names>
</name>
<etal/>
</person-group>. <article-title>Polydatin Attenuates Mycoplasma Gallisepticum (HS Strain)-Induced Inflammation Injury <italic>via</italic> Inhibiting the TLR6/ MyD88/NF-&#x3ba;b Pathway</article-title>. <source>Microb Pathog</source> (<year>2020</year>) <volume>149</volume>:<fpage>104552</fpage>. doi: <pub-id pub-id-type="doi">10.1016/j.micpath.2020.104552</pub-id>
</citation>
</ref>
<ref id="B3">
<label>3</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Luo</surname> <given-names>R</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Fan</surname> <given-names>C</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>G</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>L</given-names>
</name>
<etal/>
</person-group>. <article-title>Andrographolide Attenuates Mycoplasma Gallisepticum-Induced Inflammation and Apoptosis by the JAK/PI3K/AKT Signal Pathway in the Chicken Lungs and Primary Alveolar Type II Epithelial Cells</article-title>. <source>Int Immunopharmacol</source> (<year>2022</year>) <volume>109</volume>:<fpage>108819</fpage>. doi: <pub-id pub-id-type="doi">10.1016/j.intimp.2022.108819</pub-id>
</citation>
</ref>
<ref id="B4">
<label>4</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Glew</surname> <given-names>MD</given-names>
</name>
<name>
<surname>Browning</surname> <given-names>GF</given-names>
</name>
<name>
<surname>Markham</surname> <given-names>PF</given-names>
</name>
<name>
<surname>Walker</surname> <given-names>ID</given-names>
</name>
</person-group>. <article-title>pMGA Phenotypic Variation in Mycoplasma Gallisepticum Occurs <italic>In Vivo</italic> and Is Mediated by Trinucleotide Repeat Length Variation</article-title>. <source>Infect Immun</source> (<year>2000</year>) <volume>68</volume>:<page-range>6027&#x2013;33</page-range>. doi: <pub-id pub-id-type="doi">10.1128/IAI.68.10.6027-6033.2000</pub-id>
</citation>
</ref>
<ref id="B5">
<label>5</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tajima</surname> <given-names>M</given-names>
</name>
<name>
<surname>Yagihashi</surname> <given-names>T</given-names>
</name>
<name>
<surname>Miki</surname> <given-names>Y</given-names>
</name>
</person-group>. <article-title>Capsular Material of Mycoplasma Gallisepticum and Its Possible Relevance to the Pathogenic Process</article-title>. <source>Infect Immun</source> (<year>1982</year>) <volume>36</volume>:<page-range>830&#x2013;3</page-range>. doi: <pub-id pub-id-type="doi">10.1128/iai.36.2.830-833.1982</pub-id>
</citation>
</ref>
<ref id="B6">
<label>6</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Marouf</surname> <given-names>S</given-names>
</name>
<name>
<surname>Khalf</surname> <given-names>MA</given-names>
</name>
<name>
<surname>Alorabi</surname> <given-names>M</given-names>
</name>
<name>
<surname>El-Shehawi</surname> <given-names>AM</given-names>
</name>
<name>
<surname>El-Tahan</surname> <given-names>AM</given-names>
</name>
<name>
<surname>El-Hack</surname> <given-names>MEA</given-names>
</name>
<etal/>
</person-group>. <article-title>Mycoplasma Gallisepticum: A Devastating Organism for the Poultry Industry in Egypt</article-title>. <source>Poult Sci</source> (<year>2022</year>) <volume>101</volume>:<fpage>101658</fpage>. doi: <pub-id pub-id-type="doi">10.1016/j.psj.2021.101658</pub-id>
</citation>
</ref>
<ref id="B7">
<label>7</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Muhammad</surname> <given-names>J</given-names>
</name>
<name>
<surname>Rabbani</surname> <given-names>M</given-names>
</name>
<name>
<surname>Sheikh</surname> <given-names>AA</given-names>
</name>
<name>
<surname>Rabaan</surname> <given-names>AA</given-names>
</name>
<name>
<surname>Khan</surname> <given-names>A</given-names>
</name>
<name>
<surname>Haq</surname> <given-names>IU</given-names>
</name>
<etal/>
</person-group>. <article-title>Molecular Detection of Mycoplasma Gallisepticum in Different Poultry Breeds of Abbottabad and Rawalpindi, Pakistan</article-title>. <source>Braz J Biol</source> (<year>2021</year>) <volume>83</volume>:<elocation-id>e246514</elocation-id>. doi: <pub-id pub-id-type="doi">10.1590/1519-6984.246514</pub-id>
</citation>
</ref>
<ref id="B8">
<label>8</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Liang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>F</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zou</surname> <given-names>M</given-names>
</name>
<name>
<surname>Luo</surname> <given-names>R</given-names>
</name>
<etal/>
</person-group>. <article-title>Chinese Herbal Formulae Defend Against Mycoplasma Gallisepticum Infection</article-title>. <source>J Integr Agric</source> (<year>2022</year>).</citation>
</ref>
<ref id="B9">
<label>9</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ter Veen</surname> <given-names>C</given-names>
</name>
<name>
<surname>Dijkman</surname> <given-names>R</given-names>
</name>
<name>
<surname>de Wit</surname> <given-names>JJ</given-names>
</name>
<name>
<surname>Gyuranecz</surname> <given-names>M</given-names>
</name>
<name>
<surname>Feberwee</surname> <given-names>A</given-names>
</name>
</person-group>. <article-title>Decrease of Mycoplasma Gallisepticum Seroprevalence and Introduction of New Genotypes in Dutch Commercial Poultry During the Years 2001-2018</article-title>. <source>Avian Pathol</source> (<year>2021</year>) <volume>50</volume>:<fpage>52</fpage>&#x2013;<lpage>60</lpage>. doi: <pub-id pub-id-type="doi">10.1080/03079457.2020.1832958</pub-id>
</citation>
</ref>
<ref id="B10">
<label>10</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>J</given-names>
</name>
<name>
<surname>Qiao</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>W</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>W</given-names>
</name>
<name>
<surname>Shah</surname> <given-names>SWA</given-names>
</name>
<name>
<surname>Ishfaq</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Baicalin Mitigated Mycoplasma Gallisepticum-Induced Structural Damage and Attenuated Oxidative Stress and Apoptosis in Chicken Thymus Through the Nrf2/HO-1 Defence Pathway</article-title>. <source>Vet Res</source> (<year>2019</year>) <volume>50</volume>:<fpage>83</fpage>. doi: <pub-id pub-id-type="doi">10.1186/s13567-019-0703-6</pub-id>
</citation>
</ref>
<ref id="B11">
<label>11</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ishfaq</surname> <given-names>M</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Li</surname> <given-names>R</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>C</given-names>
</name>
<name>
<surname>Li</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>Baicalin Alleviates Mycoplasma Gallisepticum-Induced Oxidative Stress and Inflammation <italic>via</italic> Modulating NLRP3 Inflammasome-Autophagy Pathway</article-title>. <source>Int Immunopharmacol</source> (<year>2021</year>) <volume>101</volume>:<fpage>108250</fpage>. doi: <pub-id pub-id-type="doi">10.1016/j.intimp.2021.108250</pub-id>
</citation>
</ref>
<ref id="B12">
<label>12</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hu</surname> <given-names>F</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>C</given-names>
</name>
<name>
<surname>Bi</surname> <given-names>D</given-names>
</name>
<name>
<surname>Tian</surname> <given-names>W</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>J</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>J</given-names>
</name>
<etal/>
</person-group>. <article-title>Mycoplasma Gallisepticum (HS Strain) Surface Lipoprotein pMGA Interacts With Host Apolipoprotein A-I During Infection in Chicken</article-title>. <source>Appl Microbiol Biotechnol</source> (<year>2016</year>) <volume>100</volume>:<page-range>1343&#x2013;54</page-range>. doi: <pub-id pub-id-type="doi">10.1007/s00253-015-7117-9</pub-id>
</citation>
</ref>
<ref id="B13">
<label>13</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Tong</surname> <given-names>D</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>H</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>F</given-names>
</name>
<name>
<surname>Zou</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>DF-1 Cells Prevent MG-HS Infection Through gga-miR-24-3p/RAP1B Mediated Decreased Proliferation and Increased Apoptosis</article-title>. <source>Res Vet Sci</source> (<year>2021</year>) <volume>141</volume>:<page-range>164&#x2013;73</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.rvsc.2021.10.021</pub-id>
</citation>
</ref>
<ref id="B14">
<label>14</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>Y</given-names>
</name>
</person-group>. <article-title>Research Progress on MicroRNAs Involved in the Regulation of Chicken Diseases</article-title>. <source>J Poult Sci</source> (<year>2020</year>) <volume>57</volume>:<fpage>7</fpage>&#x2013;<lpage>17</lpage>. doi: <pub-id pub-id-type="doi">10.2141/jpsa.0190073</pub-id>
</citation>
</ref>
<ref id="B15">
<label>15</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sun</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zou</surname> <given-names>M</given-names>
</name>
<name>
<surname>Peng</surname> <given-names>X</given-names>
</name>
</person-group>. <article-title>Exosomal miR-181a-5p Reduce Mycoplasma Gallisepticum (HS Strain) Infection in Chicken by Targeting PPM1B and Activating the TLR2-Mediated MyD88/NF-&#x3ba;b Signaling Pathway</article-title>. <source>Mol Immunol</source> (<year>2021</year>) <volume>140</volume>:<page-range>144&#x2013;57</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.molimm.2021.09.005</pub-id>
</citation>
</ref>
<ref id="B16">
<label>16</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yin</surname> <given-names>X</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Han</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>H</given-names>
</name>
<name>
<surname>Zou</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Down-Regulated gga-miR-223 Inhibits Proliferation and Induces Apoptosis of MG-Infected DF-1 Cells by Targeting FOXO3</article-title>. <source>Microb Pathog</source> (<year>2021</year>) <volume>155</volume>:<fpage>104927</fpage>. doi: <pub-id pub-id-type="doi">10.1016/j.micpath.2021.104927</pub-id>
</citation>
</ref>
<ref id="B17">
<label>17</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bellavia</surname> <given-names>D</given-names>
</name>
<name>
<surname>De Luca</surname> <given-names>A</given-names>
</name>
<name>
<surname>Carina</surname> <given-names>V</given-names>
</name>
<name>
<surname>Costa</surname> <given-names>V</given-names>
</name>
<name>
<surname>Raimondi</surname> <given-names>L</given-names>
</name>
<name>
<surname>Salamanna</surname> <given-names>F</given-names>
</name>
<etal/>
</person-group>. <article-title>Deregulated miRNAs in Bone Health: Epigenetic Roles in Osteoporosis</article-title>. <source>Bone</source> (<year>2019</year>) <volume>122</volume>:<fpage>52</fpage>&#x2013;<lpage>75</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.bone.2019.02.013</pub-id>
</citation>
</ref>
<ref id="B18">
<label>18</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>Q</given-names>
</name>
<name>
<surname>You</surname> <given-names>C</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>S</given-names>
</name>
<name>
<surname>Dong</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Monroig</surname> <given-names>&#xd3;</given-names>
</name>
<name>
<surname>Tocher</surname> <given-names>DR</given-names>
</name>
<etal/>
</person-group>. <article-title>The miR-33 Gene Is Identified in a Marine Teleost: A Potential Role in Regulation of LC-PUFA Biosynthesis in Siganus Canaliculatus</article-title>. <source>Sci Rep</source> (<year>2016</year>) <volume>6</volume>:<fpage>32909</fpage>. doi: <pub-id pub-id-type="doi">10.1038/srep32909</pub-id>
</citation>
</ref>
<ref id="B19">
<label>19</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>X</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>D</given-names>
</name>
<name>
<surname>Han</surname> <given-names>K</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>L</given-names>
</name>
<etal/>
</person-group>. <article-title>Analysis of the microRNA Expression Profiles of Chicken Dendritic Cells in Response to H9N2 Avian Influenza Virus Infection</article-title>. <source>Vet Res</source> (<year>2020</year>) <volume>51</volume>:<fpage>132</fpage>. doi: <pub-id pub-id-type="doi">10.1186/s13567-020-00856-z</pub-id>
</citation>
</ref>
<ref id="B20">
<label>20</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>W</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>H</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Deng</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Cheng</surname> <given-names>H</given-names>
</name>
<etal/>
</person-group>. <article-title>MicroRNA Expression Profiling in Newcastle Disease Virus-Infected DF-1 Cells by Deep Sequencing</article-title>. <source>Front Microbiol</source> (<year>2019</year>) <volume>10</volume>:<elocation-id>1659</elocation-id>. doi: <pub-id pub-id-type="doi">10.3389/fmicb.2019.01659</pub-id>
</citation>
</ref>
<ref id="B21">
<label>21</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhao</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Fu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zou</surname> <given-names>M</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Yin</surname> <given-names>X</given-names>
</name>
<name>
<surname>Niu</surname> <given-names>L</given-names>
</name>
<etal/>
</person-group>. <article-title>Analysis of Deep Sequencing Exosome-microRNA Expression Profile Derived From CP-II Reveals Potential Role of gga-miRNA-451 in Inflammation</article-title>. <source>J Cell Mol Med</source> (<year>2020</year>) <volume>24</volume>:<page-range>6178&#x2013;90</page-range>. doi: <pub-id pub-id-type="doi">10.1111/jcmm.15244</pub-id>
</citation>
</ref>
<ref id="B22">
<label>22</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tan</surname> <given-names>J</given-names>
</name>
<name>
<surname>Gao</surname> <given-names>W</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>W</given-names>
</name>
<name>
<surname>Zeng</surname> <given-names>X</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>L</given-names>
</name>
<name>
<surname>Cui</surname> <given-names>X</given-names>
</name>
</person-group>. <article-title>Isoform-Specific Functions of C-Jun N-Terminal Kinase 1 and 2 in Lung Ischemia-Reperfusion Injury Through the C-Jun/activator Protein-1 Pathway</article-title>. <source>J Thorac Cardiovasc Surg</source> (<year>2021</year>) <volume>162</volume>:<page-range>e143&#x2013;56</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.jtcvs.2020.03.083</pub-id>
</citation>
</ref>
<ref id="B23">
<label>23</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kuroki</surname> <given-names>T</given-names>
</name>
<name>
<surname>Osari</surname> <given-names>S</given-names>
</name>
<name>
<surname>Nagata</surname> <given-names>K</given-names>
</name>
<name>
<surname>Kawaguchi</surname> <given-names>A</given-names>
</name>
</person-group>. <article-title>Influenza A Virus NS1 Protein Suppresses JNK1-Dependent Autophagosome Formation Mediated by Rab11a Recycling Endosomes</article-title>. <source>Front Microbiol</source> (<year>2018</year>) <volume>9</volume>:<elocation-id>3120</elocation-id>. doi: <pub-id pub-id-type="doi">10.3389/fmicb.2018.03120</pub-id>
</citation>
</ref>
<ref id="B24">
<label>24</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Van der Velden</surname> <given-names>J</given-names>
</name>
<name>
<surname>Janssen-Heininger</surname> <given-names>YM</given-names>
</name>
<name>
<surname>Mandalapu</surname> <given-names>S</given-names>
</name>
<name>
<surname>Scheller</surname> <given-names>EV</given-names>
</name>
<name>
<surname>Kolls</surname> <given-names>JK</given-names>
</name>
<name>
<surname>Alcorn</surname> <given-names>JF</given-names>
</name>
</person-group>. <article-title>Differential Requirement for C-Jun N-Terminal Kinase 1 in Lung Inflammation and Host Defense</article-title>. <source>PloS One</source> (<year>2012</year>) <volume>7</volume>:<elocation-id>e34638</elocation-id>. doi: <pub-id pub-id-type="doi">10.1371/journal.pone.0034638</pub-id>
</citation>
</ref>
<ref id="B25">
<label>25</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Namba</surname> <given-names>S</given-names>
</name>
<name>
<surname>Nakano</surname> <given-names>R</given-names>
</name>
<name>
<surname>Kitanaka</surname> <given-names>T</given-names>
</name>
<name>
<surname>Kitanaka</surname> <given-names>N</given-names>
</name>
<name>
<surname>Nakayama</surname> <given-names>T</given-names>
</name>
<name>
<surname>Sugiya</surname> <given-names>H</given-names>
</name>
</person-group>. <article-title>ERK2 and JNK1 Contribute to TNF-&#x3b1;-Induced IL-8 Expression in Synovial Fibroblasts</article-title>. <source>PloS One</source> (<year>2017</year>) <volume>12</volume>:<elocation-id>e0182923</elocation-id>. doi: <pub-id pub-id-type="doi">10.1371/journal.pone.0182923</pub-id>
</citation>
</ref>
<ref id="B26">
<label>26</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bridges</surname> <given-names>MC</given-names>
</name>
<name>
<surname>Daulagala</surname> <given-names>AC</given-names>
</name>
<name>
<surname>Kourtidis</surname> <given-names>A</given-names>
</name>
</person-group>. <article-title>LNCcation: lncRNA Localization and Function</article-title>. <source>J Cell Biol</source> (<year>2021</year>) <volume>220</volume>(<issue>2</issue>):<elocation-id>e202009045</elocation-id>. doi: <pub-id pub-id-type="doi">10.1083/jcb.202009045</pub-id>
</citation>
</ref>
<ref id="B27">
<label>27</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lee</surname> <given-names>YH</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>CC</given-names>
</name>
<name>
<surname>Hsieh</surname> <given-names>PL</given-names>
</name>
<name>
<surname>Liao</surname> <given-names>YW</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>CH</given-names>
</name>
<name>
<surname>Su</surname> <given-names>TR</given-names>
</name>
</person-group>. <article-title>Inhibition of lncRNA HOTTIP Ameliorated Myofibroblast Activities and Inflammatory Cytokines in Oral Submucous Fibrosis</article-title>. <source>J Formos Med Assoc</source> (<year>2021</year>) <volume>120</volume>:<page-range>1188&#x2013;93</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.jfma.2020.11.013</pub-id>
</citation>
</ref>
<ref id="B28">
<label>28</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bian</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Li</surname> <given-names>M</given-names>
</name>
<name>
<surname>Feng</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>X</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>J</given-names>
</name>
<etal/>
</person-group>. <article-title>LncRNA-FEZF1-AS1 Promotes Tumor Proliferation and Metastasis in Colorectal Cancer by Regulating PKM2 Signaling</article-title>. <source>Clin Cancer Res</source> (<year>2018</year>) <volume>24</volume>:<page-range>4808&#x2013;19</page-range>. doi: <pub-id pub-id-type="doi">10.1158/1078-0432.CCR-17-2967</pub-id>
</citation>
</ref>
<ref id="B29">
<label>29</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liao</surname> <given-names>H</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>S</given-names>
</name>
<name>
<surname>Qiao</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>Silencing of Long Non-Coding RNA MEG3 Alleviates Lipopolysaccharide-Induced Acute Lung Injury by Acting as a Molecular Sponge of microRNA-7b to Modulate NLRP3</article-title>. <source>Aging (Albany NY)</source> (<year>2020</year>) <volume>12</volume>:<page-range>20198&#x2013;211</page-range>. doi: <pub-id pub-id-type="doi">10.18632/aging.103752</pub-id>
</citation>
</ref>
<ref id="B30">
<label>30</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhao</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>K</given-names>
</name>
<name>
<surname>Zou</surname> <given-names>M</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Peng</surname> <given-names>X</given-names>
</name>
</person-group>. <article-title>gga-miR-451 Negatively Regulates Mycoplasma Gallisepticum (HS Strain)-Induced Inflammatory Cytokine Production <italic>via</italic> Targeting YWHAZ</article-title>. <source>Int J Mol Sci</source> (<year>2018</year>) <volume>19</volume>(<issue>4</issue>):<fpage>1191</fpage>. doi: <pub-id pub-id-type="doi">10.3390/ijms19041191</pub-id>
</citation>
</ref>
<ref id="B31">
<label>31</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhao</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Hou</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>K</given-names>
</name>
<name>
<surname>Yuan</surname> <given-names>B</given-names>
</name>
<name>
<surname>Peng</surname> <given-names>X</given-names>
</name>
</person-group>. <article-title>Identification of Differentially Expressed miRNAs Through High-Throughput Sequencing in the Chicken Lung in Response to Mycoplasma Gallisepticum HS</article-title>. <source>Comp Biochem Physiol Part D Genomics Proteomics</source> (<year>2017</year>) <volume>22</volume>:<page-range>146&#x2013;56</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.cbd.2017.04.004</pub-id>
</citation>
</ref>
<ref id="B32">
<label>32</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ali Syeda</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Langden</surname> <given-names>SSS</given-names>
</name>
<name>
<surname>Munkhzul</surname> <given-names>C</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>M</given-names>
</name>
<name>
<surname>Song</surname> <given-names>SJ</given-names>
</name>
</person-group>. <article-title>Regulatory Mechanism of MicroRNA Expression in Cancer</article-title>. <source>Int J Mol Sci</source> (<year>2020</year>) <volume>21</volume>(<issue>5</issue>):<fpage>1723</fpage>. doi: <pub-id pub-id-type="doi">10.3390/ijms21051723</pub-id>
</citation>
</ref>
<ref id="B33">
<label>33</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hammouda</surname> <given-names>MB</given-names>
</name>
<name>
<surname>Ford</surname> <given-names>AE</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>JY</given-names>
</name>
</person-group>. <article-title>The JNK Signaling Pathway in Inflammatory Skin Disorders and Cancer</article-title>. <source>Cells</source> (<year>2020</year>) <volume>9</volume>(<issue>4</issue>):<fpage>857</fpage>. doi: <pub-id pub-id-type="doi">10.3390/cells9040857</pub-id>
</citation>
</ref>
<ref id="B34">
<label>34</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Busquets</surname> <given-names>O</given-names>
</name>
<name>
<surname>Ettcheto</surname> <given-names>M</given-names>
</name>
<name>
<surname>Cano</surname> <given-names>A</given-names>
</name>
<name>
<surname>P</surname> <given-names>RM</given-names>
</name>
<name>
<surname>S&#xe1;nchez-Lopez</surname> <given-names>E</given-names>
</name>
<name>
<surname>Espinosa-Jim&#xe9;nez</surname> <given-names>T</given-names>
</name>
<etal/>
</person-group>. <article-title>Role of C-Jun N-Terminal Kinases (JNKs) in Epilepsy and Metabolic Cognitive Impairment</article-title>. <source>Int J Mol Sci</source> (<year>2019</year>) <volume>21</volume>(<issue>1</issue>):<fpage>255</fpage>. doi: <pub-id pub-id-type="doi">10.3390/ijms21010255</pub-id>
</citation>
</ref>
<ref id="B35">
<label>35</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>G</given-names>
</name>
<name>
<surname>Gong</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Cai</surname> <given-names>J</given-names>
</name>
<name>
<surname>Zheng</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Z</given-names>
</name>
</person-group>. <article-title>LncRNA 0003250 Accelerates Heart Autophagy and Binds to miR-17-5p as a Competitive Endogenous RNA in Chicken Induced by Selenium Deficiency</article-title>. <source>J Cell Physiol</source> (<year>2021</year>) <volume>236</volume>:<page-range>157&#x2013;77</page-range>. doi: <pub-id pub-id-type="doi">10.1002/jcp.29831</pub-id>
</citation>
</ref>
<ref id="B36">
<label>36</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Miao</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Niu</surname> <given-names>D</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Bao</surname> <given-names>J</given-names>
</name>
<etal/>
</person-group>. <article-title>Methylsulfonylmethane Ameliorates Inflammation <italic>via</italic> NF-&#x3ba;b and ERK/JNK-MAPK Signaling Pathway in Chicken Trachea and HD11 Cells During Mycoplasma Gallisepticum Infection</article-title>. <source>Poult Sci</source> (<year>2022</year>) <volume>101</volume>:<fpage>101706</fpage>. doi: <pub-id pub-id-type="doi">10.1016/j.psj.2022.101706</pub-id>
</citation>
</ref>
<ref id="B37">
<label>37</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>C</given-names>
</name>
<name>
<surname>Li</surname> <given-names>J</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>W</given-names>
</name>
<name>
<surname>Shah</surname> <given-names>SWA</given-names>
</name>
<name>
<surname>Ishfaq</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Mycoplasma Gallisepticum Triggers Immune Damage in the Chicken Thymus by Activating the TLR-2/MyD88/NF-&#x3ba;b Signaling Pathway and NLRP3 Inflammasome</article-title>. <source>Vet Res</source> (<year>2020</year>) <volume>51</volume>:<fpage>52</fpage>. doi: <pub-id pub-id-type="doi">10.1186/s13567-020-00777-x</pub-id>
</citation>
</ref>
<ref id="B38">
<label>38</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>W</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>S</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>H</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>Ammonia Regulates Chicken Tracheal Cell Necroptosis <italic>via</italic> the LncRNA-107053293/MiR-148a-3p/FAF1 Axis</article-title>. <source>J Hazard Mater</source> (<year>2020</year>) <volume>386</volume>:<fpage>121626</fpage>. doi: <pub-id pub-id-type="doi">10.1016/j.jhazmat.2019.121626</pub-id>
</citation>
</ref>
<ref id="B39">
<label>39</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Gong</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Cai</surname> <given-names>J</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Z</given-names>
</name>
</person-group>. <article-title>Lnc-3215 Suppression Leads to Calcium Overload in Selenium Deficiency-Induced Chicken Heart Lesion <italic>via</italic> the lnc-3215-miR-1594-TNN2 Pathway</article-title>. <source>Mol Ther Nucleic Acids</source> (<year>2019</year>) <volume>18</volume>:<fpage>1</fpage>&#x2013;<lpage>15</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.omtn.2019.08.003</pub-id>
</citation>
</ref>
<ref id="B40">
<label>40</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>H</given-names>
</name>
<name>
<surname>Cui</surname> <given-names>P</given-names>
</name>
<name>
<surname>Fu</surname> <given-names>X</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>L</given-names>
</name>
<name>
<surname>Yan</surname> <given-names>W</given-names>
</name>
<name>
<surname>Zhai</surname> <given-names>Y</given-names>
</name>
<etal/>
</person-group>. <article-title>Identification and Analysis of Long non-Coding RNAs and mRNAs in Chicken Macrophages Infected With Avian Infectious Bronchitis Coronavirus</article-title>. <source>BMC Genomics</source> (<year>2021</year>) <volume>22</volume>:<fpage>67</fpage>. doi: <pub-id pub-id-type="doi">10.1186/s12864-020-07359-3</pub-id>
</citation>
</ref>
<ref id="B41">
<label>41</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nakao</surname> <given-names>T</given-names>
</name>
<name>
<surname>Horie</surname> <given-names>T</given-names>
</name>
<name>
<surname>Baba</surname> <given-names>O</given-names>
</name>
<name>
<surname>Nishiga</surname> <given-names>M</given-names>
</name>
<name>
<surname>Nishino</surname> <given-names>T</given-names>
</name>
<name>
<surname>Izuhara</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Genetic Ablation of MicroRNA-33 Attenuates Inflammation and Abdominal Aortic Aneurysm Formation <italic>via</italic> Several Anti-Inflammatory Pathways</article-title>. <source>Arterioscler Thromb Vasc Biol</source> (<year>2017</year>) <volume>37</volume>:<page-range>2161&#x2013;70</page-range>. doi: <pub-id pub-id-type="doi">10.1161/ATVBAHA.117.309768</pub-id>
</citation>
</ref>
<ref id="B42">
<label>42</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Wan</surname> <given-names>N</given-names>
</name>
<name>
<surname>Pan</surname> <given-names>T</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>X</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Li</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>MicroRNA-33-3p Regulates Vein Endothelial Cell Apoptosis in Selenium-Deficient Broilers by Targeting E4f1</article-title>. <source>Oxid Med Cell Longev</source> (<year>2019</year>) <volume>2019</volume>:<fpage>6274010</fpage>. doi: <pub-id pub-id-type="doi">10.1155/2019/6274010</pub-id>
</citation>
</ref>
<ref id="B43">
<label>43</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Selitsky</surname> <given-names>SR</given-names>
</name>
<name>
<surname>Dinh</surname> <given-names>TA</given-names>
</name>
<name>
<surname>Toth</surname> <given-names>CL</given-names>
</name>
<name>
<surname>Kurtz</surname> <given-names>CL</given-names>
</name>
<name>
<surname>Honda</surname> <given-names>M</given-names>
</name>
<name>
<surname>Struck</surname> <given-names>BR</given-names>
</name>
<etal/>
</person-group>. <article-title>Transcriptomic Analysis of Chronic Hepatitis B and C and Liver Cancer Reveals MicroRNA-Mediated Control of Cholesterol Synthesis Programs</article-title>. <source>mBio</source> (<year>2015</year>) <volume>6</volume>:<page-range>e01500&#x2013;01515</page-range>. doi: <pub-id pub-id-type="doi">10.1128/mBio.01500-15</pub-id>
</citation>
</ref>
<ref id="B44">
<label>44</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mudri</surname> <given-names>M</given-names>
</name>
<name>
<surname>Smith</surname> <given-names>SA</given-names>
</name>
<name>
<surname>Vanderboor</surname> <given-names>C</given-names>
</name>
<name>
<surname>Davidson</surname> <given-names>J</given-names>
</name>
<name>
<surname>Regnault</surname> <given-names>TRH</given-names>
</name>
<name>
<surname>B&#xfc;tter</surname> <given-names>A</given-names>
</name>
</person-group>. <article-title>The Effects of Tracheal Occlusion on Wnt Signaling in a Rabbit Model of Congenital Diaphragmatic Hernia</article-title>. <source>J Pediatr Surg</source> (<year>2019</year>) <volume>54</volume>:<page-range>937&#x2013;44</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.jpedsurg.2019.01.024</pub-id>
</citation>
</ref>
<ref id="B45">
<label>45</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ho</surname> <given-names>PC</given-names>
</name>
<name>
<surname>Chang</surname> <given-names>KC</given-names>
</name>
<name>
<surname>Chuang</surname> <given-names>YS</given-names>
</name>
<name>
<surname>Wei</surname> <given-names>LN</given-names>
</name>
</person-group>. <article-title>Cholesterol Regulation of Receptor-Interacting Protein 140 <italic>via</italic> microRNA-33 in Inflammatory Cytokine Production</article-title>. <source>FASEB J</source> (<year>2011</year>) <volume>25</volume>:<page-range>1758&#x2013;66</page-range>. doi: <pub-id pub-id-type="doi">10.1096/fj.10-179267</pub-id>
</citation>
</ref>
<ref id="B46">
<label>46</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tsai</surname> <given-names>YC</given-names>
</name>
<name>
<surname>Kuo</surname> <given-names>PL</given-names>
</name>
<name>
<surname>Hung</surname> <given-names>WW</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>LY</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>PH</given-names>
</name>
<name>
<surname>Chang</surname> <given-names>WA</given-names>
</name>
<etal/>
</person-group>. <article-title>Angpt2 Induces Mesangial Cell Apoptosis Through the MicroRNA-33-5p-SOCS5 Loop in Diabetic Nephropathy</article-title>. <source>Mol Ther Nucleic Acids</source> (<year>2018</year>) <volume>13</volume>:<page-range>543&#x2013;55</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.omtn.2018.10.003</pub-id>
</citation>
</ref>
<ref id="B47">
<label>47</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>D</given-names>
</name>
<name>
<surname>Tan</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Xue</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Song</surname> <given-names>Y</given-names>
</name>
<etal/>
</person-group>. <article-title>MicroRNA-33/33* Inhibit the Activation of MAVS Through AMPK in Antiviral Innate Immunity</article-title>. <source>Cell Mol Immunol</source> (<year>2021</year>) <volume>18</volume>:<page-range>1450&#x2013;62</page-range>. doi: <pub-id pub-id-type="doi">10.1038/s41423-019-0326-x</pub-id>
</citation>
</ref>
<ref id="B48">
<label>48</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>W</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>X</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>S</given-names>
</name>
<name>
<surname>An</surname> <given-names>H</given-names>
</name>
</person-group>. <article-title>Long non-Coding RNA Colorectal Neoplasia Differentially Expressed Correlates Negatively With miR-33a and miR-495 and Positively With Inflammatory Cytokines in Asthmatic Children</article-title>. <source>Clin Respir J</source> (<year>2021</year>) <volume>15</volume>:<page-range>1175&#x2013;84</page-range>. doi: <pub-id pub-id-type="doi">10.1111/crj.13424</pub-id>
</citation>
</ref>
<ref id="B49">
<label>49</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bartel</surname> <given-names>DP</given-names>
</name>
</person-group>. <article-title>MicroRNAs: Target Recognition and Regulatory Functions</article-title>. <source>Cell</source> (<year>2009</year>) <volume>136</volume>:<page-range>215&#x2013;33</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.cell.2009.01.002</pub-id>
</citation>
</ref>
<ref id="B50">
<label>50</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Eferl</surname> <given-names>R</given-names>
</name>
<name>
<surname>Wagner</surname> <given-names>EF</given-names>
</name>
</person-group>. <article-title>AP-1: A Double-Edged Sword in Tumorigenesis</article-title>. <source>Nat Rev Cancer</source> (<year>2003</year>) <volume>3</volume>:<page-range>859&#x2013;68</page-range>. doi: <pub-id pub-id-type="doi">10.1038/nrc1209</pub-id>
</citation>
</ref>
<ref id="B51">
<label>51</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Couto</surname> <given-names>D</given-names>
</name>
<name>
<surname>Freitas</surname> <given-names>M</given-names>
</name>
<name>
<surname>Porto</surname> <given-names>G</given-names>
</name>
<name>
<surname>Lopez-Quintela</surname> <given-names>MA</given-names>
</name>
<name>
<surname>Rivas</surname> <given-names>J</given-names>
</name>
<name>
<surname>Freitas</surname> <given-names>P</given-names>
</name>
<etal/>
</person-group>. <article-title>Polyacrylic Acid-Coated and Non-Coated Iron Oxide Nanoparticles Induce Cytokine Activation in Human Blood Cells Through TAK1, P38 MAPK and JNK Pro-Inflammatory Pathways</article-title>. <source>Arch Toxicol</source> (<year>2015</year>) <volume>89</volume>:<page-range>1759&#x2013;69</page-range>. doi: <pub-id pub-id-type="doi">10.1007/s00204-014-1325-4</pub-id>
</citation>
</ref>
<ref id="B52">
<label>52</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hernandez</surname> <given-names>JM</given-names>
</name>
<name>
<surname>Floyd</surname> <given-names>DH</given-names>
</name>
<name>
<surname>Weilbaecher</surname> <given-names>KN</given-names>
</name>
<name>
<surname>Green</surname> <given-names>PL</given-names>
</name>
<name>
<surname>Boris-Lawrie</surname> <given-names>K</given-names>
</name>
</person-group>. <article-title>Multiple Facets of junD Gene Expression Are Atypical Among AP-1 Family Members</article-title>. <source>Oncogene</source> (<year>2008</year>) <volume>27</volume>:<page-range>4757&#x2013;67</page-range>. doi: <pub-id pub-id-type="doi">10.1038/onc.2008.120</pub-id>
</citation>
</ref>
<ref id="B53">
<label>53</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nogueiras</surname> <given-names>R</given-names>
</name>
<name>
<surname>Sabio</surname> <given-names>G</given-names>
</name>
</person-group>. <article-title>Brain JNK and Metabolic Disease</article-title>. <source>Diabetologia</source> (<year>2021</year>) <volume>64</volume>:<page-range>265&#x2013;74</page-range>. doi: <pub-id pub-id-type="doi">10.1007/s00125-020-05327-w</pub-id>
</citation>
</ref>
<ref id="B54">
<label>54</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sun</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>WZ</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>T</given-names>
</name>
<name>
<surname>Feng</surname> <given-names>X</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>N</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>HF</given-names>
</name>
</person-group>. <article-title>Signaling Pathway of MAPK/ERK in Cell Proliferation, Differentiation, Migration, Senescence and Apoptosis</article-title>. <source>J Recept Signal Transduct Res</source> (<year>2015</year>) <volume>35</volume>:<page-range>600&#x2013;4</page-range>. doi: <pub-id pub-id-type="doi">10.3109/10799893.2015.1030412</pub-id>
</citation>
</ref>
<ref id="B55">
<label>55</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Du</surname> <given-names>J</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>G</given-names>
</name>
<name>
<surname>Luo</surname> <given-names>H</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>N</given-names>
</name>
<name>
<surname>Xie</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>JNK&#x2212;IN&#x2212;8 Treatment Alleviates Lipopolysaccharide&#x2212;Induced Acute Lung Injury <italic>via</italic> Suppression of Inflammation and Oxidative Stress Regulated by JNK/Nf&#x2212;&#x3ba;b Signaling</article-title>. <source>Mol Med Rep</source> (<year>2021</year>) <volume>23</volume>(<issue>2</issue>):<fpage>150</fpage>. doi: <pub-id pub-id-type="doi">10.3892/mmr.2020.11789</pub-id>
</citation>
</ref>
<ref id="B56">
<label>56</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>de Oliveira</surname> <given-names>S</given-names>
</name>
<name>
<surname>Boudinot</surname> <given-names>P</given-names>
</name>
<name>
<surname>Calado</surname> <given-names>&#xc2;</given-names>
</name>
<name>
<surname>Mulero</surname> <given-names>V</given-names>
</name>
</person-group>. <article-title>Duox1-Derived H2O2 Modulates Cxcl8 Expression and Neutrophil Recruitment <italic>via</italic> JNK/c-JUN/AP-1 Signaling and Chromatin Modifications</article-title>. <source>J Immunol</source> (<year>2015</year>) <volume>194</volume>:<page-range>1523&#x2013;33</page-range>. doi: <pub-id pub-id-type="doi">10.4049/jimmunol.1402386</pub-id>
</citation>
</ref>
<ref id="B57">
<label>57</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>SH</given-names>
</name>
<name>
<surname>Shang</surname> <given-names>XJ</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>LS</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>JW</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>A</given-names>
</name>
<etal/>
</person-group>. <article-title>Triptolide Induces Sertoli Cell Apoptosis in Mice <italic>via</italic> ROS/JNK-Dependent Activation of the Mitochondrial Pathway and Inhibition of Nrf2-Mediated Antioxidant Response</article-title>. <source>Acta Pharmacol Sin</source> (<year>2018</year>) <volume>39</volume>:<page-range>311&#x2013;27</page-range>. doi: <pub-id pub-id-type="doi">10.1038/aps.2017.95</pub-id>
</citation>
</ref>
<ref id="B58">
<label>58</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sinha</surname> <given-names>K</given-names>
</name>
<name>
<surname>Das</surname> <given-names>J</given-names>
</name>
<name>
<surname>Pal</surname> <given-names>PB</given-names>
</name>
<name>
<surname>Sil</surname> <given-names>PC</given-names>
</name>
</person-group>. <article-title>Oxidative Stress: The Mitochondria-Dependent and Mitochondria-Independent Pathways of Apoptosis</article-title>. <source>Arch Toxicol</source> (<year>2013</year>) <volume>87</volume>:<page-range>1157&#x2013;80</page-range>. doi: <pub-id pub-id-type="doi">10.1007/s00204-013-1034-4</pub-id>
</citation>
</ref>
<ref id="B59">
<label>59</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>van der Velden</surname> <given-names>JL</given-names>
</name>
<name>
<surname>Ye</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Nolin</surname> <given-names>JD</given-names>
</name>
<name>
<surname>Hoffman</surname> <given-names>SM</given-names>
</name>
<name>
<surname>Chapman</surname> <given-names>DG</given-names>
</name>
<name>
<surname>Lahue</surname> <given-names>KG</given-names>
</name>
<etal/>
</person-group>. <article-title>JNK Inhibition Reduces Lung Remodeling and Pulmonary Fibrotic Systemic Markers</article-title>. <source>Clin Transl Med</source> (<year>2016</year>) <volume>5</volume>:<fpage>36</fpage>. doi: <pub-id pub-id-type="doi">10.1186/s40169-016-0117-2</pub-id>
</citation>
</ref>
<ref id="B60">
<label>60</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>W</given-names>
</name>
<name>
<surname>Niu</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Meng</surname> <given-names>C</given-names>
</name>
<name>
<surname>Tan</surname> <given-names>L</given-names>
</name>
<etal/>
</person-group>. <article-title>Eif2&#x3b1;-CHOP-BCl-2/JNK and IRE1&#x3b1;-XBP1/JNK Signaling Promote Apoptosis and Inflammation and Support the Proliferation of Newcastle Disease Virus</article-title>. <source>Cell Death Dis</source> (<year>2019</year>) <volume>10</volume>:<fpage>891</fpage>. doi: <pub-id pub-id-type="doi">10.1038/s41419-019-2128-6</pub-id>
</citation>
</ref>
<ref id="B61">
<label>61</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>M</given-names>
</name>
<name>
<surname>Fan</surname> <given-names>L</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>SM</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>P</given-names>
</name>
<name>
<surname>Peng</surname> <given-names>X</given-names>
</name>
<etal/>
</person-group>. <article-title>LINC01939 Inhibits the Metastasis of Gastric Cancer by Acting as a Molecular Sponge of miR-17-5p to Regulate EGR2 Expression</article-title>. <source>Cell Death Dis</source> (<year>2019</year>) <volume>10</volume>:<fpage>70</fpage>. doi: <pub-id pub-id-type="doi">10.1038/s41419-019-1344-4</pub-id>
</citation>
</ref>
<ref id="B62">
<label>62</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>S</given-names>
</name>
<name>
<surname>Wan</surname> <given-names>H</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>X</given-names>
</name>
</person-group>. <article-title>LncRNA LHFPL3-AS1 Contributes to Tumorigenesis of Melanoma Stem Cells <italic>via</italic> the miR-181a-5p/BCL2 Pathway</article-title>. <source>Cell Death Dis</source> (<year>2020</year>) <volume>11</volume>:<fpage>950</fpage>. doi: <pub-id pub-id-type="doi">10.1038/s41419-020-03141-1</pub-id>
</citation>
</ref>
<ref id="B63">
<label>63</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yu</surname> <given-names>GJ</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>DW</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>P</given-names>
</name>
</person-group>. <article-title>Long non-Coding RNA HOTAIR Functions as a Competitive Endogenous RNA to Regulate PRAF2 Expression by Sponging miR-326 in Cutaneous Squamous Cell Carcinoma</article-title>. <source>Cancer Cell Int</source> (<year>2019</year>) <volume>19</volume>:<fpage>270</fpage>. doi: <pub-id pub-id-type="doi">10.1186/s12935-019-0992-x</pub-id>
</citation>
</ref>
<ref id="B64">
<label>64</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhou</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Gao</surname> <given-names>G</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y</given-names>
</name>
</person-group>. <article-title>Long Noncoding RNA SNHG16 Targets miR-146a-5p/CCL5 to Regulate LPS-Induced WI-38 Cell Apoptosis and Inflammation in Acute Pneumonia</article-title>. <source>Life Sci</source> (<year>2019</year>) <volume>228</volume>:<page-range>189&#x2013;97</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.lfs.2019.05.008</pub-id>
</citation>
</ref>
<ref id="B65">
<label>65</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>L</given-names>
</name>
<name>
<surname>Yuan</surname> <given-names>X</given-names>
</name>
<name>
<surname>Lian</surname> <given-names>L</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>H</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>H</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Knockdown of lncRNA NORAD Inhibits the Proliferation, Inflammation and Fibrosis of Human Mesangial Cells Under High-Glucose Conditions by Regulating the miR-485/NRF1 Axis</article-title>. <source>Exp Ther Med</source> (<year>2021</year>) <volume>22</volume>:<fpage>874</fpage>. doi: <pub-id pub-id-type="doi">10.3892/etm.2021.10306</pub-id>
</citation>
</ref>
<ref id="B66">
<label>66</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chu</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>T</given-names>
</name>
<name>
<surname>Zheng</surname> <given-names>W</given-names>
</name>
<name>
<surname>Chang</surname> <given-names>R</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>L</given-names>
</name>
</person-group>. <article-title>Long Noncoding RNA MARL Regulates Antiviral Responses Through Suppression miR-122-Dependent MAVS Downregulation in Lower Vertebrates</article-title>. <source>PloS Pathog</source> (<year>2020</year>) <volume>16</volume>:<elocation-id>e1008670</elocation-id>. doi: <pub-id pub-id-type="doi">10.1371/journal.ppat.1008670</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>