Peripheral blood was obtained after securing informed consent approved by the Institutional Review Board of the AUBMC (IRB# BIO-2018-0358), and according to the Declaration of Helsinki. The study was conducted at the Immunology Research Laboratory of the Faculty of Medicine, American University of Beirut, Beirut, Lebanon.

Peripheral blood mononuclear cells (PBMCs) were isolated on a Ficoll-Paque PLUS gradient (GE Healthcare; IL, USA). Anti-human antibodies for surface and intracellular makers with isotype-matched controls were used for staining CD3 (UCHT1), CD4 (OKT4), CD8 (RPA-T8), CD45RA (HI100), CD45RO (UCHL1), CCR7 (G043H7), CD31 (WM59), CD16 (3G8), CD56 (5.1H11), CD127/IL-7Ra (A019D5), CD25 (BC96), CTLA-4 (L3D10), Helios (22F6), CD19 (HIB19), CD27 (M-T271), and IgD (IA6-2), all from Biolegend (CA, USA), and FOXP3 (PCH101) from eBioscience (CA, USA). Cells were analyzed on a BD FACS Aria cell sorter (BD Biosciences, NJ, USA), and analyzed with FlowJo software (Tree Star Inc.; OR, USA).

Genomic DNA (gDNA) was extracted from blood using the Gentra Puregene Blood Kit (Qiagen; Hilden, Germany). Custom-made primers were designed and ordered using the Ion AmpliSeq Designer (ThermoFisher Scientific, MA, USA) and used to amplify a targeted gene panel of 300 genes resulting in 6203 amplicons of intronic and exonic sequences. The products were subjected to next generation sequencing on an Ion GeneStudio S5 System (ThermoFisher Scientific), and the results were analyzed on the Ion Reporter software (ThermoFisher Scientific) using customized filters. The IL7RA gDNA region of interest was amplified by polymerase chain reaction (PCR) with TopTaq DNA Polymerase (Qiagen) using forward primer 5’GAGACTTGGAAGATGCAGAACTG3’ and reverse primer 5’CACACCTGGGTTTGAAGATCC3’. The amplified PCR products were purified using the QIAquick PCR purification kit (Qiagen) and subjected to Sanger sequencing. Sequences were compared to the reference sequence NM_002185.4 of IL7RA published at the National Centre for Biotechnology Information, and analyzed using SnapGene viewer software (GSL Biotech LLC, CA, USA).

RNA was extracted from PBMCs using TRIzol reagent (Sigma-Aldrich, MO, USA), and cDNA was synthesized using High-Capacity cDNA RT Kit (ThermoFisher Scientific). Exons 2-4 of IL7RA cDNA were amplified using TopTaq DNA Polymerase (Qiagen) with forward primer 5’GAGACTTGGAAGATGCAGAACTG3’ and reverse primer 5’TCCTGGCGGTAAGCTACATCG3’. The amplified cDNA bands were purified and subjected to Sanger sequencing.

PBMCs were labeled with 1µM carboxyfluorescein succinimidyl ester (CFSE; Sigma-Aldrich, MO, USA) and were either left unstimulated, or T cells were stimulated with 2µg/ml phytohemagglutinin (PHA; Sigma-Aldrich) or 100 ng/ml anti-CD3 antibody (OKT3; Biolegend). Five days later, samples were stained with antibodies against CD4 and CD8, and their proliferation was analyzed by flow cytometry.

Treg cell staining was performed using the FOXP3 staining kit from eBioscience (CA, USA) with antibodies against the surface markers CD4 and CD25, and the intracellular markers FOXP3, CTLA-4, and Helios. Cells were analyzed by flow cytometry.

The student’s t-test was used to compare the differences between groups using the GraphPad PRISM software (GraphPad Software, CA, USA).

The patient is born at term by normal vaginal delivery with no perinatal complications. She experienced recurrent upper respiratory tract infections since birth, oral thrush, bronchiolitis, and a rotavirus infection with concomitant jaundice, nausea, and vomiting for which she was hospitalized at 6 months of age. During her hospital admission, she was found to have a high reticulocyte count (18%), positive direct Coombs test, and she suffered from hemolytic anemia (hemoglobin levels 4.8 g/dl; normal range 10.8-12.6 g/dl (17)) for which she was transfused with packed red blood cells. Clinical immunophenotyping done at 7 months of age revealed decreased numbers of lymphocytes and CD3⁺, CD4⁺, and CD8⁺ T cells with normal numbers of B cells and elevated numbers of NK cells ( Table 1 ). Repeated immunophenotyping up to 12 months of age demonstrated persistent anemia and severely low numbers of T cells, decreased percentages of recent thymic emigrant (RTE; CD4⁺CD45RA⁺CD31⁺) and naïve CD4⁺ and CD8⁺ (CD45RA⁺) T cells with increased percentages of memory CD4⁺CD45RO⁺ and effector memory CD8⁺CD45RA^-CCR7^- T cells ( Table 1 ). In addition, her few peripheral CD4⁺ and CD8⁺ T cells failed to proliferate when stimulated with anti-CD3 and PHA as compared to control T cells ( Figures 1A, B ). She had elevated numbers of NK cells, however, around 50% of her NK cells were CD56^hi (not shown) indicating that they have a weak effector function (22). Her B cell numbers were normal; however, because her anemia was believed to be autoimmune in nature (AIHA), she was treated with rituximab at 8 months of age to deplete her B cells. She was also treated with antibiotics, steroids, and intravenous immunoglobulin.

The patient’s parents are first-degree cousins ( Figure 2A ), and her family history is notable for 4 cousins who died in infancy due to a suspected but undiagnosed immunodeficiency. Therefore, the patient’s clinical course and immune studies, as well as her family history, were all highly suggestive of a genetic disorder resulting in SCID with phenotypic and functional T cell defects.

To determine the genetic etiology of the patient’s immunodeficiency, a targeted gene panel approach was used to sequence 300 genes from her gDNA, which unveiled a novel homozygous missense variant in IL7RA. It was the substitution of guanine (G) by adenine (A) at position 379 (c.379G>A) in exon 3 of IL7RA, resulting in the change of valine (V) to isoleucine (I) at position 127 (p.V127I) of the protein ( Figure 2B ). This variant was not detected in healthy (gnomAD, Exome Variant Server, and Ensembl) and diseased (ClinVar) individuals’ databases and was predicted to be damaging by Sorting Intolerant from Tolerant (SIFT; 0.02), polyPhen-2 (0.993), and Combined Annotation Dependent Depletion (CADD; 33). Since mutations in IL7RA result in SCID (8, 14, 15), we concluded that this variant might be associated with her disease.

The homozygous c.379G>A variant was confirmed by Sanger sequencing in the patient, and here parents were heterozygous for the same variant ( Figure 2C ). Importantly, the variant severely affected IL-7Rα expression as only ~2.5% of the patient’s T cells expressed IL-7Rα as compared to ~74.0% of control T cells ( Figure 2D ). Around 73% and 67% of the mother’s and father’s T cells expressed IL-7Rα, respectively ( Figure 2D ), however, the level of expression was ~50% of that observed in several controls ( Figures 2E, F ), which is consistent with the heterozygous nature of the variant they harbor. These results demonstrate that the variant is a deleterious mutation as it abolished IL-7Rα protein expression in the patient, and reduced its expression by half in the parents.

Since G at position 379 is the terminal 3’ end nucleotide in exon 3 of IL7RA, substitution of G by A might influence the splice donor site of intron 3, affecting splicing of exons 3 to 4. To test this hypothesis, exons 2 to 4 of the IL7RA RNA/cDNA were amplified by RT-PCR, which resulted in the expected 433bp wild type band in the control, a smaller 275bp band in the patient, and a wild type and small bands in the parents ( Figure 3A ). Sequencing of the small band from the patient demonstrated aberrant splicing of exons 2-4 that bypasses exon 3, which resulted in alternative codon usage and the introduction of a TAA STOP codon a position 223-225 of the cDNA ( Figure 3B ), which terminates translation downstream of cysteine at position 74 of the protein (pC74*).

The patient underwent HSCT with myeloablative conditioning using her paternal grandmother, who shared a fully matched class I and II human leukocyte antigens (HLA), as donor. Pretransplant viral PCR for HIV, CMV, EBV, HHV6, HBV, HCV, parvovirus, adenovirus, HTLV, and toxoplasma were all negative. Pretransplant computerized tomography (CT) scan for the neck, chest, abdomen, and pelvis revealed hepatosplenomegaly.

For her conditioning she received 375 mg/m² rituximab on day -7, 40 mg/m²/dose fludarabine IV drip on days -5, -4, -3 and -2, and 1 mg/kg/dose busulfan every 6 hours on days -5, -4, -3 and -2. Infusion of 5.18 million CD34⁺ stem cells/kg was performed when she was 12 months old without major complications. To diminish the risk of graft vs host disease (GvHD), she received 15 mg/m² methotrexate on day 1, and 10 mg/m² on days 3 and 6 post-transplant, as well as Cyclosporine A as of day -1 until 8 months post-transplant.

She exhibited reticulocytosis and an exacerbation of her AIHA 5 and 7 months post-transplant when she developed upper respiratory tract infections due to COVID-19 and gastroenteritis, respectively, and received packed red blood cell transfusions and 2 doses of rituximab 1 week apart 5 months post-transplant alongside monthly intravenous immunoglobulin with the last dose given 13 months post-transplant. She was maintained on a prolonged course of steroids with very slow weaning until 13 months post-transplant. She achieved 96.0% total mixed chimerism (98.0% CD3 and 97.0% CD33) 30 days post-transplant, 54.4% total mixed chimerism (99.3% CD3 and 44.8% CD33) 100 days post-transplant, and 68.0% total mixed chimerism (97.9% CD3 and 19.6% CD33) 280 days post-transplant. Her hemoglobin level is currently stable at 10-11 g/dL and her reticulocytes numbers are low. She is receiving prophylactic trimethoprim-sulfamethoxazole, fluconazole, and valacyclovir.

Immunophenotyping done at 7, 9, 13, and 14 months post-transplant demonstrated a gradual increase in the numbers of lymphocytes, CD3⁺, CD4⁺, and CD8⁺ T cells to reach the normal range for age 13 months post-transplant ( Table 2 and Figure 4A ). In addition, the percentages of naïve T cells steadily increased with a concomitant decrease in the percentages of memory T cells. Importantly, the percentage of RTE cells increased 10-fold 13 months post-transplant indicating normal engraftment and development of T cells with normal thymic output ( Table 2 and Figure 4A ). The percentages of naïve and central memory CD8⁺ T cells were still below of range for age, but the percentage of effector memory CD8⁺ T cells was within the range for age, and that of T_EMRA CD8⁺ T cells was above the range for age, indicating that the patient might still be fighting active infections ( Table 2 and Figure 4A ). Her B cells were undetectable at 9 months post-transplant due to the rituximab treatment, but they emerged 13 months post-transplant and increased noticeably 1 month later with normal distribution of naïve and memory unswitched B cells but below the range for age of memory switched B cells ( Table 2 and Figure 4A ). Her NK cells were still diminished at 14 months post-transplant but are expected to increase as the treatment with steroids was stopped

Because of her AIHA, we determined the development and functional potential of her Treg cells. At 14 months post-transplant, the patient was found to have normal percentages of CD4⁺FOXP3⁺ Treg cells that expressed the effector molecules CD25, CTLA-4, and Helios ( Figure 4B ). Furthermore, ~60.1% of the patient’s T cells expressed IL-7Rα ( Figure 4C ), however, the level of IL-7Rα expression was ~50% of that observed in controls ( Figure 4D ). Importantly, the patient’s T cells proliferated effectively following stimulation with anti-CD3 and PHA, albeit to a lesser extent than that of control T cells ( Figure 4E ), which could be due to the lingering effect of the steroid treatment.