<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Immunol.</journal-id>
<journal-title>Frontiers in Immunology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Immunol.</abbrev-journal-title>
<issn pub-type="epub">1664-3224</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fimmu.2022.884434</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Immunology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Mystifying Molecular Structure, Expression and Repertoire Diversity of IgM Heavy Chain Genes (<italic>Igh&#x3bc;)</italic> in <italic>Clarias</italic> Catfish and Hybrids: Two Novel Transcripts in Vertebrates</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Bunnoy</surname>
<given-names>Anurak</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/705496"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Na-Nakorn</surname>
<given-names>Uthairat</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1640901"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Srisapoome</surname>
<given-names>Prapansak</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/725818"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Laboratory of Aquatic Animal Health Management, Department of Aquaculture, Faculty of Fisheries, Kasetsart University</institution>, <addr-line>Bangkok</addr-line>, <country>Thailand</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Center of Excellence in Aquatic Animal Health Management, Faculty of Fisheries, Kasetsart University</institution>, <addr-line>Bangkok</addr-line>, <country>Thailand</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Laboratory of Aquatic Animal Genetics, Department of Aquaculture, Faculty of Fisheries, Kasetsart University</institution>, <addr-line>Bangkok</addr-line>, <country>Thailand</country>
</aff>
<aff id="aff4">
<sup>4</sup>
<institution>Academy of Science, The Royal Society of Thailand</institution>, <addr-line>Bangkok</addr-line>, <country>Thailand</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Masahiro Sakai, University of Miyazaki, Japan</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Yo Okamura, University of Washington, United States; Madhubanti Basu, University of Alabama at Birmingham, United States</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Prapansak Srisapoome, <email xlink:href="mailto:ffispssp@ku.ac.th">ffispssp@ku.ac.th</email>
</p>
</fn>
<fn fn-type="other" id="fn002">
<p>This article was submitted to Comparative Immunology, a section of the journal Frontiers in Immunology</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>17</day>
<month>06</month>
<year>2022</year>
</pub-date>
<pub-date pub-type="collection">
<year>2022</year>
</pub-date>
<volume>13</volume>
<elocation-id>884434</elocation-id>
<history>
<date date-type="received">
<day>26</day>
<month>02</month>
<year>2022</year>
</date>
<date date-type="accepted">
<day>12</day>
<month>05</month>
<year>2022</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2022 Bunnoy, Na-Nakorn and Srisapoome</copyright-statement>
<copyright-year>2022</copyright-year>
<copyright-holder>Bunnoy, Na-Nakorn and Srisapoome</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>Two novel immunoglobulin heavy chain (<italic>Igh&#x3bc;</italic>) transcripts encoding membrane-bound forms of IgM (mIgM) were discovered in bighead catfish<italic>, Clarias macrocephalus</italic>. The first transcript contains four constant and two transmembrane domains [C&#x3bc;1-C&#x3bc;2-C&#x3bc;3-C&#x3bc;4-TM1-TM2] that have never been reported in teleosts, and the second transcript is an unusual mIgM that has never been identified in any vertebrate [C&#x3bc;1-(C&#x3b4;2-C&#x3b4;3-C&#x3b4;4-C&#x3b4;5)-C&#x3bc;2-C&#x3bc;3-TM1-TM2]. Fluorescence <italic>in situ</italic> hybridization (FISH) in bighead catfish, North African catfish (<italic>C. gariepinus</italic>) and hybrid catfish revealed a single copy of <italic>Igh&#x3bc;</italic> in individual parent catfish, while two gene copies were found in diploid hybrid catfish. Intensive sequence analysis demonstrated multiple distinct structural variabilities in the VH domain in <italic>Clarias</italic>, and hybrid catfish were defined and used to generate diversity with various mechanisms. Expression analysis of <italic>Igh&#x3bc;</italic> in <italic>Aeromonas hydrophila</italic> infection of the head kidney, peripheral blood leukocytes and spleen revealed significantly higher levels in North African catfish and hybrid catfish than in bighead catfish.</p>
</abstract>
<kwd-group>
<kwd>
<italic>Clarias</italic> catfish</kwd>
<kwd>IgM</kwd>
<kwd>novel transcript</kwd>
<kwd>characterization</kwd>
<kwd>structural analysis</kwd>
</kwd-group>
<contract-sponsor id="cn001">Thailand Research Fund<named-content content-type="fundref-id">10.13039/501100004396</named-content>
</contract-sponsor>
<counts>
<fig-count count="7"/>
<table-count count="0"/>
<equation-count count="0"/>
<ref-count count="79"/>
<page-count count="19"/>
<word-count count="10492"/>
</counts>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<title>Introduction</title>
<p>Vertebrate immunoglobulins (Igs) are the hallmark elements in adaptive immune responses to a particular antigen with high discrimination, specificity and long-term memory. Igs are generated by B cells and serve two purposes: 1) cell-surface receptors (membrane-bound forms; mIgs) for signaling and activation of cells and 2) soluble effector molecules (secreted forms; sIgs) for neutralization of microbes and toxins, opsonization (immunophagocytosis), antibody-dependent cell-mediated cytotoxicity (ADCC), and complement activation (immunolysis) (<xref ref-type="bibr" rid="B1">1</xref>).</p>
<p>The basic structure of Ig heavy chain (<italic>Igh</italic>) gene molecules consists of variable (VH) and constant (CH) regions (<xref ref-type="bibr" rid="B2">2</xref>). The gene sequence organizations of <italic>Igh</italic> vary depending on the species (<xref ref-type="bibr" rid="B3">3</xref>, <xref ref-type="bibr" rid="B4">4</xref>). The immunologic effector functions of the Ig classes are determined by the different constant regions of the CH chain. In most mammals, five classes of Igs are categorized based on different gene sequences; these classes are &#x3bc;, &#x3b4;, &#x3b3;, &#x3f5;, and &#x3b1;, and they correspond to the five major isotypes of Igs, IgM, D, G, E, and A, respectively. In teleost fish, only three <italic>Igh</italic> isotypes have been identified, namely, IgM, D, and T/Z based on the gene sequences of the isotypes &#x3bc;, &#x3b4;, and &#x3c4;/&#x3b6;, respectively (<xref ref-type="bibr" rid="B5">5</xref>&#x2013;<xref ref-type="bibr" rid="B7">7</xref>). Additionally, distinct <italic>Igh</italic> classes have been identified in nonmammalian vertebrates, including IgNAR and IgW (in cartilaginous fish) (<xref ref-type="bibr" rid="B8">8</xref>), IgO (platypus), IgP (in <italic>Pleurodeles waltl</italic>) (<xref ref-type="bibr" rid="B9">9</xref>), IgX, IgF and IgY (in amphibians) (<xref ref-type="bibr" rid="B9">9</xref>, <xref ref-type="bibr" rid="B10">10</xref>).</p>
<p>The evolution of Ig molecules in jawed vertebrates diverged from the &#x201c;multicluster&#x201d; type to the &#x201c;translocon&#x201d; type approximately 470 million years ago (<xref ref-type="bibr" rid="B11">11</xref>, <xref ref-type="bibr" rid="B12">12</xref>). The <italic>Igh</italic> translocon configuration in jawed vertebrates consists of variable (V<sub>H</sub>), diversity (D<sub>H</sub>), joining (J<sub>H</sub>), and constant (C<sub>H</sub>) regions, although the organization of these regions varies depending on different species, such as mouse, V<sub>H</sub>-D<sub>H</sub>-J<sub>H</sub>-C&#x3bc;-C&#x3b4;-C&#x3b3;3-C&#x3b3;1-C&#x3b3;2b-C&#x3b3;2a-C&#x3b5;-C&#x3b1;; human, V<sub>H</sub>-D<sub>H</sub>-J<sub>H</sub>-C&#x3bc;-C&#x3b4;-C&#x3b3;3-C&#x3b3;1-&#x3c8;&#x3b5;-C&#x3b1;1C&#x3b3;2-C&#x3b3;4-C&#x3b5;-C&#x3b1;2; rabbit, V<sub>H</sub>-D<sub>H</sub>-J<sub>H</sub>-C&#x3bc;-C&#x3b3;-C&#x3b5;-C&#x3b1;-C&#x3b1; (13 C&#x3b1; genes were repeated); and cattle, V<sub>H</sub>-D<sub>H</sub>-J<sub>H</sub>-C&#x3bc;-C&#x3b4;-C&#x3b3;3-C&#x3b3;1-C&#x3b3;2-C&#x3b5;-C&#x3b1;4. In teleosts, gene organization appears to be an intermediate type between the multicluster and translocon types in its evolution from Chondrichthyes to tetrapods. The <italic>Igh</italic> genes possess a translocon configuration, V<sub>H</sub>-D<sub>H</sub>-J<sub>H</sub>-C&#x3b6;/&#x3c4;-(V<sub>H</sub>)-D<sub>H</sub>-J<sub>H</sub>-C&#x3bc;-C&#x3b4;, similar to those of tetrapods, although there are differences in the C&#x3b6;/&#x3c4; gene locations among teleost species and other vertebrate groups (<xref ref-type="bibr" rid="B13">13</xref>, <xref ref-type="bibr" rid="B14">14</xref>). Interestingly, in catfish groups such as channel catfish (<italic>Ictalurus punctatus</italic>), the C&#x3b6;/&#x3c4; genes are not found either in the 3&#x2019;-region of the VH gene cluster or within the VH gene (<xref ref-type="bibr" rid="B15">15</xref>).</p>
<p>The <italic>Igh&#x3bc;</italic> gene was the first Ig class identified in teleosts and has long been considered the most primitive and most prevalent Ig in fish plasma. It can be expressed as mIg or sIg. Secreted tetrameric IgM represents the main Ig in the serum of teleosts. In teleosts as well as a wide range of mammalian species, molecular characterization of the <italic>Igh&#x3bc;</italic> gene has revealed that the secreted <italic>Igh&#x3bc;</italic> transcripts consist of a rearranged VDJ region spliced to the C&#x3bc;<sub>1</sub> domain, followed by C&#x3bc;<sub>2</sub>, C&#x3bc;<sub>3</sub> or C&#x3bc;<sub>4</sub> (VH-C&#x3bc;<sub>1</sub>-C&#x3bc;<sub>2</sub>-C&#x3bc;<sub>3</sub>- C&#x3bc;<sub>4</sub>). Interestingly, the unusual transcript patterns of the <italic>Igh&#x3bc;</italic> gene indicate that the membrane <italic>Igh&#x3bc;</italic> transcripts in teleost fish appear to be shorter than those in mammals since the first transmembrane (TM) exon is spliced directly to C&#x3bc;<sub>1</sub>, C&#x3bc;<sub>2</sub> or C&#x3bc;<sub>3</sub> thereby excluding the entire C&#x3bc;<sub>2</sub> or/and C&#x3bc;<sub>3</sub> or/and C&#x3bc;<sub>4</sub> exons (VH-C&#x3bc;<sub>1</sub>-TM, or VH-C&#x3bc;<sub>1</sub>-C&#x3bc;<sub>2</sub>-TM, or VH-C&#x3bc;<sub>1</sub>-C&#x3bc;<sub>2</sub>-C&#x3bc;<sub>3</sub>-TM, respectively). These patterns have been identified and reported in many teleost species (<xref ref-type="bibr" rid="B3">3</xref>, <xref ref-type="bibr" rid="B16">16</xref>&#x2013;<xref ref-type="bibr" rid="B27">27</xref>).</p>
<p>In Thailand, the production of catfish is the second largest fish aquaculture industry, with approximately 159,314&#xa0;million&#xa0;tons in 2004 (<xref ref-type="bibr" rid="B28">28</xref>). Two major species of catfish, bighead catfish (<italic>Clarias macrocephalus</italic> Gunther, 1864) and North African catfish (<italic>C. gariepinus</italic>), and their hybrid catfish (&#x201c;pla-duk-big-uey&#x201d; in Thai), are economically popular cultured species in southeast Asia, especially in Thailand, Vietnam, Malaysia and Indonesia. Notably, the hybrid catfish (<italic>C. macrocephalus</italic> &#xd7; <italic>C. gariepinus</italic>) demonstrates many commercially desirable dominant characteristics from its parents, such as good quality of meat, rapid growth, better feed conversion, increased survival, resistance to many diseases and tolerance to many environmental conditions. Therefore, bighead catfish has become a remarkable supporter species in catfish production in many counties in southeast Asia.</p>
<p>Most of our current knowledge on the immune systems of catfish comes from other models and economically important fish species, such as zebrafish (<italic>Danio rerio</italic>) and medaka (<italic>Oryzias latipes</italic>) (<xref ref-type="bibr" rid="B14">14</xref>, <xref ref-type="bibr" rid="B29">29</xref>&#x2013;<xref ref-type="bibr" rid="B35">35</xref>). In addition, the structural, functional and genetic features of catfish Igs in the genus <italic>Clarias</italic> are still virtually absent.</p>
<p>The study of molecular <italic>Ig</italic> genes in catfish could provide a better understanding of their role in immunity, and these genes could be applied as tools for basic research, diagnosis, and therapy in catfish culture farming. Thus far, the study of <italic>Ig</italic> genes has focused on the molecular structure of <italic>Igh&#x3bc;</italic> loci in catfish, particularly their splicing patterns, functions, diversification, expression and homogeneity or heterogeneity between species and their hybrids. In the present study, the organization of the <italic>Igh&#x3bc;</italic> genes was analyzed at the chromosomal level. The obtained data provide new knowledge regarding catfish and may benefit applications in sustainable aquaculture industries.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<title>Materials and Methods</title>
<sec id="s2_1">
<title>Animals</title>
<p>Bighead catfish (<italic>Clarias macrocephalus</italic> G&#xfc;nther, 1864), North African catfish (<italic>Clarias gariepinus</italic>) and their hybrid catfish (<italic>C. macrocephalus</italic> &#xd7; <italic>C. gariepinus</italic>), 90&#x2013;120 g in body weight, were obtained from the Department of Aquaculture, Faculty of Fisheries, Kasetsart University, Thailand. The fish were acclimatized in a quarantine tank with aerated freshwater at temperatures between 28 and 31&#xb0;C for 2 weeks before the start of the experiment. The experimental procedures performed with aquatic animals were carried out in accordance with the Ethical Principles and Guidelines for the Use of Animals National Research Council of Thailand for the care and use of animals for scientific purposes. The protocol was approved by the Animal Ethics Committee, Kasetsart University, Thailand (Ethics ID: ACKU61-FIS-004).</p>
</sec>
<sec id="s2_2">
<title>Isolation of Genomic DNA and RNA and cDNA Synthesis</title>
<p>Catfish genomic (g) DNA was isolated from whole blood tissues using a QIAamp DNA Blood and Tissue Mini Kit (QIAamp, CA, USA) according to the manufacturer&#x2019;s protocols.</p>
<p>The PBLs of catfish are target tissues used to isolate total RNA and for cDNA synthesis. Total RNA was analyzed using NucleoZOL&#x2122; reagent (Clontech Laboratories, CA, USA) according to the manufacturer&#x2019;s instructions. The obtained total RNA was then used as templates for first strand cDNA synthesis using the protocol described for the Thermo Scientific RevertAid Reverse Transcriptase Kit (Thermo Fisher Scientific, MA, USA). The products of the gDNAs and first-strand cDNA synthesis were stored at -80&#xb0;C for further experiments.</p>
</sec>
<sec id="s2_3">
<title>Amplification of the Internal Constant Domain of cDNA Encoding <italic>Igh&#x3bc;</italic> Genes</title>
<p>Degenerative primers were first designed to amplify the internal constant domain region of cDNA encoding <italic>Igh&#x3bc;</italic> genes based on the highly conserved regions of <italic>Igh&#x3bc;</italic> genes from the NCBI nucleotide database of closely related species of catfish, including <italic>Ictalurus punctatus</italic> (M27230), <italic>Hemibagrus macropterus</italic> (JF909893), <italic>Silurus meridionalis</italic> (KJ659069) and <italic>Pelteobagrus fulvidraco</italic> (JN202623). The primers were <italic>Cla</italic>_<italic>Igh&#x3bc;_intr_f:</italic> 5&#x2032;-GTYTMCMSYDTGGCARTGCGGCBC-3&#x2032; and <italic>Cla</italic>_<italic>Igh&#x3bc;_intr_r:</italic> 5&#x2032;-GARVYCTCTGGTGGAGSGAGCAMG<italic>-</italic>3&#x2032; with an approximate amplicon size of 950 bp. Reverse transcription PCRs (RT-PCRs) were carried out using Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer&#x2019;s protocols. The PCR cycling conditions are one cycle of 95&#xb0;C for 5&#xa0;min, 30 cycles of 95&#xb0;C for 30 sec, 55&#xb0;C for 30 sec, and 72&#xb0;C for 90 sec, followed by a final extension at 72&#xb0;C for 5&#xa0;min. Then, PCR products encoding <italic>Igh&#x3bc;</italic> genes were ligated to the pJET1.2/blunt cloning vector (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer&#x2019;s protocols. Nucleotide sequencing of the recombinant plasmid was performed by the Macrogen sequencing service (Macrogen Inc., Seoul, South Korea) using pJET1.2 forward and reverse sequencing primers.</p>
</sec>
<sec id="s2_4">
<title>Recovery of 5&#x2032;- and 3&#x2032;-Constant Domains of cDNA Encoding <italic>Igh&#x3bc;</italic> Genes</title>
<p>The 5&#x2032;- and 3&#x2032;- internal constant domain sequences of cDNA encoding <italic>Igh&#x3bc;</italic> genes were recovered by rapid amplification of cDNA ends (RACE) PCR techniques using 5&#x2032;- and 3&#x2032;-SMARTer<sup>&#xae;</sup> (Clontech, Mountain View, CA, USA), according to the manufacturer&#x2019;s protocol, with SMARTer<sup>&#xae;</sup> universal primers and gene-specific primers that were provided from the kits and designed from 5&#x2032;- or 3&#x2032;- internal constant domain sequences, respectively (<italic>Cla</italic>_<italic>Igh&#x3bc;_5RACE_r:</italic> 5&#x2032;-GTGCCGCTCGCATCCTTCCAAACG-3&#x2032; and <italic>Cla</italic>_<italic>Igh&#x3bc;_3RACE_f:</italic> 5&#x2032;-GGCTCAACTTCTCCAGTTAAGTG-3&#x2032;). The 5&#x2032; and 3&#x2032; RACE-PCR products were cloned into the pJET1.2/blunt cloning vector (Thermo Fisher Scientific, Waltham, MA, USA) and sequenced using the Macrogen sequencing service (Macrogen, Inc., Seoul, South Korea) as described above.</p>
</sec>
<sec id="s2_5">
<title>Cloning and Characterization of <italic>Igh&#x3bc;</italic> Genes of Catfish</title>
<p>To obtain and characterize the <italic>Igh&#x3bc;</italic> genes of catfish, we used catfish gDNA to amplify the <italic>Igh&#x3bc;</italic> genes of catfish using forward and reverse specific primers designed from the highly conserved region of the 5&#x2032; end of C&#x3bc;<sub>1</sub> and the 3&#x2032;UTR of full-length <italic>Igh&#x3bc;</italic> cDNAs, respectively. The forward primer was <italic>Cla</italic>_<italic>Igh&#x3bc;_C&#x3bc;<sub>1_</sub>f:</italic> 5&#x2032;-GAACGTCGGTGACCGTAACTTCA-3<bold>&#x2032;</bold> for all <italic>Clarias</italic> catfish species. The reverse primers were <italic>Cla</italic>_<italic>mac</italic>_<italic>Igh&#x3bc;_3UTR_r:</italic> 5<bold>&#x2032;-</bold>GAACACACAAGCATCAGACAGACTG<italic>-</italic>3<bold>&#x2032;</bold> for big head catfish and hybrid catfish and <italic>Cla</italic>_<italic>gar</italic>_<italic>Igh&#x3bc;_3UTR_r:</italic> 5<bold>&#x2032;-</bold>CAAGAACACACAAGCATCAGACAG<italic>-</italic>3&#x2032; for North African catfish and hybrid catfish.</p>
<p>PCRs were carried out using Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer&#x2019;s protocols. The PCR cycling conditions were one cycle of 95&#xb0;C for 5&#xa0;min, 30 cycles of 95&#xb0;C for 30 sec, 60&#xb0;C for 30 sec, and 72&#xb0;C for 5&#xa0;min, followed by a final extension at 72&#xb0;C for 10&#xa0;min. The PCR products of <italic>Igh&#x3bc;</italic> genes were cloned and sequenced as described above.</p>
</sec>
<sec id="s2_6">
<title>Sequence and Phylogenic Analyses of Full-Length cDNAs and <italic>Igh&#x3bc;</italic> Gene</title>
<p>The obtained nucleotide sequences of <italic>Igh&#x3bc;</italic> genes were characterized, analyzed, assembled, and aligned using bioinformatic software DNA sequences including GENETYX version 7.0, BLASTN (<uri xlink:href="https://blast.ncbi.nlm.nih.gov/">https://blast.ncbi.nlm.nih.gov/</uri>), BLASTX (<uri xlink:href="https://blast.ncbi.nlm.nih.gov/">https://blast.ncbi.nlm.nih.gov/</uri>), ExPASy (<uri xlink:href="https://www.expasy.org/">https://www.expasy.org/</uri>), DAS-Transmembrane Prediction server (<uri xlink:href="http://www.sbc.su.se/~miklos/DAS/">www.sbc.su.se/~miklos/DAS/</uri>), MatGAT program version 2.0 (<uri xlink:href="http://www.bitincka.com/ledion/matgat">http://www.bitincka.com/ledion/matgat</uri>), and MEGA version 7.0 (<uri xlink:href="http://www.megasoftware.net">http://www.megasoftware.net</uri>). Furthermore, the sequences were aligned with those of related <italic>Igh&#x3bc;</italic> gene sequences in other vertebrate species using ClustalW. Phylogenetic trees were constructed using Molecular Evolutionary Genetics Analysis (MEGA) software, version 7.0 (Proprietary freeware, Japan) with neighbor-joining (NJ) algorithms with a bootstrap of 1000 replications.</p>
</sec>
<sec id="s2_7">
<title>Prediction of Protein Structures of Catfish <italic>Igh&#x3bc;</italic> Genes</title>
<p>The protein structures of <italic>Igh&#x3bc;</italic> molecules of catfish were determined to predict the possibility of constant domain structure using the structural bioinformatics web server SWISS-MODEL workspace integrates programs (<uri xlink:href="https://swissmodel.expasy.org">https://swissmodel.expasy.org</uri>) according to the programs&#x2019; procedures (<xref ref-type="bibr" rid="B36">36</xref>). The amino acids in the constant domain of each <italic>Igh&#x3bc;</italic> molecule were used to generate the target sequence for protein structure prediction.</p>
</sec>
<sec id="s2_8">
<title>Cytogenetic Mapping of <italic>Igh&#x3bc;</italic> Genes in Catfish</title>
<p>Metaphase chromosomes of catfish were obtained from the head kidney of each catfish species treated with colchicine according to Karami et al. (2015) (<xref ref-type="bibr" rid="B37">37</xref>). Prepared tissues were stored in fixative solution at -20&#xb0;C until use. The chromosomal spreads were analyzed by staining with 15% Giemsa for 45&#xa0;min and examined under a light microscope (Olympus, MA, USA). The <italic>Igh&#x3bc;</italic> gene probes for fluorescence <italic>in situ</italic> hybridization&#xa0;(FISH) used full-length <italic>Igh&#x3bc;</italic> genes containing the constant domain C&#x3bc;<sub>1</sub> to the 3&#x2032;UTR of the <italic>Igh&#x3bc;</italic> genes of each catfish species. DNA probes were performed according to standard procedures of FISH Tag detection kits (Thermo Fisher Scientific, MA, USA). Metaphase chromosome hybridization was carried out following a previously described method (<xref ref-type="bibr" rid="B38">38</xref>). Chromosomes and specific probes were performed with DAPI and Alexa Fluor 488 or 594 dyes following the manufacturer&#x2019;s instructions (Thermo Fisher Scientific, MA, USA). Digital micrographs were recorded and processed using a Nikon/DigitaL Eclipse C2Si confocal microscope (Nikon Instruments Inc., NY, USA).</p>
</sec>
<sec id="s2_9">
<title>Diversity Analysis of the Variable Domain of <italic>Igh&#x3bc;</italic> Genes of Catfish</title>
<p>The 5&#x2032; VH region of first-strand cDNAs encoding <italic>Igh&#x3bc;</italic> genes was synthesized from total RNA of PBLs of each catfish species using a 5&#x2032; RACE-Ready cDNA synthesis kit (Clontech, Mountain View, CA, USA), as previously described. PCR was amplified using Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific, Waltham, MA, USA) with the 5&#x2032; universal primer mix (UPM) and gene-specific primers (GSPs) from the kit and nucleotide sequences located in the 5&#x2032; region of the C&#x3bc;<sub>1</sub> constant domain of <italic>Igh&#x3bc;</italic> genes (<italic>Cla_Igh&#x3bc;_C&#x3bc;1_r</italic>: 5&#x2032;-GTGCCGCTCGCATCCTTCCAAACG-3&#x2032;). The PCR cycling conditions were one cycle of 95&#xb0;C for 5&#xa0;min, 25 cycles of 95&#xb0;C for 30 sec, 68&#xb0;C for 30 sec, and 72&#xb0;C for 120 sec, followed by a final extension at 72&#xb0;C for 5&#xa0;min. The 5&#x2032; RACE VH PCR products of <italic>Igh&#x3bc;</italic> cDNA were ligated to the pJET1.2/blunt cloning vector (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer&#x2019;s protocol. A different hundred recombinant clones were randomly selected for sequencing by the Macrogen sequencing service (Macrogen Inc., Seoul, South Korea) as previously described.</p>
</sec>
<sec id="s2_10">
<title>Analysis of V<sub>H</sub>, D<sub>H</sub> and J<sub>H</sub> Segments</title>
<p>The 5&#x2032; VH nucleotide sequences of <italic>Igh&#x3bc;</italic> genes were trimmed to three separated regions encoding the <italic>V<sub>H</sub>
</italic>, <italic>D<sub>H</sub>
</italic> and <italic>J<sub>H</sub>
</italic> genes using an Ig variable domain sequence analysis tool (NCBI IgBLAST, <uri xlink:href="https://www.ncbi.nlm.nih.gov/igblast/">https://www.ncbi.nlm.nih.gov/igblast/</uri>). The nucleotide sequences of each gene region were classified at the family level based on 80% similarity of nucleotide sequences using the matrix global alignment tool (MATGAT 2.0).</p>
</sec>
<sec id="s2_11">
<title>Analysis of Complementarity-Determining Regions (CDRs)</title>
<p>CDR nucleotide regions of each variable domain nucleotide sequence were first characterized using IgBLAST (<uri xlink:href="https://www.ncbi.nlm.nih.gov/igblast/">https://www.ncbi.nlm.nih.gov/igblast/</uri>). The D<sub>H</sub> segments were predicted using the VDJsolver 1.0 server (<uri xlink:href="https://services.healthtech.dtu.dk">https://services.healthtech.dtu.dk</uri>). The CDRs were analyzed for their characterization, including CDR length distribution and amino acid composition in each position, using the High V-QUEST IMGT tool (<xref ref-type="bibr" rid="B39">39</xref>).</p>
</sec>
<sec id="s2_12">
<title>Analysis of the Variability Plot of the Variable Domains of IgM Molecules</title>
<p>The variability plots of variable domain nucleotide sequences were analyzed using the Shannon (1948) (<xref ref-type="bibr" rid="B40">40</xref>) and Kabat and Wu (1971) (<xref ref-type="bibr" rid="B41">41</xref>) methods. The variability plots were illustrated using the online bioinformatics software protein variability server (PVS, <uri xlink:href="https://imed.med.ucm.es/PVS/pvs-help.html">https://imed.med.ucm.es/PVS/pvs-help.html</uri>).</p>
</sec>
<sec id="s2_13">
<title>Expression of <italic>Igh&#x3bc;</italic> Genes in Catfish</title>
<p>The tissue distribution of <italic>Igh&#x3bc;</italic> genes of catfish was addressed in both normal fish and fish that underwent <italic>Aeromonas hydrophila</italic> challenge. Fifty acclimatized catfish were randomly transferred into tanks containing 500 L of water. Catfish were used to determine the expression of the <italic>Igh&#x3bc;</italic> gene in normal fish and infectious fish. The infectious catfish were intraperitoneally injected with 0.1 mL of virulent <italic>A. hydrophila</italic> AQH0018 bacterium (1 &#xd7; 10<sup>6</sup> CFU/mL). A virulent <italic>A. hydrophila</italic> AQH0018 bacterium was grown in TSB medium at 32&#xb0;C for 18 hr, and cell pellets were harvested by centrifugation at 2,500 rpm for 10 mins, washed and resuspended in 0.85% NaCl prior to injection. The effective doses were preliminarily determined to validate the optimum dose throughout the median lethal dose (LD<sub>50</sub>) assay (<xref ref-type="bibr" rid="B42">42</xref>). Sixteen organs, brain (BR), dendrite (DR), gall bladder (GB), gills (GIL), head kidney (HK), heart (HR), intestine (IN), liver (LI), muscle (MC), ovary (OV), peripheral blood lymphocytes (PBL), skin (SKN), spleen (SPL), stomach (STO), testes (TES) and trunk kidney (TK), were collected from three fish of each catfish before injection (normal fish) and post injection (infectious fish) at 0, 12, 24, 36, 48, 60, 72, 84, 96, 108, 120, 132, 144, 156 and 168 hr.</p>
<p>Total RNA and first-strand cDNA synthesis from sixteen organs of catfish were isolated using NucleoZOL&#x2122; reagent (Clontech Laboratories, CA, USA) and a Thermo Scientific RevertAid Reverse Transcriptase kit (Thermo Fisher Scientific, MA, USA) following the manufacturer&#x2019;s instructions.</p>
<p>Quantification of <italic>Igh&#x3bc;</italic> gene expression was performed using quantitative reverse transcriptase PCR (qRT-PCR) assays. qRT-PCR assays were performed with Brilliant III Ultra-Fast SYBR<sup>&#xae;</sup> Green (Agilent, CA, USA) in Mx3005P QPCR Systems (Agilent, CA, USA). qPCRs of the <italic>Igh&#x3bc;</italic> gene and <italic>&#x3b2;-actin</italic> genes of each fish species were conducted using the specific primers <italic>Cla</italic>_<italic>Igh&#x3bc;_qpcr<sub>_</sub>f:</italic> 5&#x2032;-TGGACTGAGCTACGTTTGGAAGGA-3&#x2032; and <italic>Cla</italic>_ <italic>Igh&#x3bc;_ qpcr_r:</italic> 5&#x2032;-CGCCTGACTCACTGAGGAGTACTT<italic>-</italic>3&#x2032; with an amplicon size of 167 bp and <italic>Cla</italic>_<italic>b-actin_qpcr<sub>_</sub>f:</italic> 5&#x2032;-GTCCGTGACATCAAGGAGAAGCTC-3&#x2032; and <italic>Cla</italic>_<italic>b-actin_qpcr<sub>_</sub>r:</italic> 5&#x2032;-GGACTCCATACCCAGGAAAGATGG-3&#x2032; with an amplicon size of 189 bp for the <italic>Igh&#x3bc;</italic> and <italic>&#x3b2;-actin</italic> genes, respectively. In addition, the expression distribution of two novel transcripts including <italic>Cm</italic>_mIgM2 and <italic>Cm</italic>_mIgM3 were performed in sixteen organs of healthy bighead catfish. The specific primers are <italic>Cm</italic>_mIgM2_<italic>f:</italic> 5&#x2032;-GCACAGAGTTCACCTGCAATG-3&#x2032; and <italic>Cm</italic>_mIgM2_<italic>r:</italic> 5&#x2032;-AAATGTTAAGGCATACAGACC-3&#x2032; with an amplicon size of 154 bp, and <italic>Cm</italic>_mIgM3_<italic>f:</italic> 5&#x2032;-CCACGGATACGTCTGGAGAA-3&#x2032; and <italic>Cm</italic>_mIgM3_<italic>r:</italic> 5&#x2032;-ACTCGCCTTGACTCTCACTG-3&#x2032; with an amplicon size of 163 bp.</p>
<p>qRT-PCR cycling conditions were one cycle of 95&#xb0;C for 5&#xa0;min, 40 cycles of 95&#xb0;C for 30 sec, 60&#xb0;C for 30 sec, and 72&#xb0;C for 90 sec, followed by a final extension at 72&#xb0;C for 10&#xa0;min. The expression of the <italic>&#x3b2;-actin</italic> gene was used as the housekeeping gene to standardize the results by eliminating variation in mRNA and cDNA quantity and quality. The relative expression of the <italic>Igh&#x3bc;</italic> gene in catfish tissues was calculated using 2<italic>
<sup>-&#x394;&#x394;CT</sup>
</italic> analysis according to the protocol by Schmittgen and Livak (2001) (<xref ref-type="bibr" rid="B43">43</xref>). The brain RT was used as calibrator. All reactions were done in triplicate.</p>
</sec>
<sec id="s2_14">
<title>Statistical Analysis</title>
<p>The relative expression levels of <italic>Igh&#x3bc;</italic> genes were calculated using <italic>&#x3b2;-actin</italic> as a reference. All quantitative data are presented as the mean <bold>&#xb1;</bold> standard deviation (SD). Statistical analysis at each time course was performed using SPSS statistics 24.0 software using one-way analysis of variance (ANOVA) and Duncan&#x2019;s new multiple range test (DMRT). The level of statistical significance between species in different organs is indicated as * (<italic>P</italic>&lt;0.05), ** (<italic>P</italic>&lt;0.01) and *** (<italic>P</italic>&lt;0.001) using Student&#x2019;s t-test.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<title>Results</title>
<sec id="s3_1">
<title>Characterization and Sequence Analysis of cDNA Transcripts Encoding a Constant Region of the <italic>Igh&#x3bc;</italic> Gene</title>
<p>Through analysis of the cDNA transcripts encoding constant regions of the <italic>Igh&#x3bc;</italic> genes in bighead catfish, North African catfish and their hybrid catfish, one hundred positive clones of each catfish were first cloned and sequenced to obtain the internal nucleotide sequences of the constant regions of the <italic>Igh&#x3bc;</italic> genes. A single band of PCR fragment was shown for each catfish species. Sequence analysis indicated no variation in the nucleotide sequences of individual bighead catfish, North African catfish and their hybrid catfish. There were four exons encoding C&#x3bc;<sub>s</sub> [C&#x3bc;<sub>1(partial)</sub>-C&#x3bc;<sub>2</sub>-C&#x3bc;<sub>3</sub>-C&#x3bc;<sub>4(partial)</sub>] of 954 and 949 bp for bighead catfish and North African catfish, respectively (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>), compared to the published <italic>Igh&#x3bc;</italic> sequence of channel catfish (<italic>Ictalurus punctatus</italic>). In the hybrid, two different nucleotide sequences were observed; each sequence exhibited a 100% match with the <italic>Igh&#x3bc;</italic> sequence of one of the parents. Among a hundred clones from hybrid catfish, the <italic>Igh&#x3bc;</italic> nucleotide sequences shared a distribution of 28% and 72% to bighead catfish and North African catfish, respectively (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>).</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Representation of the genomic organization and splicing patterns of <italic>Igh&#x3bc;</italic> in teleosts and catfish. <italic>Igh&#x3bc;</italic> generally encodes a VH domain, four constant (C&#x3bc;<sub>1</sub> to C&#x3bc;<sub>4</sub>) domains and two transmembrane domains. For full-length cDNA <italic>Igh&#x3bc;</italic> transcripts in bighead catfish, North African catfish and their hybrid catfish, three major molecular techniques were performed <bold>(A)</bold>. Patterns of PCR amplification products, 5&#x2019; RACE PCR <bold>(B)</bold>, internal constant domain <bold>(C)</bold>, and 3&#x2019; RACE PCR <bold>(D)</bold> of <italic>Igh&#x3bc;</italic> of bighead catfish, North African catfish and their hybrid catfish. A single gene copy (NCBI accession no. MZ559374) and six different <italic>Igh&#x3bc;</italic> transcripts were identified in bighead catfish, and five and one were expressed as membrane (NCBI accession nos. MN934742, MN934743, MN934744, MN934745 and MN934746) and secreted forms (NCBI accession no. MN934747), respectively. Moreover, two membrane forms of <italic>Igh&#x3bc;</italic> transcripts had novel splicing patterns in teleosts and vertebrates (highlighted in yellow) (NCBI accession nos. MN934745 and MN934746) <bold>(E)</bold>. A single gene copy (NCBI accession no. MZ559375) and three different <italic>Igh&#x3bc;</italic> transcripts were identified in North African catfish; two and one were expressed as membrane (NCBI accession no. MN934748 and MN934749) and secreted forms (NCBI accession no. MN934750), respectively <bold>(F)</bold>. Two gene copies (NCBI accession nos. MZ559376 and MZ559377) and two <italic>Igh&#x3bc;</italic> transcripts were identified in the hybrid catfish (NCBI accession nos. MN934751 and MN934752) <bold>(G)</bold>. Comparisons of cytogenetic localization of <italic>Igh&#x3bc;</italic> gene loci in bighead catfish <bold>(H)</bold>, North African catfish <bold>(I)</bold> and their hybrid catfish <bold>(J)</bold>. All nucleotide sequences are illustrated in supplementary files and the NCBI database corresponding to the provided NCBI accession numbers.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-884434-g001.tif"/>
</fig>
<p>The 5&#x2032; and 3&#x2032; of the <italic>Igh&#x3bc;</italic> gene constant regions in each catfish were consequently cloned and sequenced using 5&#x2032; and 3&#x2032; RACE techniques with specific primers designed from the 5&#x2032; end of the C&#x3bc;<sub>2</sub> exon and 3&#x2032; end of C&#x3bc;<sub>1</sub> for recovering the 5&#x2032; and 3&#x2032; nucleotide regions of <italic>Igh&#x3bc;</italic> cDNAs, respectively. The obtained 5&#x2032; and 3&#x2032; nucleotide sequences of <italic>Igh&#x3bc;</italic> genes corresponded to the C&#x3bc;<sub>1</sub>-C&#x3bc;<sub>2</sub>-C&#x3bc;<sub>3</sub> and C&#x3bc;<sub>3</sub>-C&#x3bc;<sub>4</sub>-TM-polyA tails, respectively (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>). No variation difference in the nucleotide sequences was observed in the 5&#x2032; <italic>Igh&#x3bc;</italic> constant region exon in bighead catfish and North African catfish. In addition, the hybrid catfish exhibited two different nucleotide sequences, one from each parent (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1A, B</bold>
</xref>). There was no variation in the internal nucleotide sequences of the constant regions of the Igh&#x3bc; genes in all studied catfish. (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1C</bold>
</xref>). However, the sequences of the 3&#x2032; constant regions consisted of two major different Ig forms, (mIg and sIg), which are controlled by alternate mRNA processing events in certain species. Up to six nucleotide sequence patterns of 3&#x2032; region exons were observed in bighead catfish (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1D</bold>
</xref>): five patterns for mIg and one pattern for sIg. Among the five patterns of mIg, three corresponded to C&#x3bc;<sub>1</sub>-C&#x3bc;<sub>2</sub>-C&#x3bc;<sub>3</sub>-TM1-TM2 with differences in the polyadenylation signal region (polyA signal: TM-2A, TM-2B and TM-2C, respectively) of the untranslated 3&#x2032; sequence, one corresponded to C&#x3bc;<sub>1</sub>-C&#x3bc;<sub>2</sub>-C&#x3bc;<sub>3</sub>-C&#x3bc;<sub>4</sub>-TM1-TM2 containing the polyA signal TM-2C, and one corresponded to C&#x3bc;<sub>1</sub>-(non-<italic>Igh&#x3bc;</italic> exons)-C&#x3bc;<sub>2</sub>-C&#x3bc;<sub>3</sub>-TM<sub>1</sub>-TM<sub>2</sub> containing the polyA signal TM-2A. One sIg was encoded by exon C&#x3bc;<sub>1</sub>-C&#x3bc;<sub>2</sub>-C&#x3bc;<sub>3</sub>-C&#x3bc;<sub>4</sub> and the polyA signal SC-1A (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1D, E</bold>
</xref> and <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figures&#xa0;1</bold>
</xref>&#x2013;<xref ref-type="supplementary-material" rid="SM1">
<bold>6</bold>
</xref>).</p>
<p>Three nucleotide sequence patterns were observed in North African catfish, and they corresponded to two patterns for mIg and one pattern for sIg (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1D</bold>
</xref>). Two patterns of mIg corresponded to C&#x3bc;<sub>1</sub>-C&#x3bc;<sub>2</sub>-C&#x3bc;<sub>3</sub>-TM1-TM2 with differences in the polyadenylation signal region (polyA signal: TM-2A and TM-2B, respectively) of the untranslated 3&#x2032; sequence. Another pattern corresponded to sIg that contained four exons coding C&#x3bc;<sub>1</sub>-C&#x3bc;<sub>2</sub>-C&#x3bc;<sub>3</sub>-C&#x3bc;<sub>4</sub> and the polyA signal SC-1A (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1D, F</bold>
</xref> and <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figures&#xa0;7</bold>
</xref>&#x2013;<xref ref-type="supplementary-material" rid="SM1">
<bold>9</bold>
</xref>).</p>
<p>Two nucleotide sequence patterns of the 3&#x2032; region exon corresponding to mIg (C&#x3bc;<sub>1</sub>-C&#x3bc;<sub>2</sub>-C&#x3bc;<sub>3</sub>-TM1-TM2) and sIg (C&#x3bc;<sub>1</sub>-C&#x3bc;<sub>2</sub>-C&#x3bc;<sub>3</sub>-C&#x3bc;<sub>4</sub>) were observed in the hybrid. The mIg and sIg nucleotide sequence coding from C&#x3bc;<sub>1</sub> through polyA tails were absolutely identical to their parent, bighead catfish and African catfish, respectively (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1D, G</bold>
</xref> and <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figures&#xa0;1</bold>
</xref>, <xref ref-type="supplementary-material" rid="SM1">
<bold>9</bold>
</xref>).</p>
</sec>
<sec id="s3_2">
<title>Cytogenetic Mapping of <italic>Igh&#x3bc;</italic> Genes in Catfish</title>
<p>
<italic>In situ</italic> hybridization with specific probes to the <italic>Igh&#x3bc;</italic> gene of individual catfish species, bighead catfish and North African catfish revealed that only a single copy of the <italic>Igh&#x3bc;</italic> gene was found in bighead catfish (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1H</bold>
</xref>) and North African catfish (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1I</bold>
</xref>). In addition, a strong hybridization of both the <italic>Igh&#x3bc;</italic> genes of bighead catfish and North African catfish was represented in their hybrid catfish (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1J</bold>
</xref>). The expression of <italic>Igh&#x3bc;</italic> transcripts in the hybrid catfish from the two <italic>Igh&#x3bc;</italic> genes received from the parents was confirmed.</p>
</sec>
<sec id="s3_3">
<title>Amino Acid Sequence Comparison of <italic>Igh&#x3bc;</italic> Transcripts in <italic>Clarias</italic> Catfish</title>
<p>The amino acid sequences of <italic>Igh&#x3bc;</italic> transcripts among bighead catfish, North African catfish and their hybrid catfish were aligned and compared to published complete IgH gene loci of channel catfish (<italic>Ictalurus punctatus</italic>) and zebrafish (<italic>Danio rerio</italic>). The aligned sequences are illustrated in <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>. The results showed several important features based on the overall relative size of the amino acid sequences of general <italic>Igh&#x3bc;</italic> transcripts, with 436 and 430 residues for the constant (C&#x3bc;<sub>1</sub>-C&#x3bc;<sub>4</sub>) domain and 44 and 41 residues for the transmembrane domains of bighead catfish and North African catfish, respectively. The mIgM and sIgM forms of the hybrid catfish were similar in size to those of the parents, bighead catfish and North African catfish (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>). The sequence similarity of the mIgM and sIgM forms of the hybrid catfish were absolutely conserved and similar to those of the parents. These results exhibited highly important significant differences between their phenotypic characterization and relationship to their parent.</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Comparisons of translated amino acids among bighead catfish, North African catfish, their hybrid catfish, channel catfish and zebrafish in different <italic>Igh&#x3bc;</italic>-coded exons found in this study: C&#x3bc;<sub>1</sub> exon <bold>(A)</bold>, non-<italic>Igh&#x3bc;</italic> exon <bold>(B)</bold>, C&#x3bc;<sub>2</sub> exon <bold>(C)</bold>, C&#x3bc;<sub>3</sub> exon <bold>(D)</bold>, C&#x3bc;<sub>4</sub> exon <bold>(E)</bold> and <italic>Igh&#x3bc;</italic> tail exon <bold>(F)</bold>. *, fully conserved residue of amino acids that play the same role in the same column/position.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-884434-g002.tif"/>
</fig>
<p>The translated amino acid sequences of the individual C&#x3bc;<sub>1</sub>, C&#x3bc;<sub>2</sub>, C&#x3bc;<sub>3</sub>, C&#x3bc;<sub>4</sub> and transmembrane domains of bighead catfish, North African catfish and their hybrid catfish were used to define significant similarity among their relationships and evolutionary lineage. The amino acid sequences of the C&#x3bc;<sub>1</sub> and C&#x3bc;<sub>2</sub> domains of all catfish were similar in size, with 103 and 103 residues, respectively (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>). However, the C&#x3bc;<sub>1</sub> and C&#x3bc;<sub>2</sub> domains were slightly larger and smaller than the channel catfish C&#x3bc;<sub>1</sub> and C&#x3bc;<sub>2</sub> domains (102 and 104 residues, respectively) (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>). Additionally, bighead catfish shared amino acid similarity of C&#x3bc;<sub>1</sub> and C&#x3bc;<sub>2</sub> to African catfish, the hybrid catfish (mIgM), the hybrid catfish (sIgM), channel catfish and zebrafish with 82.4, 100.0, 82.4, 72.5 and 38.6% similarity for the C&#x3bc;<sub>1</sub> domain and 77.2, 100.0, 727.2, 57.8 and 36.8% similarity for the C&#x3bc;<sub>2</sub> domain, respectively (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table&#xa0;1</bold>
</xref>). The amino acid similarity of the C&#x3bc;<sub>3</sub> domains of bighead catfish shared 69.7, 100.0, 69.7, 45.9 and 32.9% and 74.4, 100.0, 74.4, 54.03 and 43.2% similarity in the C&#x3bc;<sub>4</sub> domain to North African catfish, the hybrid catfish (mIgM), the hybrid catfish (sIgM), channel catfish and zebrafish, respectively. In addition, the amino acid similarity values of transmembrane domains of the <italic>Igh&#x3bc;</italic> carboxyl-terminal region of bighead catfish were 97.5, 100.0, 84.0 and 76.0% for North African catfish, the hybrid catfish (mIgM), channel catfish and zebrafish, respectively. Overall, based on amino acid conservation analyses of five complete domains of <italic>Igh&#x3bc;</italic> of bighead catfish, the C&#x3bc;<sub>1</sub>, C&#x3bc;<sub>2</sub>, C&#x3bc;<sub>3</sub>, C&#x3bc;<sub>4</sub> and TM domains shared 75.8, 100.0, 75.8, 57.5 and 38.4% similarity with North African catfish, the hybrid catfish (mIgM), the hybrid catfish (sIgM), channel catfish and zebrafish, respectively (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table&#xa0;1</bold>
</xref>).</p>
<p>The conservation of the <italic>Igh&#x3bc;</italic> domain is evident in the catfish C&#x3bc;<sub>1</sub>, C&#x3bc;<sub>2</sub>, C&#x3bc;<sub>3</sub>, and C&#x3bc;<sub>4</sub> of <italic>Igh&#x3bc;</italic> structures. The cysteines that likely form the intradomain disulfide bridge (<italic>S-S</italic>) as well as the tryptophan located within the C&#x3bc;<sub>1</sub>, C&#x3bc;<sub>2</sub>, C&#x3bc;<sub>3</sub>, and C&#x3bc;<sub>4</sub> regions were absolutely conserved among catfish, channel catfish and zebrafish (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2A&#x2013;E</bold>
</xref>). The cysteine that likely participates in the disulfide linkage of the catfish chain to the light chain was also conserved in the C&#x3bc;<sub>1</sub> regions (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>). Additionally, the predicted results of these protein tertiary structures of <italic>Igh&#x3bc;</italic> transcripts in bighead catfish, North African catfish and their hybrid catfish are illustrated in <xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3</bold>
</xref>. The <italic>Igh&#x3bc;</italic> molecules encoded by general coding exons found in teleost and catfish mIg (C&#x3bc;<sub>1</sub>-C&#x3bc;<sub>2</sub>-C&#x3bc;<sub>3</sub>-TM1-TM2) and sIg (C&#x3bc;<sub>1</sub>-C&#x3bc;<sub>2</sub>-C&#x3bc;<sub>3</sub>-C&#x3bc;<sub>4</sub>) exhibited similar predicted structures in all the studied catfish (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3A&#x2013;C</bold>
</xref>). Additionally, the predicted results of these protein tertiary structures of <italic>Igh&#x3bc;</italic> transcripts of unusual splicing patterns generated novel membrane forms of <italic>Igh&#x3bc;</italic> transcripts in teleosts [C&#x3bc;<sub>1</sub>-C&#x3bc;<sub>2</sub>-C&#x3bc;<sub>3</sub>-C&#x3bc;<sub>4</sub>-TM1-TM2] and vertebrates [C&#x3bc;<sub>1</sub>-(C&#x3b4;<sub>2</sub>-C&#x3b4;<sub>3</sub>-C&#x3b4;<sub>4</sub>-C&#x3b4;<sub>5</sub>)-C&#x3bc;<sub>2</sub>-C&#x3bc;<sub>3</sub>-TM1-TM2] that were larger in size and rather complex compared to other general predicted structures (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3D, E</bold>
</xref>).</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>The predicted crystal protein structures of <italic>Igh&#x3bc;</italic> transcripts expressed in the membrane and secreted forms in different catfish: bighead catfish <bold>(A)</bold>, North African catfish <bold>(B)</bold>, and their hybrid catfish <bold>(C)</bold>. The more complex molecules of two novel <italic>Igh&#x3bc;</italic> transcripts found in bighead catfish are illustrated in <bold>(D, E)</bold>.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-884434-g003.tif"/>
</fig>
<p>The evolutionary relationships of <italic>Igh&#x3bc;</italic> constant regions among various vertebrate species are illustrated in <xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4A</bold>
</xref>, and the relationships of teleost <italic>Igh</italic> constant regions are illustrated in <xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4B</bold>
</xref>. In this study, the <italic>Clarias</italic> catfish <italic>Igh&#x3bc;</italic> constant domains were cladded into the catfish group of vertebrate lineages and classified into the <italic>Igh&#x3bc;</italic> group among the reported <italic>Igh</italic> in fish.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Evolutionary phylogenetic relationship of <italic>Igh&#x3bc;</italic> between bighead catfish (NCBI accession nos. MN934742, MN934743, MN934744, MN934745, MN934746 and MN934747), North African catfish (NCBI accession nos. MN934748, MN934749 and MN934750), their hybrid catfish (NCBI accession nos. MN934751 and MN934752) and vertebrates, including mammals, amphibians, reptiles, aves, chondrichthyes and other teleosts <bold>(A)</bold>. Phylogenetic relationship between immunoglobulin heavy chain, IgM, IgD and IgZ/T, expressed in reported teleost fish and bighead catfish, North African catfish and their hybrid catfish <bold>(B)</bold>. Phylogenetic trees were constructed using neighbor-joining (NJ) algorithms with a bootstrap of 1000 replications.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-884434-g004.tif"/>
</fig>
</sec>
<sec id="s3_4">
<title>Unusual Splicing Patterns Generate Novel Membrane Forms of <italic>Igh&#x3bc;</italic> Transcripts in Teleosts and Vertebrates</title>
<p>The two novel and unusual splicing patterns of the <italic>Igh&#x3bc;</italic> membrane form were found in only bighead catfish: one was associated with a new splicing pattern among teleosts, and the other among vertebrates. The constant region of the new <italic>Igh&#x3bc;</italic> membrane form in teleosts is encoded by four C&#x3bc;<sub>4</sub> exons and directly spliced into the first transmembrane exons (C&#x3bc;<sub>1</sub>-C&#x3bc;<sub>2</sub>-C&#x3bc;<sub>3</sub>-C&#x3bc;<sub>4</sub>-TM1-TM2), as reported in other vertebrates, such as tetrapods, birds, sharks, and mammals. However, the castratory event was observed by the lack of a cryptic donor splicing site at the 3&#x2032; region of the C&#x3bc;<sub>4</sub> exon, which is important for splicing to the transmembrane domain to generate the membrane form as reported previously. The predicted crystal protein structure of this molecule is illustrated in <xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3D</bold>
</xref>. The predicted results of the protein tertiary structures are close to the actual crystal structures of reported <italic>Igh&#x3bc;</italic> transcripts in bighead catfish (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref>), North African catfish (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3B</bold>
</xref>) and their hybrid catfish (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3C</bold>
</xref>).</p>
<p>The other novel and unusual splicing pattern of the <italic>Igh&#x3bc;</italic> transcript was notable for vertebrates. The largest molecule of the <italic>Igh&#x3bc;</italic> membrane-bound form was defined together with the new <italic>Igh&#x3bc;</italic> splicing pattern among vertebrate animals. The molecular size of the molecule was approximately 92.64 kDa by encoding two major constant <italic>IgH</italic> loci in teleosts: C&#x3bc; and non-C&#x3bc; gene loci. The molecule encoded three C&#x3bc;<sub>s</sub> and non-C&#x3bc; constant exons. The first exon of the 5&#x2032;N-terminal domain was the C&#x3bc;<sub>1</sub> exon of the <italic>Igh&#x3bc;</italic> gene, which was directly spliced to the non-C&#x3bc; exons (487 residues) (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2B</bold>
</xref>) and then spliced directly to link the C&#x3bc;<sub>2</sub>, C&#x3bc;<sub>3</sub>, TM1 and TM2 exons of the <italic>Igh&#x3bc;</italic> gene of bighead catfish. The translated amino acid sequences of the C&#x3bc; exons, including C&#x3bc;<sub>1</sub>, C&#x3bc;<sub>2</sub>, C&#x3bc;<sub>3</sub>, TM1 and TM2, were identical (100%) to the previously described <italic>Igh&#x3bc;</italic> gene of bighead catfish (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1B</bold>
</xref>, <xref ref-type="fig" rid="f2">
<bold>2</bold>
</xref>). In addition, the encoded non-C&#x3bc; constant region exons were studied <italic>via</italic> BLAST and compared to the published complete <italic>IgH</italic> gene loci of channel catfish and zebrafish. The translated amino acid sequences of the entire non-C&#x3bc; exons were 57.73 and 34.63% identical to the <italic>Igh&#x3b4;</italic> gene locus of channel catfish and zebrafish, respectively (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table&#xa0;1</bold>
</xref>). The evolutionary relationship analysis of non-C&#x3bc; exons of bighead catfish was confirmed; it was grouped into <italic>Igh&#x3b4;</italic> among other teleosts and shared a branch with the <italic>Igh&#x3b4;</italic> of the closely related teleost species channel catfish (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4B</bold>
</xref>). In addition, the nearest neighbors&#x2019; relationships of presumptive <italic>Igh&#x3b4;</italic> constant exons were gilthead bream (<italic>Sparus aurata</italic>, AXL14358), grass carp (<italic>Ctenopharyngodon idella</italic>, ACV21058) and Wuchang bream (<italic>Megalobrama amblycephala</italic>, AGR34025). However, the presumptive non-C&#x3bc; exon sequences clustered within teleost <italic>Igh&#x3b4;</italic> rather than <italic>Igh&#x3bc;.</italic> The predicted protein tertiary structure of this molecule was larger in size and rather complex compared to other predicted structures (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3E</bold>
</xref>).</p>
</sec>
<sec id="s3_5">
<title>Genomic Organization of the <italic>Igh&#x3bc;</italic> Gene Locus</title>
<p>To gain insight into the <italic>Igh&#x3bc;</italic> locus of <italic>Clarias</italic> catfish and hybrid catfish, we also defined the complete genomic organization of the gene locus. The corresponding genomic sequences encoding the <italic>Igh&#x3bc;</italic> constant domain were amplified, cloned, sequenced and compared to the published complete <italic>Igh</italic> gene locus in channel catfish. Consistent with this finding, only a single copy of the genomic <italic>Igh&#x3bc;</italic> gene locus was found in bighead catfish and North African catfish (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1E, F, H, I</bold>
</xref>, and <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figures&#xa0;10</bold>
</xref>, <xref ref-type="supplementary-material" rid="SM1">
<bold>11</bold>
</xref>). The complete constant region of the <italic>Igh&#x3bc;</italic> locus, which encodes an Ig <italic>&#x3bc;</italic> domain, contained approximately 6,793 kb (six exons, five introns and six polyadenylation signals) and 6,660 kb (six exons, five introns and six polyadenylation signals) of bighead catfish and North African catfish, respectively. However, the individual <italic>Igh&#x3bc;</italic> loci of each bighead catfish and North African catfish were also found in the hybrid catfish, which had the transmembrane and secreted <italic>Igh&#x3bc;</italic> transcripts, as mentioned before. The nucleotide identity between the two <italic>Igh&#x3bc;</italic> gene loci in the hybrid catfish was identical to those of the parents, bighead catfish and African catfish (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1G, J</bold>
</xref> and <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figures&#xa0;10</bold>
</xref>, <xref ref-type="supplementary-material" rid="SM1">
<bold>11</bold>
</xref>).</p>
</sec>
<sec id="s3_6">
<title>Diversity Analysis of the Variable Domain (VH) of <italic>Igh&#x3bc;</italic> Genes</title>
<p>A total of 100 unique nonredundant clones of each catfish were characterized for VH sequences of the <italic>Igh&#x3bc;</italic> gene. The functional regions of VH encoded by the V<sub>H</sub>, D<sub>H</sub> and J<sub>H</sub> segments were identified, and analysis of framework regions (FWs) and complementarity-determining regions (CDRs) was also performed (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5A</bold>
</xref>) according to the international immunogenetics (IMGT) information numbering system for Ig structural definition (<xref ref-type="bibr" rid="B59">59</xref>).</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Representation of comparative diversity analyses of the VH domains of <italic>Igh&#x3bc;</italic> bighead catfish, North African catfish and their hybrid catfish. General structures of the VH domain correspond to the V<sub>H</sub>, D<sub>H</sub>, and J<sub>H</sub> segments that consist of the FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4 regions found in all vertebrates <bold>(A)</bold>. Comparative classification of the V<sub>H</sub>, D<sub>H</sub>, and J<sub>H</sub> gene segments in bighead catfish, North African catfish and their hybrid catfish <bold>(B)</bold>. Comparison of V<sub>H</sub> gene family members among reported vertebrates <bold>(C)</bold>. Degree of sequence variability of the VH repertoire in bighead catfish, North African catfish and their hybrid catfish, according to the Shannon (1948) and Kabat and Wu (1971) methods <bold>(D)</bold>. Comparison of amino acid length in CDR1, CDR2, and CDR3 of bighead catfish, North African catfish and their hybrid catfish <bold>(E)</bold>, x&#x305;: average nucleotide length, S<sup>2</sup>: variance distribution. Percent frequency of amino acid variability and composition of CDR1 CDR2 and CDR3 regions of bighead catfish, North African catfish and their hybrid catfish <bold>(F)</bold>. The NCBI accession numbers of VH nucleotide sequences are MN934442- MN934541, MN934542- MN934641 and MN934642- MN934741 for bighead catfish, North African catfish and their hybrid catfish, respectively.<sup>1</sup>Yasuike et&#xa0;al., 2010 (<xref ref-type="bibr" rid="B44">44</xref>); <sup>2</sup>Danilova et&#xa0;al., 2005 (<xref ref-type="bibr" rid="B13">13</xref>); <sup>3</sup>Yang et&#xa0;al., 2003 (<xref ref-type="bibr" rid="B45">45</xref>); <sup>4</sup>Brown et&#xa0;al., 2006 (<xref ref-type="bibr" rid="B46">46</xref>); <sup>5</sup>Phuyindee et&#xa0;al., 2015 (<xref ref-type="bibr" rid="B47">47</xref>); <sup>6</sup>Andersson and Matsunaga, 1998 (<xref ref-type="bibr" rid="B48">48</xref>); <sup>7</sup>Stenvik et&#xa0;al., 2000 (<xref ref-type="bibr" rid="B49">49</xref>); <sup>8</sup>Wilson et&#xa0;al., 1991 (<xref ref-type="bibr" rid="B31">31</xref>); <sup>9</sup>Peixoto and Brenner, 2000 (<xref ref-type="bibr" rid="B50">50</xref>); <sup>10</sup>Coscia and Oreste, 2003 (<xref ref-type="bibr" rid="B22">22</xref>); <sup>11</sup>Rumfelt et&#xa0;al., 2004 (<xref ref-type="bibr" rid="B51">51</xref>); <sup>12</sup>Lundqvist et&#xa0;al., 1998 (<xref ref-type="bibr" rid="B52">52</xref>); <sup>13</sup>Haire et&#xa0;al., 1990 (<xref ref-type="bibr" rid="B53">53</xref>);<sup>14</sup>Ota and Nei, 1995 (<xref ref-type="bibr" rid="B54">54</xref>); <sup>15</sup>Mainville et&#xa0;al., 1996 (<xref ref-type="bibr" rid="B55">55</xref>); <sup>16</sup>Mage et&#xa0;al., 1984 (<xref ref-type="bibr" rid="B56">56</xref>); <sup>17</sup>Sun et&#xa0;al., 1994 (<xref ref-type="bibr" rid="B57">57</xref>) and <sup>18</sup>Matsuda et&#xa0;al., 1998 (<xref ref-type="bibr" rid="B58">58</xref>).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-884434-g005.tif"/>
</fig>
<p>Based on 80% nucleotide identity, the functional V<sub>H</sub> segments were classified into <italic>15</italic>, <italic>15</italic> and <italic>17</italic> families for bighead catfish, North African catfish and their hybrid catfish, respectively. Between the most 3&#x2032; V<sub>H</sub> segment and the 5&#x2032; J<sub>H</sub> segment, 9, 11 and 13 functional D<sub>H</sub> segment families were defined in bighead catfish, North African catfish and their hybrid catfish, respectively. Altogether, the functional J<sub>H</sub> segments of catfish VH have been identified. There were 11, 11 and 8 families of bighead catfish, North African catfish and their hybrid catfish, respectively (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5B</bold>
</xref>). The comparisons of the V<sub>H</sub> gene family among catfish in this study and among reported vertebrates are illustrated in <xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5B, C</bold>
</xref>, respectively. The NCBI accession numbers of VH nucleotide sequences are MN934442-MN934541, MN934542-MN934641 and MN934642-MN934741 for bighead catfish, North African catfish and their hybrid catfish, respectively. In addition, adding P- and N-nucleotides was predominantly observed at the junction of the V and J segments for the generation of V(D)J junctional diversity in bighead catfish, North African catfish and their hybrid catfish (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figures&#xa0;12</bold>
</xref>&#x2013;<xref ref-type="supplementary-material" rid="SM1">
<bold>14</bold>
</xref>).</p>
</sec>
<sec id="s3_7">
<title>Analysis of Framework Regions (FWs) and Complementarity-Determining Regions (CDRs)</title>
<p>To determine the extent of diversification in the VH repertoire of the <italic>Igh&#x3bc;</italic> gene, we calculated the length variation and percent deviations of amino acids in each position of the FWs and CDRs and compared them to those of germline VH genes from the international ImMunoGeneTics information system<sup>&#xae;</sup> (IMGT<sup>&#xae;</sup>, <uri xlink:href="http://www.imgt.org">http://www.imgt.org</uri>) (<xref ref-type="bibr" rid="B60">60</xref>).</p>
<p>The FWs of bighead catfish, North African catfish and their hybrid catfish were similar in length and diversity of amino acids. The lengths of amino acids of FW1, FW2, FW3 and FW4 in all catfish were approximately 33, 14, 36 and 14 residues, respectively (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5D</bold>
</xref>). To examine the degree of sequence variability of the VH repertoire in <italic>Clarias</italic> catfish, plots of the variability according to the Shannon (1948) (<xref ref-type="bibr" rid="B40">40</xref>) and Kabat and Wu (1971) (<xref ref-type="bibr" rid="B41">41</xref>) methods were generated. The overall amino acid sequence variability of the VH region was mostly confined to the CDRs and particularly the CDR3s. In addition, the amino acid variability among CDRs (CDR1, CDR2 and CDR3) was highly similar to that of FR1 to FR4 of all studied catfish. Moreover, the comparisons of variability plots of VH sequences among the studied <italic>Clarias</italic> catfish were closely related in sequence patterns and variability level to each other based on both the Shannon and Kabat and Wu methods (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5D</bold>
</xref>). Shannon entropy plots of all catfish revealed increased diversity at amino acid positions 31 to 42 for CDR1, 58 to 65 for CDR2 and 102 to 120 for CDR3 (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5D</bold>
</xref>). They were generally related to the traditional definitions using the Kabat numbering convention (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5D</bold>
</xref>).</p>
<p>The amino acid length diagrams of CDRs of bighead catfish, North African catfish and their hybrid catfish in <xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5E</bold>
</xref> indicate that the amino acid length of CDR1 ranged from 3 to 12 residues with an average of 7.6, 7.5 and 6.9 residues, respectively. The most common length was seven for all catfish, with approximately 58 to 71% frequency.</p>
<p>Within nonredundant CDR1 (n&#x2009;=&#x2009;100) sequences of each <italic>Clarias</italic> catfish, 6 major amino acids were observed in bighead catfish, which accounted for 79.7% of all residues: Ala (7.7%), Gly (16.5%), Ser (18.9%), Thr (9.1%), Val (4.1%) and Tyr (23.1%). For North African catfish, 8 major amino acids were observed, which accounted for 93.7% of all residues: Cys (11.7%), Gly (8.5%), Asn (8.0%), Pro (4.0%), Ser (30.2%), Thr (14.5%), Val (8.7%), and Tyr (7.9%). For their hybrid catfish, 7 major amino acids were observed, which accounted for 75.2% of all residues: Asp (6.8%), Gly (8.2%), Leu (10.2%), Ser (17.3%), Thr (8.1%), Val (9.7%), and Tyr (14.6%) (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5F</bold>
</xref>).</p>
<p>The amino acid sequences of the CDR2 were shorter overall than those of CDR1, which were 4 to 8 residues in bighead catfish, North African catfish and their hybrid catfish with average amino acid lengths of 7.0, 6.9 and 6.8 residues, respectively. Approximately 76 to 79% of nonredundant CDR2s were 7 amino acid residues in length. Shannon entropy plots of amino acid variation of nonredundant CDR1 and CDR2 were mostly similar in diversity to those of the related V<sub>H</sub> families within the species and among <italic>Clarias</italic> species. Within 8 residues in length of CDR2 revealed highly conserved residues at position one of the CDR1s (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5F</bold>
</xref>).</p>
<p>Six major amino acids were observed in nonredundant CDR2s (n&#x2009;=&#x2009;100) sequences of bighead catfish, which accounted for 78.4% of all residues: Ala (5.4%), Asp (5.8%), Gly (25.3%), Ile (12.4%), Ser (11.7%) and Thr (17.5%). For North African catfish, 5 major amino acids were observed, which accounted for 78.2% of all residues: Asp (5.6%), Gly (21.0%), Ile (22.9%), Ser (17.4%) and Thr (11.1%). For their hybrid catfish, 5 major amino acids were also observed, which accounted for 73.2% of all residues: Asp (5.3%), Gly (31.8%), Ile (12.1%), Ser (11.3%) and Thr (12.4%) (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5F</bold>
</xref>).</p>
<p>The length distributions of the <italic>Clarias</italic> catfish CDR3 repertoire varied from 6 to 19 residues with averages of 11.9, 12.2 and 12.4 residues for bighead catfish, North African catfish and their hybrid catfish, respectively. The most common length was 10 to 15 residues for all catfish, with approximately 13 to 26% frequency. Analysis of amino acid frequencies for nonredundant CDR3s across all individual catfish revealed that the highest mutation rates in the VH repertoire were observed within CDR3 for all studied catfish. Highly conserved amino acid residues at positions one and two were observed in the CDR3 of all catfish. Seven major amino acids were observed in bighead catfish, which accounted for 66.3% of all residues: Ala (13.4%), Lys (7.1%), Leu (17.7%), Pro (3.6%), Gln (3.1%), Arg (17.1%) and Trp (4.0%). For North African catfish, 7 major amino acids were identified, which accounted for 80.3% of all residues: Ala (22.6%), Asp (7.5%), Gly (5.8%), His (9.5%), Ser (16.0%) Thr (4.3%) and Yyr (14.4%). For their hybrid catfish, 8 major amino acids were observed, which accounted for 77.4% of all residues: Ala (7.9%), Asp (5.9%), Gly (5.5%), Lys (10.7%), Leu (16.8%), Arg (21.0%), Ser (5.0%) and Thr (4.3%). Notably, three amino acids, Gly, Ser and Thr, were predominantly distributed in all CDR1s, CDR2s and CDR3s of all catfish in this study (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5F</bold>
</xref>).</p>
</sec>
<sec id="s3_8">
<title>Expression and Tissue Distribution of <italic>Igh&#x3bc;</italic> Genes</title>
<p>To examine the distribution of <italic>Igh&#x3bc;</italic> in <italic>Clarias</italic> catfish, we examined the potential functional coding segment of <italic>Igh&#x3bc;</italic>, the C&#x3bc;<sub>2</sub> region, in sixteen tissues of catfish. <italic>Igh&#x3bc;</italic> was highly expressed in the head kidney, spleen and peripheral blood lymphocytes (PBLs) in all studied catfish (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6A</bold>
</xref>). The relative expression levels reached approximately 60-, 700- and 600-fold the accustomed expression in head kidney, an important fish immune response organ, of bighead catfish, North African catfish and their hybrid catfish, respectively. However, the lowest expression was also observed in various tissues, including the brain, dendrite, gallbladder, gills, heart, liver, muscle, ovary, skin, stomach, testes and trunk kidney, in all studied catfish (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6A, B</bold>
</xref>). Highly significant expression levels were observed in North African catfish and the hybrid catfish in several tissues, including the gills, head kidney, heart, intestine, liver, muscle, ovary, PBLs, skin, spleen, stomach, and testes, compared to those in bighead catfish (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6B</bold>
</xref>). No significant difference was observed in tissues of North African catfish and the hybrid catfish. However, the relative expression of <italic>Igh&#x3bc;</italic> was not significantly different in dendrites, gall bladder or trunk kidney among all studied catfish (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6B</bold>
</xref>).</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Representation of the overall relative expression and distribution of <italic>Igh&#x3bc;</italic> in bighead catfish, North African catfish and their hybrid catfish in sixteen tissues <bold>(A)</bold>. Comparison of the relative expression of <italic>Igh&#x3bc;</italic> in sixteen different tissues <bold>(B)</bold>. Expression responses of <italic>Igh&#x3bc;</italic> in immune-related organs, including the spleen, head kidney and PBLs, after intraperitoneal injection of a virulent pathogen, <italic>Aeromonas hydrophila</italic>, of bighead catfish, North African catfish and their hybrid catfish <bold>(C)</bold>. The relative expression levels of <italic>Igh&#x3bc;</italic> genes were calculated using <italic>&#x3b2;-actin</italic> as a reference gene. All quantitative data are presented as the mean &#xb1; standard deviation (SD). The levels of statistical significance are indicated by *(<italic>P</italic>&lt;0.05), **(<italic>P</italic>&lt;0.01) or ***(<italic>P</italic>&lt;0.001). The brain RT was used as the calibrator. All experiments are done in triplicate (n = 3). ns, not significant.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-884434-g006.tif"/>
</fig>
<p>Intraperitoneal injection of virulent <italic>Aeromonas hydrophila</italic> clearly exhibited the pattern of immune responses of catfish, and its significance was defined among the three catfish. In the spleen, the expression of <italic>Igh&#x3bc;</italic> was moderately increased approximately 200-400-fold after 12&#x2013;168 hours (hr) of pathogen exposure for all catfish. For the head kidney, the expression of <italic>Igh&#x3bc;</italic> was strongly increased approximately 200&#x2013;300-, 850&#x2013;950-, and 800&#x2013;950-fold after 12&#x2013;24 hr. of pathogen exposure for bighead catfish, North African catfish and their hybrid catfish, respectively. In the PBLs, <italic>Igh&#x3bc;</italic> expression showed significant upregulation of approximately 200-, 450- and 500-fold after 12&#x2013;24 hr. of exposure for bighead catfish, North African catfish and their hybrid catfish, respectively. In addition, an approximate upregulation of 200&#x2013;300-fold was also observed in all catfish after 12&#x2013;24 hr. of exposure (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6C</bold>
</xref>).</p>
<p>The relative expression of two novel transcripts, including <italic>Cm</italic>_mIgM2 and <italic>Cm</italic>_mIgM3 in bighead catfish tissues showed highly expression levels compared to brain, approximately 337- and 122-, 90- and 177-, 40- and 20-, 21- and 17-fold, in PBLs, head kidney, spleen, and liver of <italic>Cm</italic>_mIgM2 and <italic>Cm</italic>_mIgM3, respectively (<xref ref-type="fig" rid="f7">
<bold>Figures&#xa0;7A, B</bold>
</xref>).</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>Representation of relative expression levels and distribution of two novel <italic>Igh&#x3bc;</italic> molecules in bighead catfish including <italic>Cm</italic>_mIgM2 <bold>(A)</bold> and <italic>Cm</italic>_mIgM3 <bold>(B)</bold> in sixteen tissues. All experiments are done in triplicate (n=3).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-884434-g007.tif"/>
</fig>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<title>Discussion</title>
<p>The specific features of <italic>Igh&#x3bc;</italic> constant region transcripts found in bighead catfish, North African catfish and their hybrid catfish conform to the patterns of organization reported previously in other vertebrate and teleost <italic>Igh&#x3bc;</italic> genes. The <italic>Igh&#x3bc;</italic> constant regions of the secreted form of <italic>Igh&#x3bc;</italic> are a typically spliced pattern, as found in other teleosts, which are encoded by four C&#x3bc; protein domains, C&#x3bc;<sub>1</sub>, C&#x3bc;<sub>2</sub>, C&#x3bc;<sub>3</sub> and C&#x3bc;<sub>4</sub>, without a transmembrane protein domain at the carboxyl-terminal region (<xref ref-type="bibr" rid="B7">7</xref>, <xref ref-type="bibr" rid="B61">61</xref>). In addition, the general mRNA splicing patterns to generate the membrane form of <italic>Igh&#x3bc;</italic> were found in all studied catfish by direct splicing from C&#x3bc;<sub>3</sub> to the first transmembrane exon with the lack of a cryptic donor splicing site (T/C/G&#x2193;GGTAAA), as reported in the 3&#x2032; region of the C&#x3bc;<sub>4</sub> exon in mammalian, shark, and amphibian mIg molecules. In this study, two domains of transmembrane proteins of <italic>Igh&#x3bc;</italic> were found in all studied catfish as well as in channel catfish and other teleosts (<xref ref-type="bibr" rid="B5">5</xref>, <xref ref-type="bibr" rid="B14">14</xref>, <xref ref-type="bibr" rid="B24">24</xref>, <xref ref-type="bibr" rid="B29">29</xref>).</p>
<p>Two unexpected and unusual <italic>Igh&#x3bc;</italic> constant region transcripts were found in bighead catfish. One is a novel <italic>Igh&#x3bc;</italic> transcript for teleosts, and the other is a novel transcript for vertebrates. The form is unusual in that the transmembrane domains are directly spliced to exon C&#x3bc;<sub>4</sub> to create a membrane-bound form of <italic>Igh&#x3bc;</italic> that did not seem to conform to any patterns of the membrane form of the <italic>Igh&#x3bc;</italic> structure previously reported in teleosts. The molecule corresponded with C&#x3bc;<sub>1</sub>-C&#x3bc;<sub>2</sub>-C&#x3bc;<sub>3</sub>-C&#x3bc;<sub>4</sub>-TM1-TM2. Although this molecular pattern feature is typical of most mammals and vertebrates examined previously (<xref ref-type="bibr" rid="B62">62</xref>, <xref ref-type="bibr" rid="B63">63</xref>), the cryptic donor splicing site at the 3&#x2032; region of the C&#x3bc;<sub>4</sub> exon, the acceptor site of the first transmembrane (TM1) exon (<xref ref-type="bibr" rid="B62">62</xref>, <xref ref-type="bibr" rid="B64">64</xref>), was not found in the case of this study. In this regard, the presence of the C&#x3bc;<sub>4</sub> exon between C&#x3bc;<sub>3</sub> and the first transmembrane domain of the <italic>Igh&#x3bc;</italic> membrane-bound form produced a unique characteristic of the mIg form as a novel membrane receptor feature of B cells in bighead catfish and teleosts.</p>
<p>Another important <italic>Igh&#x3bc;</italic> transcript was discovered in bighead catfish, and it is interesting in that the membrane-bound form of <italic>Igh&#x3bc;</italic> was encoded by two major exon domains, C&#x3bc; and non-C&#x3bc; exon domains. The molecular pattern was obviously characterized as C&#x3bc;<sub>1</sub>-(non-C&#x3bc;)-C&#x3bc;<sub>2</sub>-C&#x3bc;<sub>3</sub>-TM1-TM2. The presence of 487 amino acid residues of the non-C&#x3bc; exon between the C&#x3bc;<sub>1</sub> and C&#x3bc;<sub>2</sub> regions of the typical membrane-bound form of <italic>Igh&#x3bc;</italic> was spliced directly to the end of the C&#x3bc;<sub>1</sub> exon without any additional or lacking amino acids. Thus far, the non-C&#x3bc; exon was defined compared to the most closely and distinctly related published <italic>Igh</italic> locus, channel catfish (<italic>Ictalurus punctatus</italic>) (<xref ref-type="bibr" rid="B63">63</xref>, <xref ref-type="bibr" rid="B65">65</xref>) and zebrafish (<italic>Danio rerio</italic>) (<xref ref-type="bibr" rid="B13">13</xref>, <xref ref-type="bibr" rid="B66">66</xref>). The amino acid similarity of the non-C&#x3bc; exon was 57.73% and 34.63% to the <italic>Igh&#x3b4;</italic> gene loci of channel catfish and zebrafish, respectively. It is also characterized as four <italic>Igh&#x3b4;</italic> constant exons based on the <italic>Igh&#x3b4;</italic> gene locus of channel catfish, C<sub>&#x3b4;2</sub>-C<sub>&#x3b4;3</sub>-C<sub>&#x3b4;4</sub>-C<sub>&#x3b4;5</sub>. There were 79, 220, 94 and 94 amino acid residues, respectively (<xref ref-type="bibr" rid="B63">63</xref>, <xref ref-type="bibr" rid="B65">65</xref>). In this regard, it is interesting that the 3&#x2032; end of non-C&#x3bc;, C<sub>&#x3b4;5,</sub> was directly spliced to the C&#x3bc;<sub>2</sub>-C&#x3bc;<sub>3</sub>-TM1-TM2 exons with the identical polyadenylation signal at the C-terminus of the described typically membrane-bound form of the <italic>Igh&#x3bc;</italic> molecule in bighead catfish. The evolutionary relationship analysis of this novel membrane-bound form seemed to confirm the identification by grouping into the <italic>Igh&#x3b4;</italic> clade among other teleosts and sharing a branch to the <italic>Igh&#x3b4;</italic> of the closely related teleost species, channel catfish (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref>). However, the presumptive non-C&#x3bc; exon sequences clustered within the teleost <italic>Igh&#x3b4;</italic> rather than <italic>Igh&#x3bc;</italic> gene domains. The new pattern of mRNA splicing of the <italic>Igh&#x3bc;</italic> membrane formed by two major <italic>Igh&#x3bc;</italic> and <italic>Igh&#x3b4;</italic> constant exons could be defined as C&#x3bc;<sub>1</sub>-C&#x3b4;2-C&#x3b4;3-C&#x3b4;4-C&#x3b4;5-C&#x3bc;<sub>2</sub>-C&#x3bc;<sub>3</sub>-TM1 and TM2. The presence of encoding <italic>Igh&#x3b4;</italic> constant exons inside the <italic>Igh&#x3bc;</italic> molecule suggests that this was a novel splicing pattern among vertebrate animals that has never been present in any class of vertebrates thus far (<xref ref-type="bibr" rid="B5">5</xref>, <xref ref-type="bibr" rid="B9">9</xref>, <xref ref-type="bibr" rid="B25">25</xref>, <xref ref-type="bibr" rid="B29">29</xref>, <xref ref-type="bibr" rid="B66">66</xref>). However, the unusual splicing of the two patterns was not found in either North African catfish or the hybrid catfish. Therefore, it is possible that bighead catfish express <italic>Igh&#x3bc;</italic> membrane receptors with at least three different mRNA splicing patterns.</p>
<p>Inside the gene organizations of constant <italic>Igh&#x3bc;</italic> regions, the lengths of the five introns separating these six exons seem to be similar to those of the closely related species channel catfish<sup>42</sup> and quite different from those of other vertebrates. The intron separating C&#x3bc;<sub>1</sub> and C&#x3bc;<sub>2</sub> was approximately 1.7 kb for bighead catfish, 1.8 kb for North African catfish and 1.7 kb for channel catfish (<xref ref-type="bibr" rid="B63">63</xref>). <italic>Xenopus</italic> also exhibited a long intron between C&#x3bc;<sub>1</sub> and C&#x3bc;<sub>2</sub> of approximately 1.6 kb (<xref ref-type="bibr" rid="B67">67</xref>, <xref ref-type="bibr" rid="B68">68</xref>). Smaller introns separating C&#x3bc;<sub>2</sub> to C&#x3bc;<sub>3</sub> and C&#x3bc;<sub>3</sub> to C&#x3bc;<sub>4</sub> of approximately 0.2&#x2013;0.4 kb and 0.2&#x2013;0.3 kb were found in bighead catfish and North African catfish, respectively, and were also identified in channel catfish (<xref ref-type="bibr" rid="B63">63</xref>). However, a longer intron (approximately 1.4 kb) between exons C&#x3bc;<sub>2</sub> and C&#x3bc;<sub>3</sub> was found in the horn shark <italic>Heterodontus francisci</italic> (<xref ref-type="bibr" rid="B69">69</xref>). An extensive distance between C&#x3bc;<sub>4</sub> and the first transmembrane domain exons of approximately 1&#x2013;3 kb seems to be observed in bighead catfish, North African catfish and all reported vertebrates, such as mouse, horned shark and channel catfish (<xref ref-type="bibr" rid="B63">63</xref>, <xref ref-type="bibr" rid="B67">67</xref>&#x2013;<xref ref-type="bibr" rid="B69">69</xref>) . The introns separating C&#x3bc;<sub>1</sub>, C&#x3bc;<sub>2</sub>, C&#x3bc;<sub>3</sub>, and C&#x3bc;<sub>4</sub> in mouse are all less than 0.5 kb (<xref ref-type="bibr" rid="B70">70</xref>, <xref ref-type="bibr" rid="B71">71</xref>). In addition, a large intron separating TM1 and TM2 exons was also approximately 1.3 kb and 1.2 kb for bighead catfish and North African catfish, respectively, as found in <italic>Xenopus</italic> (approximately 1.1 kb) and channel catfish (approximately 2.3 kb) (<xref ref-type="bibr" rid="B63">63</xref>, <xref ref-type="bibr" rid="B67">67</xref>, <xref ref-type="bibr" rid="B69">69</xref>) . On the basis of the obtained data, this <italic>Igh&#x3bc;</italic> gene organization was characteristically generalized to all teleost fish.</p>
<p>The gene localization of the <italic>Igh&#x3bc;</italic> gene region of the IgH constant region locus of bighead catfish, North African catfish and their hybrid catfish confirms that bighead catfish and North African catfish possess only a single copy of this gene, whereas their hybrid catfish possesses two copies of this gene (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1J</bold>
</xref>). The finding that the <italic>Clarias</italic> catfish <italic>Igh&#x3bc;</italic> gene is most likely found in a single copy in the genome suggests that it may be common to all teleost fish, e.g., in channel catfish (<xref ref-type="bibr" rid="B72">72</xref>) and several other teleosts (<xref ref-type="bibr" rid="B26">26</xref>, <xref ref-type="bibr" rid="B73">73</xref>, <xref ref-type="bibr" rid="B74">74</xref>). The obtained <italic>Igh&#x3bc;</italic> constant gene organization of the hybrid catfish clearly showed that the sequences were identical to those of the parents. The presence of two copies of the <italic>Igh&#x3bc;</italic> gene in the hybrid catfish may be normal in diploid hybrid animals. In this regard, it is interesting that the <italic>Igh&#x3bc;</italic> transcripts of the hybrid catfish are processed from different gene loci, and the membrane-bound and secretory forms were made up of the <italic>Igh&#x3bc;</italic> gene of bighead catfish and North African catfish, respectively. The degree similarity of the amino acid was also identical to those of the parents. This available evidence would seem thus far to support the disease resistance characteristics of North African catfish and the hybrid catfish in several research reports. This suggests that the soluble effector molecules secreted from <italic>Igh&#x3bc;</italic> of North African catfish and the hybrid catfish may be strongly involved in specific immune responses, such as toxin or microbe neutralization, opsonization (immunophagocytosis), antibody-dependent cell-mediated cytotoxicity (ADCC), and complement activation (immunolysis) (<xref ref-type="bibr" rid="B1">1</xref>, <xref ref-type="bibr" rid="B75">75</xref>).</p>
<p>Furthermore, the ability of Ig to interact and bind antigen was involved in the variable domains of <italic>Igh&#x3bc;</italic> molecules. Specific pathogens or antigens are recognized <italic>via</italic> the fragment antigen-binding (Fab) variable region (<xref ref-type="bibr" rid="B49">49</xref>). Additional analysis of the VH domain provided extensive insight. In our findings, the overall structures of bighead catfish, North African catfish and their hybrid catfish VH region corresponded to the V<sub>H,</sub> D<sub>H,</sub> and J<sub>H</sub> segments that consist of FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4, as reported in all vertebrates examined previously (<xref ref-type="bibr" rid="B49">49</xref>, <xref ref-type="bibr" rid="B76">76</xref>).</p>
<p>Analysis of the V<sub>H</sub>, D<sub>H</sub> and J<sub>H</sub> family classification based on their 80% similarities of amino acids interestingly demonstrated that a large number of V<sub>H</sub> gene families were defined in all studied catfish, of approximately 15&#x2013;17 family members from one hundred nonredundant clones. There are similarities in some teleosts and some mammals, e.g., Atlantic salmon, zebrafish, and mice (14&#x2013;18 families). However, there were also higher levels in the V<sub>H</sub> gene family than in vertebrates (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5C</bold>
</xref>) (<xref ref-type="bibr" rid="B13">13</xref>, <xref ref-type="bibr" rid="B44">44</xref>, <xref ref-type="bibr" rid="B58">58</xref>). Much less is known and reported about the D<sub>H</sub> and J<sub>H</sub> segments of teleosts than about the V<sub>H</sub> of teleosts. Bighead catfish, North African catfish and their hybrid catfish process approximately 9, 11, and 13 families and 11, 11, and 8 families for a hundred nonredundant clones of D<sub>H</sub> and J<sub>H</sub> segments, respectively, compared to 9 in channel catfish, 4 in mouse, 6 in human, 6 in <italic>O. mykiss</italic>, and 2 in <italic>G. morhua</italic> for the J<sub>H</sub> segment (<xref ref-type="bibr" rid="B73">73</xref>). To date, there have been few reports of D<sub>H</sub> region diversity in vertebrates and teleosts, and significant variability in D<sub>H</sub> segments can be inferred from the generation of variability in CDR3 defined in the different cDNA clone sequences (<xref ref-type="bibr" rid="B49">49</xref>, <xref ref-type="bibr" rid="B73">73</xref>). This available evidence indicates that the mechanisms of VH diversity generalization of <italic>Igh&#x3bc;</italic> are made up of several gene family members that are necessary for generating several distinct VH repertoires in all studied catfish. In addition, junctional diversity occurs at the junction of the V<sub>H</sub>-D<sub>H</sub> and D<sub>H</sub>-J<sub>H</sub> boundaries. These regions code for CDR3. Diversity is increased by the addition of P-nucleotides and N-nucleotides (<xref ref-type="bibr" rid="B49">49</xref>). P-nucleotides are often made-up palindromic sequences and added to the ends of the asymmetrical DNA strand. Moreover, the random nontemplate-encoded addition of 2 to 20 base pairs or N nucleotides changes the amino acid sequence in the hypervariable CDR3. P- and N-nucleotides are principally found in the V<sub>H</sub>-D<sub>H</sub> and D<sub>H</sub>-J<sub>H</sub> junctions of the assembled heavy chain gene (<xref ref-type="bibr" rid="B49">49</xref>, <xref ref-type="bibr" rid="B76">76</xref>). Furthermore, it was suggested that inversion (D-D joining), nucleotide deletion, heavy-light chain pairing and somatic hypermutation contribute to diversity in VH antigenic recognition after naive B cells are released to the periphery and encounter antigens (<xref ref-type="bibr" rid="B49">49</xref>, <xref ref-type="bibr" rid="B73">73</xref>). Based on the findings in the present study, these mechanisms may be used to generate diverse VH repertoires in bighead catfish, North African catfish, and their hybrid catfish.</p>
<p>Analysis of the CDR3s provided strong evidence that the CDR3 of all studied catfish is longer than those of Atlantic cod, trout, frog and mouse but shorter than those of rabbit, human and cattle (<xref ref-type="bibr" rid="B13">13</xref>, <xref ref-type="bibr" rid="B44">44</xref>, <xref ref-type="bibr" rid="B49">49</xref>, <xref ref-type="bibr" rid="B58">58</xref>). In addition, overall analysis of the VH domain of <italic>Igh&#x3bc;</italic> indicated that the amino acid deviation in the CDRs was higher than that in the FWs in all catfish. Notably, these findings generally indicated predominant conservation in the VH repertoire (<xref ref-type="bibr" rid="B49">49</xref>, <xref ref-type="bibr" rid="B73">73</xref>). However, the calculated amino acid variability and composition of all CDRs in VH interestingly demonstrated that high variability plots and variability in amino acid composition were observed in all CDR1s, CDR2s and CDR3s of all studied catfish compared to those of reported vertebrates (<xref ref-type="bibr" rid="B49">49</xref>, <xref ref-type="bibr" rid="B77">77</xref>, <xref ref-type="bibr" rid="B78">78</xref>). Based on our findings, the potential for increasing the structural variability of the VH domain in <italic>Clarias</italic> catfish and their hybrids seems to be higher than that of teleosts, particularly given the number of V<sub>H</sub> and J<sub>H</sub> family members, long length of CDR3, and high variability in all CDR1s, CDR2s and CDR3s. This may be a general feature of <italic>Clarias</italic> catfish, which has never been reported thus far.</p>
<p>The functional expression of <italic>Igh&#x3bc;</italic> in bighead catfish, North African catfish and their hybrid catfish was examined in different tissues. The <italic>Igh&#x3bc;</italic> gene of all studied catfish and two novel <italic>Igh&#x3bc;</italic> molecules of bighead catfish were typically expressed in any organ and predominantly expressed in immune-related organs, especially the head kidney, PBLs, spleen and liver tissues, which is in accordance with previous studies (<xref ref-type="bibr" rid="B13">13</xref>, <xref ref-type="bibr" rid="B79">79</xref>). High expression of the two novel transcripts in immune-involved organs may indicate specific unknown functions that need further investigation.</p>
<p>In our study, significant responses of <italic>Igh&#x3bc;</italic> expression among <italic>Clarias</italic> catfish and the hybrid catfish were observed after bacterial exposure. North African catfish and the hybrid catfish exhibited approximately 900&#x2013;950-fold relative expression levels in head kidney and 400&#x2013;500-fold in PBLs; these levels are much higher than those of bighead catfish by at least 2&#x2013;2.5-fold changes. The head kidney in teleosts is considered a primary lymphoid organ similar to the mammalian bone marrow, a major hemopoietic organ and site of Ig and other immune cell production in teleosts (<xref ref-type="bibr" rid="B15">15</xref>). <italic>A. hydrophila</italic> is a significant pathogen of <italic>Clarias</italic> catfish in Thailand. It is highly pathogenic due to the presence of hemolysin and aerolysin virulence genes, which demonstrate high virulence in <italic>Clarias</italic> catfish acute septicemia. A virulent strain could cause death within 24 hrs. and resulted in abdominal effusion and varying degrees of internal organ hemorrhage. The precise mechanism by which specific IgM immune responses rapidly increased after 12-24 hrs. post-exposure is still uncertain in the <italic>A. hydrophila</italic> challenge experiment. It could be suggested in two ways. First, as a characteristic of acute septicemia, the virulent bacteria evenly divide speedily in the blood and are rapidly circulated to the major immune-related tissues such as the head and kidney, activating the chemokine signaling pathway and triggering an inflammatory response, as well as upregulating IgM in the host. Second, prior to conducting the experiment, all studied catfish were exposed to <italic>A. hydrophila</italic> in their surrounding environment, resulting in a strongly rapid upregulation of IgM specific to <italic>A. hydrophila</italic> 12-24 hrs. post-exposure.</p>
<p>Unexpectedly, the pattern of <italic>Igh&#x3bc;</italic> expression in hybrid catfish is consistent with their fatherhood of North African catfish. This evidence may imply a long mysterious question regarding the well-known characteristics of the bacterial resistance of North African catfish and the hybrid catfish, which normally are much higher than those of bighead catfish.</p>
<p>These results indicate that the <italic>Igh&#x3bc;</italic> transcripts in bighead catfish, North African catfish and the hybrid catfish are typically produced by splicing patterns of mRNA reported in all teleosts. Notably, in bighead catfish, two more unusual spicing <italic>Igh&#x3bc;</italic> transcripts of membrane-bound forms, 1) C&#x3bc;<sub>1</sub>-C&#x3bc;<sub>2</sub>-C&#x3bc;<sub>3</sub>-C&#x3bc;<sub>4-</sub>TM1-TM2 and 2) C&#x3bc;<sub>1</sub>-(C&#x3b4;<sub>2</sub>-C&#x3b4;<sub>3</sub>-C&#x3b4;<sub>4</sub>-C&#x3b4;<sub>5</sub>)-C&#x3bc;<sub>2</sub>-C&#x3bc;<sub>3</sub>-TM1-TM2, represent novel patterns of mRNA splicing of the <italic>Igh&#x3bc;</italic> membrane form for teleosts and vertebrates, respectively. However, the reasons for the addition of <italic>Igh&#x3b4;</italic> to <italic>Igh&#x3bc;</italic> molecules are still unknown. All <italic>Igh&#x3bc;</italic> transcripts were produced from a single gene copy in individual bighead catfish and North African catfish. In addition, the different <italic>Igh&#x3bc;</italic> transcripts, membrane and secreted forms, of diploid hybrid catfish consisted of two copies of the <italic>Igh&#x3bc;</italic> gene from the parents, bighead catfish and North African catfish. Extensive insight into the VH domain could generate a number of distinct structural variabilities in the VH domain in <italic>Clarias</italic> catfish and the hybrid catfish. The overall functional significance of <italic>Igh&#x3bc;</italic> in hybrid catfish is mostly similar to that in North African catfish.</p>
</sec>
<sec id="s5" sec-type="data-availability">
<title>Data Availability Statement</title>
<p>The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Material</bold>
</xref>.</p>
</sec>
<sec id="s6" sec-type="ethics-statement">
<title>Ethics Statement</title>
<p>The animal study was reviewed and approved by The Animal Ethics Committee, Kasetsart University, Thailand (Ethics ID: ACKU61-FIS-004). Written informed consent was obtained from the owners for the participation of their animals in this study.</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author Contributions</title>
<p>AB designed and performed all the experiments and wrote the original manuscript. UN-N and PS revised the manuscript. PS designed the experiments and revised the manuscript. All authors listed have read and approved the manuscript for publication.</p>
</sec>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>This work was financially supported by the Thailand Research Fund (TRF) and the Betagro Science Center, Thailand. This study is part of the project entitled &#x201c;Genetics and Biotechnology for Improvement of Aquatic Animal Production&#x201d; (contract number DPG5980003) awarded to Professor Uthairat Na-Nakorn under the &#x201c;Distinguished Research Professor 2016 Award.&#x201d;</p>
</sec>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of Interest</title>
<p>The authors declare that this research was conducted in the absence of any commercial or financial relationship that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s10" sec-type="disclaimer">
<title>Publisher&#x2019;s Note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
</body>
<back>
<ack>
<title>Acknowledgments</title>
<p>We would like to acknowledge Associate Professor Dr. Kornsorn Srikulnath and his laboratory members, Department of Genetics, Faculty of Science, Kasetsart University, Bangkok Thailand, for training in chromosome preparation. In addition, we thank the Graduate School at Kasetsart University, Thailand, for the partial financial support of the student who is the first author of this article.</p>
</ack>
<sec id="s11" sec-type="supplementary-material">
<title>Supplementary Material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fimmu.2022.884434/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fimmu.2022.884434/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="DataSheet_1.pdf" id="SM1" mimetype="application/pdf"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Burton</surname> <given-names>DR</given-names>
</name>
<name>
<surname>Woof</surname> <given-names>JM</given-names>
</name>
</person-group>. <article-title>Human Antibody Effector Function</article-title>. <source>Adv Immunol</source> (<year>1992</year>) <volume>51</volume>:<fpage>1</fpage>&#x2013;<lpage>84</lpage>. doi: <pub-id pub-id-type="doi">10.1016/S0065-2776(08)60486-1</pub-id>
</citation>
</ref>
<ref id="B2">
<label>2</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Warr</surname> <given-names>GW</given-names>
</name>
</person-group>. <article-title>The Immunoglobulin Genes of Fish</article-title>. <source>Dev Comp Immunol</source> (<year>1995</year>) <volume>19</volume>:<fpage>1</fpage>&#x2013;<lpage>12</lpage>. doi: <pub-id pub-id-type="doi">10.1016/0145-305X(94)00052-H</pub-id>
</citation>
</ref>
<ref id="B3">
<label>3</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Coscia</surname> <given-names>MR</given-names>
</name>
<name>
<surname>Varriale</surname> <given-names>S</given-names>
</name>
<name>
<surname>De Santi</surname> <given-names>C</given-names>
</name>
<name>
<surname>Giacomelli</surname> <given-names>S</given-names>
</name>
<name>
<surname>Oreste</surname> <given-names>U</given-names>
</name>
</person-group>. <article-title>Evolution of the Antarctic Teleost Immunoglobulin Heavy Chain Gene</article-title>. <source>Mol Phylogenet Evol</source> (<year>2010</year>) <volume>55</volume>:<page-range>226&#x2013;33</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.ympev.2009.09.033</pub-id>
</citation>
</ref>
<ref id="B4">
<label>4</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Stavnezer</surname> <given-names>J</given-names>
</name>
<name>
<surname>Amemiya</surname> <given-names>CT</given-names>
</name>
</person-group>. <article-title>Evolution of Isotype Switching</article-title>. <source>Semin Immunol</source> (<year>2004</year>) <volume>16</volume>:<page-range>257&#x2013;75</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.smim.2004.08.005</pub-id>
</citation>
</ref>
<ref id="B5">
<label>5</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hikima</surname> <given-names>J</given-names>
</name>
<name>
<surname>Jung</surname> <given-names>TS</given-names>
</name>
<name>
<surname>Aoki</surname> <given-names>T</given-names>
</name>
</person-group>. <article-title>Immunoglobulin Genes and Their Transcriptional Control in Teleosts</article-title>. <source>Dev Comp Immunol</source> (<year>2011</year>) <volume>35</volume>:<page-range>924&#x2013;36</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.dci.2010.10.011</pub-id>
</citation>
</ref>
<ref id="B6">
<label>6</label>
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Ohno</surname> <given-names>S</given-names>
</name>
</person-group>. <source>Immunoglobulins</source> Vol. <volume>197-204</volume>. <person-group person-group-type="editor">
<name>
<surname>Litman</surname> <given-names>GW</given-names>
</name>
<name>
<surname>Good</surname> <given-names>RA</given-names>
</name>
</person-group>, editors. <publisher-loc>New York, NY, USA</publisher-loc>: <publisher-name>Springer USA</publisher-name> (<year>1978</year>).</citation>
</ref>
<ref id="B7">
<label>7</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wilson</surname> <given-names>MR</given-names>
</name>
<name>
<surname>van Ravenstein</surname> <given-names>E</given-names>
</name>
<name>
<surname>Miller</surname> <given-names>NW</given-names>
</name>
<name>
<surname>Clem</surname> <given-names>LW</given-names>
</name>
<name>
<surname>Middleton</surname> <given-names>DL</given-names>
</name>
<name>
<surname>Warr</surname> <given-names>GW</given-names>
</name>
</person-group>. <article-title>cDNA Sequences and Organization of IgM Heavy Chain Genes in Two Holostean Fish</article-title>. <source>Dev Comp Immunol</source> (<year>1995</year>) <volume>19</volume>:<page-range>153&#x2013;64</page-range>. doi: <pub-id pub-id-type="doi">10.1016/0145-305X(94)00063-L</pub-id>
</citation>
</ref>
<ref id="B8">
<label>8</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Roux</surname> <given-names>KH</given-names>
</name>
<name>
<surname>Greenberg</surname> <given-names>AS</given-names>
</name>
<name>
<surname>Greene</surname> <given-names>L</given-names>
</name>
<name>
<surname>Strelets</surname> <given-names>L</given-names>
</name>
<name>
<surname>Avila</surname> <given-names>D</given-names>
</name>
<name>
<surname>McKinney</surname> <given-names>EC</given-names>
</name>
<etal/>
</person-group>. <article-title>Structural Analysis of the Nurse Shark (New) Antigen Receptor (NAR): Molecular Convergence of NAR and Unusual Mammalian Immunoglobulins</article-title>. <source>Proc Natl Acad Sci USA</source> (<year>1998</year>) <volume>95</volume>:<page-range>11804&#x2013;9</page-range>. doi: <pub-id pub-id-type="doi">10.1073/pnas.95.20.11804</pub-id>
</citation>
</ref>
<ref id="B9">
<label>9</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Schaerlinger</surname> <given-names>B</given-names>
</name>
<name>
<surname>Bascove</surname> <given-names>M</given-names>
</name>
<name>
<surname>Frippiat</surname> <given-names>J-P</given-names>
</name>
</person-group>. <article-title>A New Isotype of Immunoglobulin Heavy Chain in the Urodele Amphibian <italic>Pleurodeles Waltl</italic> Predominantly Expressed in Larvae</article-title>. <source>Mol Immunol</source> (<year>2008</year>) <volume>45</volume>:<page-range>776&#x2013;86</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.molimm.2007.06.356</pub-id>
</citation>
</ref>
<ref id="B10">
<label>10</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Golub</surname> <given-names>R</given-names>
</name>
<name>
<surname>Charlemagne</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>Structure, Diversity, and Repertoire of VH Families in the Mexican Axolotl</article-title>. <source>J Immunol</source> (<year>1998</year>) <volume>160</volume>:<page-range>1233&#x2013;9</page-range>.</citation>
</ref>
<ref id="B11">
<label>11</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hsu</surname> <given-names>E</given-names>
</name>
<name>
<surname>Criscitiello</surname> <given-names>MF</given-names>
</name>
</person-group>. <article-title>Diverse Immunoglobulin Light Chain Organizations in Fish Retain Potential to Revise B Cell Receptor Specificities</article-title>. <source>J Immunol</source> (<year>2006</year>) <volume>177</volume>:<page-range>2452&#x2013;62</page-range>. doi: <pub-id pub-id-type="doi">10.4049/jimmunol.177.4.2452</pub-id>
</citation>
</ref>
<ref id="B12">
<label>12</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Litman</surname> <given-names>GW</given-names>
</name>
<name>
<surname>Anderson</surname> <given-names>MK</given-names>
</name>
<name>
<surname>Rast</surname> <given-names>JP</given-names>
</name>
</person-group>. <article-title>Evolution of Antigen Binding Receptors</article-title>. <source>Annu Rev Immunol</source> (<year>1999</year>) <volume>17</volume>:<page-range>109&#x2013;47</page-range>. doi: <pub-id pub-id-type="doi">10.1146/annurev.immunol.17.1.109</pub-id>
</citation>
</ref>
<ref id="B13">
<label>13</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Danilova</surname> <given-names>N</given-names>
</name>
<name>
<surname>Bussmann</surname> <given-names>J</given-names>
</name>
<name>
<surname>Jekosch</surname> <given-names>K</given-names>
</name>
<name>
<surname>Steiner</surname> <given-names>LA</given-names>
</name>
</person-group>. <article-title>The Immunoglobulin Heavy-Chain Locus in Zebrafish: Identification and Expression of a Previously Unknown Isotype, Immunoglobulin Z</article-title>. <source>Nat Immunol</source> (<year>2005</year>) <volume>6</volume>:<fpage>295</fpage>&#x2013;<lpage>302</lpage>. doi: <pub-id pub-id-type="doi">10.1038/ni1166</pub-id>
</citation>
</ref>
<ref id="B14">
<label>14</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Savan</surname> <given-names>R</given-names>
</name>
<name>
<surname>Aman</surname> <given-names>A</given-names>
</name>
<name>
<surname>Nakao</surname> <given-names>M</given-names>
</name>
<name>
<surname>Watanuki</surname> <given-names>H</given-names>
</name>
<name>
<surname>Sakai</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Discovery of a Novel Immunoglobulin Heavy Chain Gene Chimera From Common Carp (<italic>Cyprinus Carpio</italic> L.)</article-title>. <source>Immunogenetics</source> (<year>2005</year>) <volume>57</volume>:<page-range>458&#x2013;63</page-range>. doi: <pub-id pub-id-type="doi">10.1007/s00251-005-0015-z</pub-id>
</citation>
</ref>
<ref id="B15">
<label>15</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bengt&#xe9;n</surname> <given-names>E</given-names>
</name>
<name>
<surname>Quiniou</surname> <given-names>S</given-names>
</name>
<name>
<surname>Hikima</surname> <given-names>J</given-names>
</name>
<name>
<surname>Waldbieser</surname> <given-names>G</given-names>
</name>
<name>
<surname>Warr</surname> <given-names>GW</given-names>
</name>
<name>
<surname>Miller</surname> <given-names>NW</given-names>
</name>
<etal/>
</person-group>. <article-title>Structure of the Catfish IGH Locus: Analysis of the Region Including the Single Functional IGHM Gene</article-title>. <source>Immunogenetics</source> (<year>2006</year>) <volume>58</volume>:<page-range>831&#x2013;44</page-range>. doi: <pub-id pub-id-type="doi">10.1007/s00251-006-0139-9</pub-id>
</citation>
</ref>
<ref id="B16">
<label>16</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Saha</surname> <given-names>NR</given-names>
</name>
<name>
<surname>Suetake</surname> <given-names>H</given-names>
</name>
<name>
<surname>Suzuki</surname> <given-names>Y</given-names>
</name>
</person-group>. <article-title>Analysis and Characterization of the Expression of the Secretory and Membrane Forms of IgM Heavy Chains in the Pufferfish</article-title>. <source>Takifugu rubripes. Mol Immunol</source> (<year>2005</year>) <volume>42</volume>:<page-range>113&#x2013;24</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.molimm.2004.06.034</pub-id>
</citation>
</ref>
<ref id="B17">
<label>17</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Oreste</surname> <given-names>U</given-names>
</name>
<name>
<surname>Coscia</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Specific Features of Immunoglobulin VH Genes of the Antarctic Teleost</article-title>. <source>Trematomus bernacchii. Gene</source> (<year>2002</year>) <volume>295</volume>:<fpage>199</fpage>&#x2013;<lpage>204</lpage>. doi: <pub-id pub-id-type="doi">10.1016/S0378-1119(02)00686-8</pub-id>
</citation>
</ref>
<ref id="B18">
<label>18</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Merlino</surname> <given-names>A</given-names>
</name>
<name>
<surname>Varriale</surname> <given-names>S</given-names>
</name>
<name>
<surname>Coscia</surname> <given-names>MR</given-names>
</name>
<name>
<surname>Mazzarella</surname> <given-names>L</given-names>
</name>
<name>
<surname>Oreste</surname> <given-names>U</given-names>
</name>
</person-group>. <article-title>Structure and Dimerization of the Teleost Transmembrane Immunoglobulin Region</article-title>. <source>J Mol Graph Model</source> (<year>2008</year>) <volume>27</volume>:<page-range>401&#x2013;7</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.jmgm.2008.07.001</pub-id>
</citation>
</ref>
<ref id="B19">
<label>19</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Magor</surname> <given-names>BG</given-names>
</name>
<name>
<surname>Wilson</surname> <given-names>MR</given-names>
</name>
<name>
<surname>Miller</surname> <given-names>NW</given-names>
</name>
<name>
<surname>Clem</surname> <given-names>LW</given-names>
</name>
<name>
<surname>Middleton</surname> <given-names>DL</given-names>
</name>
<name>
<surname>Warr</surname> <given-names>GW</given-names>
</name>
</person-group>. <article-title>An Ig Heavy Chain Enhancer of the Channel Catfish <italic>Ictalurus Punctatus</italic>: Evolutionary Conservation of Function But Not Structure</article-title>. <source>J Immunol</source> (<year>1994</year>) <volume>153</volume>:<page-range>5556&#x2013;63</page-range>.</citation>
</ref>
<ref id="B20">
<label>20</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hordvik</surname> <given-names>I</given-names>
</name>
<name>
<surname>Voie</surname> <given-names>AM</given-names>
</name>
<name>
<surname>Glette</surname> <given-names>J</given-names>
</name>
<name>
<surname>Male</surname> <given-names>R</given-names>
</name>
<name>
<surname>Endresen</surname> <given-names>C</given-names>
</name>
</person-group>. <article-title>Cloning and Sequence Analysis of Two Isotypic IgM Heavy Chain Genes From Atlantic Salmon, <italic>Salmo Salar</italic> L</article-title>. <source>Eur J Immunol</source> (<year>1992</year>) <volume>22</volume>:<page-range>2957&#x2013;62</page-range>. doi: <pub-id pub-id-type="doi">10.1002/eji.1830221130</pub-id>
</citation>
</ref>
<ref id="B21">
<label>21</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ghaffari</surname> <given-names>SH</given-names>
</name>
<name>
<surname>Lobb</surname> <given-names>CJ</given-names>
</name>
</person-group>. <article-title>Cloning and Sequence Analysis of Channel Catfish Heavy Chain cDNA Indicate Phylogenetic Diversity Within the IgM Immunoglobulin Family</article-title>. <source>J Immunol</source> (<year>1989</year>) <volume>142</volume>:<page-range>1356&#x2013;65</page-range>.</citation>
</ref>
<ref id="B22">
<label>22</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Coscia</surname> <given-names>MR</given-names>
</name>
<name>
<surname>Oreste</surname> <given-names>U</given-names>
</name>
</person-group>. <article-title>Limited Diversity of the Immunoglobulin Heavy Chain Variable Domain of the Emerald Rock Cod <italic>Trematomus Bernacchii</italic>
</article-title>. <source>Fish Shellfish Immunol</source> (<year>2003</year>) <volume>14</volume>:<fpage>71</fpage>&#x2013;<lpage>92</lpage>. doi: <pub-id pub-id-type="doi">10.1006/fsim.2002.0418</pub-id>
</citation>
</ref>
<ref id="B23">
<label>23</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cheng</surname> <given-names>CA</given-names>
</name>
<name>
<surname>John</surname> <given-names>JA</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>MS</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>CY</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>CH</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>CH</given-names>
</name>
<etal/>
</person-group>. <article-title>Characterization of Serum Immunoglobulin M of Grouper and cDNA Cloning of Its Heavy Chain</article-title>. <source>Vet Immunol Immunopathol</source> (<year>2006</year>) <volume>109</volume>:<page-range>255&#x2013;65</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.vetimm.2005.08.029</pub-id>
</citation>
</ref>
<ref id="B24">
<label>24</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bengten</surname> <given-names>E</given-names>
</name>
<name>
<surname>Leanderson</surname> <given-names>T</given-names>
</name>
<name>
<surname>Pilstrom</surname> <given-names>L</given-names>
</name>
</person-group>. <article-title>Immunoglobulin Heavy Chain cDNA From the Teleost Atlantic Cod (<italic>Gadus Morhua</italic> L.): Nucleotide Sequences of Secretory and Membrane Form Show an Unusual Splicing Pattern</article-title>. <source>Eur J Immunol</source> (<year>1991</year>) <volume>21</volume>:<page-range>3027&#x2013;33</page-range>. doi: <pub-id pub-id-type="doi">10.1002/eji.1830211219</pub-id>
</citation>
</ref>
<ref id="B25">
<label>25</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Andersson</surname> <given-names>E</given-names>
</name>
<name>
<surname>Peixoto</surname> <given-names>B</given-names>
</name>
<name>
<surname>Tormanen</surname> <given-names>V</given-names>
</name>
<name>
<surname>Matsunaga</surname> <given-names>T</given-names>
</name>
</person-group>. <article-title>Evolution of the Immunoglobulin M Constant Region Genes of Salmonid Fish, Rainbow Trout (<italic>Oncorhynchus Mykiss</italic>) and Arctic Charr (<italic>Salvelinus Alpinus</italic>): Implications Concerning Divergence Time of Species</article-title>. <source>Immunogenetics</source> (<year>1995</year>) <volume>41</volume>:<page-range>312&#x2013;5</page-range>. doi: <pub-id pub-id-type="doi">10.1007/BF00172156</pub-id>
</citation>
</ref>
<ref id="B26">
<label>26</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Amemiya</surname> <given-names>CT</given-names>
</name>
<name>
<surname>Litman</surname> <given-names>GW</given-names>
</name>
</person-group>. <article-title>Complete Nucleotide Sequence of an Immunoglobulin Heavy-Chain Gene and Analysis of Immunoglobulin Gene Organization in a Primitive Teleost Species</article-title>. <source>Proc Natl Acad Sci USA</source> (<year>1990</year>) <volume>87</volume>:<page-range>811&#x2013;5</page-range>.</citation>
</ref>
<ref id="B27">
<label>27</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nakao</surname> <given-names>M</given-names>
</name>
<name>
<surname>Moritomo</surname> <given-names>T</given-names>
</name>
<name>
<surname>Tomana</surname> <given-names>M</given-names>
</name>
<name>
<surname>Fujiki</surname> <given-names>K</given-names>
</name>
<name>
<surname>Yano</surname> <given-names>T</given-names>
</name>
</person-group>. <article-title>Isolation of cDNA Encoding the Constant Region of the Immuoglobulin Heavy-Chain From Common Carp (<italic>Cyprinus Carpio</italic> L.)</article-title>. <source>Fish Shellfish Immunol</source> (<year>1998</year>) <volume>8</volume>:<page-range>425&#x2013;34</page-range>. doi: <pub-id pub-id-type="doi">10.1006/fsim.1998.0149</pub-id>
</citation>
</ref>
<ref id="B28">
<label>28</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<collab>FAO</collab>
</person-group>. <article-title>Food and Agriculture Organization of the United Nations</article-title>. <source>Fishstat Plus Rome</source> (<year>2017</year>).</citation>
</ref>
<ref id="B29">
<label>29</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Srisapoome</surname> <given-names>P</given-names>
</name>
<name>
<surname>Ohira</surname> <given-names>T</given-names>
</name>
<name>
<surname>Hirono</surname> <given-names>I</given-names>
</name>
<name>
<surname>Aoki</surname> <given-names>T</given-names>
</name>
</person-group>. <article-title>Genes of the Constant Regions of Functional Immunoglobulin Heavy Chain of Japanese Flounder</article-title>. <source>Paralichthys olivaceus. Immunogen</source> (<year>2004</year>) <volume>56</volume>:<fpage>292</fpage>&#x2013;<lpage>300</lpage>. doi: <pub-id pub-id-type="doi">10.1007/s00251-004-0689-7</pub-id>
</citation>
</ref>
<ref id="B30">
<label>30</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Picchietti</surname> <given-names>S</given-names>
</name>
<name>
<surname>Abelli</surname> <given-names>L</given-names>
</name>
<name>
<surname>Buonocore</surname> <given-names>F</given-names>
</name>
<name>
<surname>Randelli</surname> <given-names>E</given-names>
</name>
<name>
<surname>Fausto</surname> <given-names>AM</given-names>
</name>
<name>
<surname>Scapigliati</surname> <given-names>G.</given-names>
</name>
<etal/>
</person-group>. <article-title>Immunoglobulin Protein and Gene Transcripts in Sea Bream (<italic>Sparus Aurata</italic> L.) Oocytes</article-title>. <source>Fish Shellfish Immunol</source> (<year>2006</year>) <volume>20</volume>:<fpage>398</fpage>&#x2013;<lpage>404</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.fsi.2005.06.001</pub-id>
</citation>
</ref>
<ref id="B31">
<label>31</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wilson</surname> <given-names>MR</given-names>
</name>
<name>
<surname>Middleton</surname> <given-names>D</given-names>
</name>
<name>
<surname>Warr</surname> <given-names>GW</given-names>
</name>
</person-group>. <article-title>Immunoglobulin VH Genes of the Goldfish, <italic>Carassius Auratus</italic>: A Re-Examination</article-title>. <source>Mol Immunol</source> (<year>1991</year>) <volume>28</volume>:<page-range>449&#x2013;57</page-range>. doi: <pub-id pub-id-type="doi">10.1016/0161-5890(91)90158-G</pub-id>
</citation>
</ref>
<ref id="B32">
<label>32</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Buonocore</surname> <given-names>F</given-names>
</name>
<name>
<surname>Stocchi</surname> <given-names>V</given-names>
</name>
<name>
<surname>Nunez-Ortiz</surname> <given-names>N</given-names>
</name>
<name>
<surname>Randelli</surname> <given-names>E</given-names>
</name>
<name>
<surname>Gerdol</surname> <given-names>M</given-names>
</name>
<name>
<surname>Pallavicini</surname> <given-names>A</given-names>
</name>
<etal/>
</person-group>. <article-title>Immunoglobulin T From Sea Bass (<italic>Dicentrarchus Labrax</italic> L.): Molecular Characterization, Tissue Localization and Expression After Nodavirus Infection</article-title>. <source>BMC Mol Biol</source> (<year>2017</year>) <volume>18</volume>:<fpage>8</fpage>. doi: <pub-id pub-id-type="doi">10.1186/s12867-017-0085-0</pub-id>
</citation>
</ref>
<ref id="B33">
<label>33</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bengten</surname> <given-names>E</given-names>
</name>
<name>
<surname>Stromberg</surname> <given-names>S</given-names>
</name>
<name>
<surname>Pilstrom</surname> <given-names>L</given-names>
</name>
</person-group>. <article-title>Immunoglobulin VH Regions in Atlantic Cod (<italic>Gadus Morhua</italic> L.): Their Diversity and Relationship to VH Families From Other Species</article-title>. <source>Dev Comp Immunol</source> (<year>1994</year>) <volume>18</volume>:<page-range>109&#x2013;22</page-range>. doi: <pub-id pub-id-type="doi">10.1016/0145-305X(94)90239-9</pub-id>
</citation>
</ref>
<ref id="B34">
<label>34</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Magadan-Mompo</surname> <given-names>S</given-names>
</name>
<name>
<surname>Sanchez-Espinel</surname> <given-names>C</given-names>
</name>
<name>
<surname>Gambon-Deza</surname> <given-names>F</given-names>
</name>
</person-group>. <article-title>Immunoglobulin Heavy Chains in Medaka (<italic>Oryzias Latipes</italic>)</article-title>. <source>BMC Evol Biol</source> (<year>2011</year>) <volume>11</volume>:<fpage>165</fpage>. doi: <pub-id pub-id-type="doi">10.1186/1471-2148-11-165</pub-id>
</citation>
</ref>
<ref id="B35">
<label>35</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hu</surname> <given-names>YL</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>LY</given-names>
</name>
<name>
<surname>Xiang</surname> <given-names>LX</given-names>
</name>
<name>
<surname>Shao</surname> <given-names>JZ</given-names>
</name>
</person-group>. <article-title>Discovery of an Unusual Alternative Splicing Pathway of the Immunoglobulin Heavy Chain in a Teleost Fish, <italic>Danio Rerio</italic>
</article-title>. <source>Dev Comp Immunol</source> (<year>2011</year>) <volume>35</volume>:<page-range>253&#x2013;7</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.dci.2010.10.009</pub-id>
</citation>
</ref>
<ref id="B36">
<label>36</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Waterhouse</surname> <given-names>A</given-names>
</name>
<name>
<surname>Bertoni</surname> <given-names>M</given-names>
</name>
<name>
<surname>Bienert</surname> <given-names>S</given-names>
</name>
<name>
<surname>Studer</surname> <given-names>G</given-names>
</name>
<name>
<surname>Tauriello</surname> <given-names>G</given-names>
</name>
<name>
<surname>Gumienny</surname> <given-names>R</given-names>
</name>
<etal/>
</person-group>. <article-title>SWISS-MODEL: Homology Modelling of Protein Structures and Complexes</article-title>. <source>Nucleic Acids Res</source> (<year>2018</year>) <volume>46</volume>:<page-range>W296&#x2013;303</page-range>. doi: <pub-id pub-id-type="doi">10.1093/nar/gky427</pub-id>
</citation>
</ref>
<ref id="B37">
<label>37</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Karami</surname> <given-names>A</given-names>
</name>
<name>
<surname>Eghtesadi Araghi</surname> <given-names>P</given-names>
</name>
<name>
<surname>Syed</surname> <given-names>MA</given-names>
</name>
<name>
<surname>Wilson</surname> <given-names>SP</given-names>
</name>
</person-group>. <article-title>Chromosome Preparation in Fish: Effects of Fish Species and Larval Age</article-title>. <source>Int Aquat Res</source> (<year>2015</year>) <volume>7</volume>:<page-range>201&#x2013;10</page-range>. doi: <pub-id pub-id-type="doi">10.1007/s40071-015-0104-z</pub-id>
</citation>
</ref>
<ref id="B38">
<label>38</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Knoll</surname> <given-names>JH</given-names>
</name>
<name>
<surname>Lichter</surname> <given-names>P</given-names>
</name>
</person-group>. <article-title>
<italic>In Situ</italic> Hybridization to Metaphase Chromosomes and Interphase Nuclei</article-title>. <source>Curr Protoc Hum Genet</source> (<year>2005</year>) <volume>45</volume>:<fpage>4.3.1</fpage>&#x2013;<lpage>4.3.31</lpage>. doi: <pub-id pub-id-type="doi">10.1002/0471142905.hg0403s45</pub-id>
</citation>
</ref>
<ref id="B39">
<label>39</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>S</given-names>
</name>
<name>
<surname>Lefranc</surname> <given-names>MP</given-names>
</name>
<name>
<surname>Miles</surname> <given-names>JJ</given-names>
</name>
<name>
<surname>Alamyar</surname> <given-names>E</given-names>
</name>
<name>
<surname>Giudicelli</surname> <given-names>V</given-names>
</name>
<name>
<surname>Duroux</surname> <given-names>P</given-names>
</name>
<etal/>
</person-group>. <article-title>IMGT/HighV QUEST Paradigm for T Cell Receptor IMGT Clonotype Diversity and Next Generation Repertoire Immunoprofiling</article-title>. <source>Nat Commun</source> (<year>2013</year>) <volume>4</volume>:<fpage>2333</fpage>. doi: <pub-id pub-id-type="doi">10.1038/ncomms3333</pub-id>
</citation>
</ref>
<ref id="B40">
<label>40</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shannon</surname> <given-names>CE</given-names>
</name>
</person-group>. <article-title>A Mathematical Theory of Communication</article-title>. <source>Bell Syst Tech</source> (<year>1948</year>) <volume>27</volume>:<fpage>379</fpage>&#x2013;<lpage>423</lpage>. doi: <pub-id pub-id-type="doi">10.1002/j.1538-7305.1948.tb01338.x</pub-id>
</citation>
</ref>
<ref id="B41">
<label>41</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kabat</surname> <given-names>EA</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>TT</given-names>
</name>
<name>
<surname>Bilofsky</surname> <given-names>H</given-names>
</name>
</person-group>. <article-title>Unusual Distributions of Amino Acids in Complementarity-Determining (Hypervariable) Segments of Heavy and Light Chains of Immunoglobulins and Their Possible Roles in Specificity of Antibody-Combining Sites</article-title>. <source>J Biol Chem</source> (<year>1977</year>) <volume>252</volume>:<page-range>6609&#x2013;16</page-range>. doi: <pub-id pub-id-type="doi">10.1016/S0021-9258(17)39891-5</pub-id>
</citation>
</ref>
<ref id="B42">
<label>42</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chinedu</surname> <given-names>E</given-names>
</name>
<name>
<surname>Arome</surname> <given-names>D</given-names>
</name>
<name>
<surname>Ameh</surname> <given-names>FS</given-names>
</name>
</person-group>. <article-title>A New Method for Determining Acute Toxicity in Animal Models</article-title>. <source>Int J Toxicol</source> (<year>2013</year>) <volume>20</volume>:<page-range>224&#x2013;6</page-range>. doi: <pub-id pub-id-type="doi">10.4103/0971-6580.121674</pub-id>
</citation>
</ref>
<ref id="B43">
<label>43</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Livak</surname> <given-names>KJ</given-names>
</name>
<name>
<surname>Schmittgen</surname> <given-names>TD</given-names>
</name>
</person-group>. <article-title>Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2<sup>(-Delta Delta C(T))</sup>
</article-title>. <source>Method Methods (San Diego Calif.)</source> (<year>2001</year>) <volume>25</volume>:<page-range>402&#x2013;8</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1006/meth.2001.1262</pub-id>
</citation>
</ref>
<ref id="B44">
<label>44</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yasuike</surname> <given-names>M</given-names>
</name>
<name>
<surname>de Boer</surname> <given-names>J</given-names>
</name>
<name>
<surname>von Schalburg</surname> <given-names>KR</given-names>
</name>
<name>
<surname>Cooper</surname> <given-names>GA</given-names>
</name>
<name>
<surname>McKinnel</surname> <given-names>L</given-names>
</name>
<name>
<surname>Messmer</surname> <given-names>A</given-names>
</name>
<etal/>
</person-group>. <article-title>Evolution of Duplicated IgH Loci in Atlantic Salmon</article-title>. <source>Salmo salar. BMC Genomics</source> (<year>2010</year>) <volume>11</volume>:<fpage>486</fpage>. doi: <pub-id pub-id-type="doi">10.1186/1471-2164-11-486</pub-id>
</citation>
</ref>
<ref id="B45">
<label>45</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname> <given-names>F</given-names>
</name>
<name>
<surname>Ventura-Holman</surname> <given-names>T</given-names>
</name>
<name>
<surname>Waldbieser</surname> <given-names>GC</given-names>
</name>
<name>
<surname>Lobb</surname> <given-names>CJ</given-names>
</name>
</person-group>. <article-title>Structure, Genomic Organization, and Phylogenetic Implications of Six New VH Families in the Channel Catfish</article-title>. <source>Mol Immunol</source> (<year>2003</year>) <volume>40</volume>:<page-range>247&#x2013;60</page-range>. doi: <pub-id pub-id-type="doi">10.1016/S0161-5890(03)00143-3</pub-id>
</citation>
</ref>
<ref id="B46">
<label>46</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Brown</surname> <given-names>GD</given-names>
</name>
<name>
<surname>Kaattari</surname> <given-names>IM</given-names>
</name>
<name>
<surname>Kaattari</surname> <given-names>SL</given-names>
</name>
</person-group>. <article-title>Two New Ig VH Gene Families in</article-title>. <source>Oncorhynchus mykiss. Immunogen</source> (<year>2006</year>) <volume>58</volume>:<page-range>933&#x2013;6</page-range>. doi: <pub-id pub-id-type="doi">10.1007/s00251-006-0149-7</pub-id>
</citation>
</ref>
<ref id="B47">
<label>47</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Phuyindee</surname> <given-names>C</given-names>
</name>
<name>
<surname>Unajak</surname> <given-names>S</given-names>
</name>
<name>
<surname>Srisapoome</surname> <given-names>P</given-names>
</name>
</person-group>. <article-title>Diversity Analysis of the Immunoglobulin M Heavy Chain Gene in Nile Tilapia, <italic>Oreochromis Niloticus</italic> (Linnaeus)</article-title>. <source>Afr J Biotechnol</source> (<year>2015</year>) <volume>14</volume>:<page-range>2282&#x2013;99</page-range>. doi: <pub-id pub-id-type="doi">10.5897/AJB2014.14001</pub-id>
</citation>
</ref>
<ref id="B48">
<label>48</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Andersson</surname> <given-names>E</given-names>
</name>
<name>
<surname>Matsunaga</surname> <given-names>T</given-names>
</name>
</person-group>. <article-title>Evolutionary Stability of the Immunoglobulin Heavy Chain Variable Region Gene Families in Teleost</article-title>. <source>Immunogenetics</source> (<year>1998</year>) <volume>47</volume>:<page-range>272&#x2013;7</page-range>. doi: <pub-id pub-id-type="doi">10.1007/s002510050357</pub-id>
</citation>
</ref>
<ref id="B49">
<label>49</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Stenvik</surname> <given-names>J</given-names>
</name>
<name>
<surname>Lundb&#xe4;ck</surname> <given-names>AS</given-names>
</name>
<name>
<surname>J&#xf8;rgensen</surname> <given-names>TO</given-names>
</name>
<name>
<surname>Pilstr&#xf6;m</surname> <given-names>L</given-names>
</name>
</person-group>. <article-title>Variable Region Diversity of the Atlantic Cod (<italic>Gadus Morhua</italic> L.) Immunoglobulin Heavy Chain</article-title>. <source>Immunogenetics</source> (<year>2000</year>) <volume>51</volume>:<page-range>670&#x2013;80</page-range>. doi: <pub-id pub-id-type="doi">10.1007/s002510000188</pub-id>
</citation>
</ref>
<ref id="B50">
<label>50</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Peixoto</surname> <given-names>BR</given-names>
</name>
<name>
<surname>Brenner</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>Characterization of Approximately 50&#x2009;Kb of the Immunoglobulin VH Locus of the Japanese Pufferfish</article-title>. <source>Fugu rubripes. Immunogen</source> (<year>2000</year>) <volume>51</volume>:<page-range>443&#x2013;51</page-range>. doi: <pub-id pub-id-type="doi">10.1007/s002510050643</pub-id>
</citation>
</ref>
<ref id="B51">
<label>51</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rumfelt</surname> <given-names>LL</given-names>
</name>
<name>
<surname>Lohr</surname> <given-names>RL</given-names>
</name>
<name>
<surname>Dooley</surname> <given-names>H</given-names>
</name>
<name>
<surname>Flajnik</surname> <given-names>MF</given-names>
</name>
</person-group>. <article-title>Diversity and Repertoire of IgW and IgM VH Families in the Newborn Nurse Shark</article-title>. <source>BMC Immunol</source> (<year>2004</year>) <volume>5</volume>:<fpage>8</fpage>. doi: <pub-id pub-id-type="doi">10.1186/1471-2172-5-8</pub-id>
</citation>
</ref>
<ref id="B52">
<label>52</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lundqvist</surname> <given-names>ML</given-names>
</name>
<name>
<surname>Str&#xf6;mberg</surname> <given-names>S</given-names>
</name>
<name>
<surname>Pilstr&#xf6;m</surname> <given-names>L</given-names>
</name>
</person-group>. <article-title>Ig Heavy Chain of the Sturgeon <italic>Acipenser Baeri</italic>: cDNA Sequence and Diversity</article-title>. <source>Immunogenetics</source> (<year>1998</year>) <volume>48</volume>:<page-range>372&#x2013;82</page-range>. doi: <pub-id pub-id-type="doi">10.1007/s002510050448</pub-id>
</citation>
</ref>
<ref id="B53">
<label>53</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Haire</surname> <given-names>RN</given-names>
</name>
<name>
<surname>Amemiya</surname> <given-names>CT</given-names>
</name>
<name>
<surname>Suzuki</surname> <given-names>D</given-names>
</name>
<name>
<surname>Litman</surname> <given-names>GW</given-names>
</name>
</person-group>. <article-title>Eleven Distinct VH Gene Families and Additional Patterns of Sequence Variation Suggest a High Degree of Immunoglobulin Gene Complexity in a Lower Vertebrate</article-title>. <source>Xenopus laevis. J Exp Med</source> (<year>1990</year>) <volume>171</volume>:<page-range>1721&#x2013;37</page-range>. doi: <pub-id pub-id-type="doi">10.1084/jem.171.5.1721</pub-id>
</citation>
</ref>
<ref id="B54">
<label>54</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ota</surname> <given-names>T</given-names>
</name>
<name>
<surname>Nei</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Evolution of Immunoglobulin VH Pseudogenes in Chickens</article-title>. <source>Mol Biol Evol</source> (<year>1995</year>) <volume>12</volume>:<fpage>94</fpage>&#x2013;<lpage>102</lpage>. doi: <pub-id pub-id-type="doi">10.1093/oxfordjournals.molbev.a040194</pub-id>
</citation>
</ref>
<ref id="B55">
<label>55</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mainville</surname> <given-names>CA</given-names>
</name>
<name>
<surname>Sheehan</surname> <given-names>KM</given-names>
</name>
<name>
<surname>Klaman</surname> <given-names>LD</given-names>
</name>
<name>
<surname>Giorgetti</surname> <given-names>CA</given-names>
</name>
<name>
<surname>Press</surname> <given-names>JL</given-names>
</name>
<name>
<surname>Brodeur</surname> <given-names>PH</given-names>
</name>
</person-group>. <article-title>Deletional Mapping of Fifteen Mouse VH Gene Families Reveals a Common Organization for Three IgH Haplotypes</article-title>. <source>J Immunol</source> (<year>1996</year>) <volume>156</volume>:<page-range>1038&#x2013;46</page-range>.</citation>
</ref>
<ref id="B56">
<label>56</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pinheiro</surname> <given-names>A</given-names>
</name>
<name>
<surname>Lanning</surname> <given-names>D</given-names>
</name>
<name>
<surname>Alves</surname> <given-names>PC</given-names>
</name>
<name>
<surname>Mage</surname> <given-names>RG</given-names>
</name>
<name>
<surname>Knight</surname> <given-names>KL</given-names>
</name>
<name>
<surname>van der Loo</surname> <given-names>W</given-names>
</name>
<etal/>
</person-group>. <article-title>Molecular Bases of Genetic Diversity and Evolution of the Immunoglobulin Heavy Chain Variable Region (IGHV) Gene Locus in Leporids</article-title>. <source>Immunogenetics</source> (<year>2011</year>) <volume>63</volume>:<fpage>397</fpage>&#x2013;<lpage>408</lpage>. doi: <pub-id pub-id-type="doi">10.1007/s00251-011-0533-9</pub-id>
</citation>
</ref>
<ref id="B57">
<label>57</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sun</surname> <given-names>J</given-names>
</name>
<name>
<surname>Kacskovics</surname> <given-names>I</given-names>
</name>
<name>
<surname>Brown</surname> <given-names>WR</given-names>
</name>
<name>
<surname>Butler</surname> <given-names>JE</given-names>
</name>
</person-group>. <article-title>Expressed Swine VH Genes Belong to a Small VH Gene Family Homologous to Human VHIII</article-title>. <source>J Immunol</source> (<year>1994</year>) <volume>153</volume>:<page-range>5618&#x2013;27</page-range>.</citation>
</ref>
<ref id="B58">
<label>58</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Matsuda</surname> <given-names>F</given-names>
</name>
<name>
<surname>Ishii</surname> <given-names>K</given-names>
</name>
<name>
<surname>Bourvagnet</surname> <given-names>P</given-names>
</name>
<name>
<surname>Kuma KiHayashida</surname> <given-names>H</given-names>
</name>
<name>
<surname>Miyata</surname> <given-names>T</given-names>
</name>
<etal/>
</person-group>. <article-title>The Complete Nucleotide Sequence of the Human Immunoglobulin Heavy Chain Variable Region Locus</article-title>. <source>J Exp Med</source> (<year>1998</year>) <volume>188</volume>:<page-range>2151&#x2013;62</page-range>. doi: <pub-id pub-id-type="doi">10.1084/jem.188.11.2151</pub-id>
</citation>
</ref>
<ref id="B59">
<label>59</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lefranc</surname> <given-names>MP</given-names>
</name>
<name>
<surname>Giudicelli</surname> <given-names>V</given-names>
</name>
<name>
<surname>Kaas</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Duprat</surname> <given-names>E</given-names>
</name>
<name>
<surname>Jabado-Michaloud</surname> <given-names>J</given-names>
</name>
<name>
<surname>Scaviner</surname> <given-names>D</given-names>
</name>
<etal/>
</person-group>. <article-title>IMGT, the International ImMunoGeneTics Information System</article-title>. <source>Nucleic Acids Res</source> (<year>2005</year>) <volume>33</volume>:<page-range>D593&#x2013;7</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/gki065</pub-id>
</citation>
</ref>
<ref id="B60">
<label>60</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lefranc</surname> <given-names>MP</given-names>
</name>
<name>
<surname>Giudicelli</surname> <given-names>V</given-names>
</name>
<name>
<surname>Ginestoux</surname> <given-names>C</given-names>
</name>
<name>
<surname>Bodmer</surname> <given-names>J</given-names>
</name>
<name>
<surname>M&#xfc;ller</surname> <given-names>W</given-names>
</name>
<name>
<surname>Bontrop</surname> <given-names>R</given-names>
</name>
<etal/>
</person-group>. <article-title>IMGT, the International ImMunoGeneTics Database</article-title>. <source>Nucleic Acids Res</source> (<year>1999</year>) <volume>27</volume>:<page-range>209&#x2013;12</page-range>. doi: <pub-id pub-id-type="doi">10.1093/nar/27.1.209</pub-id>
</citation>
</ref>
<ref id="B61">
<label>61</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hansen</surname> <given-names>JD</given-names>
</name>
<name>
<surname>Landis</surname> <given-names>ED</given-names>
</name>
<name>
<surname>Phillips</surname> <given-names>RB</given-names>
</name>
</person-group>. <article-title>Discovery of a Unique Ig Heavy-Chain Isotype (IgT) in Rainbow Trout: Implications for a Distinctive B Cell Developmental Pathway in Teleost Fish</article-title>. <source>Proc Natl Acad Sci USA</source> (<year>2005</year>) <volume>102</volume>:<page-range>6919&#x2013;24</page-range>. doi: <pub-id pub-id-type="doi">10.1073/pnas.0500027102</pub-id>
</citation>
</ref>
<ref id="B62">
<label>62</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fillatreau</surname> <given-names>S</given-names>
</name>
<name>
<surname>Six</surname> <given-names>A</given-names>
</name>
<name>
<surname>Magadan</surname> <given-names>S</given-names>
</name>
<name>
<surname>Castro</surname> <given-names>R</given-names>
</name>
<name>
<surname>Sunyer</surname> <given-names>JO</given-names>
</name>
<name>
<surname>Boudinot</surname> <given-names>P</given-names>
</name>
</person-group>. <article-title>The Astonishing Diversity of Ig Classes and B Cell Repertoires in Teleost Fish</article-title>. <source>Front Immunol</source> (<year>2013</year>) <volume>4</volume>. doi: <pub-id pub-id-type="doi">10.3389/fimmu.2013.00028</pub-id>
</citation>
</ref>
<ref id="B63">
<label>63</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bengt&#xe9;n</surname> <given-names>E</given-names>
</name>
<name>
<surname>Quiniou</surname> <given-names>SM</given-names>
</name>
<name>
<surname>Stuge</surname> <given-names>TB</given-names>
</name>
<name>
<surname>Katagiri</surname> <given-names>T</given-names>
</name>
<name>
<surname>Miller</surname> <given-names>NW</given-names>
</name>
<name>
<surname>Clem</surname> <given-names>LW</given-names>
</name>
<etal/>
</person-group>. <article-title>The IgH Locus of the Channel Catfish, <italic>Ictalurus Punctatus</italic>, Contains Multiple Constant Region Gene Dequences: Different Genes Encode Heavy Chains of Membrane and Secreted IgD</article-title>. <source>J Immunol</source> (<year>2002</year>) <volume>169</volume>:<fpage>2488</fpage>. doi: <pub-id pub-id-type="doi">10.4049/jimmunol.169.5.2488</pub-id>
</citation>
</ref>
<ref id="B64">
<label>64</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bruce</surname> <given-names>SR</given-names>
</name>
<name>
<surname>Dingle</surname> <given-names>RWC</given-names>
</name>
</person-group>. <article-title>Peterson Ml</article-title>. <source>B-cell Plasma-Cell Splicing Differences: A Potential Role Regulated Immunoglobulin RNA Processing. RNA</source> (<year>2003</year>) <volume>9</volume>:<page-range>1264&#x2013;73</page-range>. doi: <pub-id pub-id-type="doi">10.1261/rna.5820103</pub-id>
</citation>
</ref>
<ref id="B65">
<label>65</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ventura-Holman</surname> <given-names>T</given-names>
</name>
<name>
<surname>Lobb</surname> <given-names>CJ</given-names>
</name>
</person-group>. <article-title>Structural Organization of the Immunoglobulin Heavy Chain Locus in the Channel Catfish: The IgH Locus Represents a Composite of Two Gene Clusters</article-title>. <source>Mol Immunol</source> (<year>2002</year>) <volume>38</volume>:<page-range>557&#x2013;64</page-range>. doi: <pub-id pub-id-type="doi">10.1016/S0161-5890(01)00075-X</pub-id>
</citation>
</ref>
<ref id="B66">
<label>66</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Danilova</surname> <given-names>N</given-names>
</name>
<name>
<surname>Saunders</surname> <given-names>HL</given-names>
</name>
<name>
<surname>Ellestad</surname> <given-names>KK</given-names>
</name>
<name>
<surname>Magor</surname> <given-names>BG</given-names>
</name>
</person-group>. <article-title>The Zebrafish IgH Locus Contains Multiple Transcriptional Regulatory Regions</article-title>. <source>Dev Comp Immunol</source> (<year>2011</year>) <volume>35</volume>:<page-range>352&#x2013;9</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.dci.2010.10.010</pub-id>
</citation>
</ref>
<ref id="B67">
<label>67</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Schwager</surname> <given-names>J</given-names>
</name>
<name>
<surname>Mikoryak</surname> <given-names>CA</given-names>
</name>
<name>
<surname>Steiner</surname> <given-names>LA</given-names>
</name>
</person-group>. <article-title>Amino Acid Sequence of Heavy Chain From <italic>Xenopus Laevis</italic> IgM Deduced From cDNA Sequence: Implications for Evolution of Immunoglobulin Domains</article-title>. <source>Proc Natl Acad Sci USA</source> (<year>1988</year>) <volume>85</volume>:<page-range>2245&#x2013;9</page-range>. doi: <pub-id pub-id-type="doi">10.1073/pnas.85.7.2245</pub-id>
</citation>
</ref>
<ref id="B68">
<label>68</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Schwager</surname> <given-names>J</given-names>
</name>
<name>
<surname>Grossberger</surname> <given-names>D</given-names>
</name>
<name>
<surname>Du Pasquier</surname> <given-names>L</given-names>
</name>
</person-group>. <article-title>Organization and Rearrangement of Immunoglobulin M Genes in the Amphibian Xenopus</article-title>. <source>EMBO J</source> <year>1988</year>
<volume>7</volume>(<issue>8</issue>):<page-range>2409&#x2013;15</page-range>. doi: <pub-id pub-id-type="doi">10.1002/j.1460-2075.1988.tb03086.x</pub-id>
</citation>
</ref>
<ref id="B69">
<label>69</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lee</surname> <given-names>V</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>JL</given-names>
</name>
<name>
<surname>Lui</surname> <given-names>MF</given-names>
</name>
<name>
<surname>Malecek</surname> <given-names>K</given-names>
</name>
<name>
<surname>Ohta</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Mooers</surname> <given-names>A</given-names>
</name>
<etal/>
</person-group>. <article-title>The Evolution of Multiple Isotypic IgM Heavy Chain Genes in the Shark</article-title>. <source>J Immunol</source> (<year>2008</year>) <volume>180</volume>:<page-range>7461&#x2013;70</page-range>. doi: <pub-id pub-id-type="doi">10.4049/jimmunol.180.11.7461</pub-id>
</citation>
</ref>
<ref id="B70">
<label>70</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>McGuire</surname> <given-names>KL</given-names>
</name>
<name>
<surname>Duncan</surname> <given-names>WR</given-names>
</name>
<name>
<surname>Tucker</surname> <given-names>PW</given-names>
</name>
</person-group>. <article-title>Phylogenetic Conservation of Immunoglobulin Heavy Chains: Direct Comparison of Hamster and Mouse C&#x3bc; Genes</article-title>. <source>Nucleic Acids Res</source> (<year>1985</year>) <volume>13</volume>:<page-range>5611&#x2013;28</page-range>. doi: <pub-id pub-id-type="doi">10.1093/nar/13.15.5611</pub-id>
</citation>
</ref>
<ref id="B71">
<label>71</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Early</surname> <given-names>P</given-names>
</name>
<name>
<surname>Rogers</surname> <given-names>J</given-names>
</name>
<name>
<surname>Davis</surname> <given-names>M</given-names>
</name>
<name>
<surname>Calame</surname> <given-names>K</given-names>
</name>
<name>
<surname>Bond</surname> <given-names>M</given-names>
</name>
<name>
<surname>Wall</surname> <given-names>R</given-names>
</name>
<etal/>
</person-group>. <article-title>Two mRNAs Can Be Produced From a Single Immunoglobulin &#x3bc; Gene by Alternative RNA Processing Pathways</article-title>. <source>Cell</source> (<year>1980</year>) <volume>20</volume>:<page-range>313&#x2013;9</page-range>. doi: <pub-id pub-id-type="doi">10.1016/0092-8674(80)90617-0</pub-id>
</citation>
</ref>
<ref id="B72">
<label>72</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wilson</surname> <given-names>MR</given-names>
</name>
<name>
<surname>Marcuz</surname> <given-names>A</given-names>
</name>
<name>
<surname>van Ginkel</surname> <given-names>F</given-names>
</name>
<name>
<surname>Miller</surname> <given-names>NW</given-names>
</name>
<name>
<surname>Clem</surname> <given-names>LW</given-names>
</name>
<name>
<surname>Middleton</surname> <given-names>D</given-names>
</name>
<etal/>
</person-group>. <article-title>The Immunoglobulin M Heavy Chain Constant Region Gene of the Channel Catfish, <italic>Ictalurus Punctatus</italic>: An Unusual mRNA Splice Pattern Produces the Membrane Form of the Molecule</article-title>. <source>Nucleic Acids Res</source> (<year>1990</year>) <volume>18</volume>:<page-range>5227&#x2013;33</page-range>. doi: <pub-id pub-id-type="doi">10.1093/nar/18.17.5227</pub-id>
</citation>
</ref>
<ref id="B73">
<label>73</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ghaffari</surname> <given-names>SH</given-names>
</name>
<name>
<surname>Lobb</surname> <given-names>CJ</given-names>
</name>
</person-group>. <article-title>Nucleotide Sequence of Channel Catfish Heavy Chain cDNA and Genomic Blot Analyses</article-title>. <source>Implications Phylogeny Ig Heavy Chains. J&#xa0;Immunol</source> (<year>1989</year>) <volume>143</volume>:<page-range>2730&#x2013;9</page-range>.</citation>
</ref>
<ref id="B74">
<label>74</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lee</surname> <given-names>MA</given-names>
</name>
<name>
<surname>Bengt&#xe9;n</surname> <given-names>E</given-names>
</name>
<name>
<surname>Daggfeldt</surname> <given-names>A</given-names>
</name>
<name>
<surname>Rytting</surname> <given-names>A-S</given-names>
</name>
<name>
<surname>Pilstr&#xf6;m</surname> <given-names>L</given-names>
</name>
</person-group>. <article-title>Characterisation of Rainbow Trout cDNAs Encoding a Secreted and Membrane-Bound Ig Heavy Chain and the Genomic Intron Upstream of the First Constant Exon</article-title>. <source>Mol Immunol</source> (<year>1993</year>) <volume>30</volume>:<page-range>641&#x2013;8</page-range>. doi: <pub-id pub-id-type="doi">10.1016/0161-5890(93)90075-M</pub-id>
</citation>
</ref>
<ref id="B75">
<label>75</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Harris</surname> <given-names>LJ</given-names>
</name>
<name>
<surname>Larson</surname> <given-names>SB</given-names>
</name>
<name>
<surname>McPherson</surname> <given-names>A</given-names>
</name>
</person-group>. <article-title>Comparison of Intact Antibody Structures and the Implications for Effector Function</article-title>. <source>Adv Immunol</source> (<year>1999</year>) <volume>72</volume>:<fpage>191</fpage>&#x2013;<lpage>208</lpage>. doi: <pub-id pub-id-type="doi">10.1016/S0065-2776(08)60021-8</pub-id>
</citation>
</ref>
<ref id="B76">
<label>76</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Andersson</surname> <given-names>E</given-names>
</name>
<name>
<surname>Matsunaga</surname> <given-names>T</given-names>
</name>
</person-group>. <article-title>Evolution of Immunoglobulin Heavy Chain Variable Region Genes: A VH Family Can Last for 150-200 Million Years or Longer</article-title>. <source>Immunogenetics</source> (<year>1995</year>) <volume>41</volume>:<fpage>18</fpage>&#x2013;<lpage>28</lpage>. doi: <pub-id pub-id-type="doi">10.1007/BF00188428</pub-id>
</citation>
</ref>
<ref id="B77">
<label>77</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Roman</surname> <given-names>T</given-names>
</name>
<name>
<surname>De Guerra</surname> <given-names>A</given-names>
</name>
<name>
<surname>Charlemagne</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>Evolution of Specific Antigen Recognition: Size Reduction and Restricted Length Distribution of the CDRH3 Regions in the Rainbow Trout</article-title>. <source>Eur J Immunol</source> (<year>1995</year>) <volume>25</volume>:<page-range>269&#x2013;73</page-range>. doi: <pub-id pub-id-type="doi">10.1002/eji.1830250144</pub-id>
</citation>
</ref>
<ref id="B78">
<label>78</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Brodeur</surname> <given-names>PH</given-names>
</name>
<name>
<surname>Riblet</surname> <given-names>R</given-names>
</name>
</person-group>. <article-title>The Immunoglobulin Heavy Chain Variable Region (Igh-V) Locus in the Mouse</article-title>. <source>I. One Hundred Igh-V Genes Comprise Seven Families Homologous Genes. Eur J Immunol</source> (<year>1984</year>) <volume>14</volume>:<page-range>922&#x2013;30</page-range>. doi: <pub-id pub-id-type="doi">10.1002/eji.1830141012</pub-id>
</citation>
</ref>
<ref id="B79">
<label>79</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Stenvik</surname> <given-names>J</given-names>
</name>
<name>
<surname>Schr&#xf8;der</surname> <given-names>MB</given-names>
</name>
<name>
<surname>Olsen</surname> <given-names>K</given-names>
</name>
<name>
<surname>Zapata</surname> <given-names>A</given-names>
</name>
<name>
<surname>J&#xf8;rgensen</surname> <given-names>T&#xd8;</given-names>
</name>
</person-group>. <article-title>Expression of Immunoglobulin Heavy Chain Transcripts (VH-Families, IgM, and IgD) in Head Kidney and Spleen of the Atlantic Cod (<italic>Gadus Morhua</italic> L.)</article-title>. <source>Dev Comp Immunol</source> (<year>2001</year>) <volume>25</volume>:<fpage>291</fpage>&#x2013;<lpage>302</lpage>. doi: <pub-id pub-id-type="doi">10.1016/S0145-305X(00)00056-2</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>