<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Immunol.</journal-id>
<journal-title>Frontiers in Immunology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Immunol.</abbrev-journal-title>
<issn pub-type="epub">1664-3224</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fimmu.2022.866073</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Immunology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Ethanol Induces Secretion of Proinflammatory Extracellular Vesicles That Inhibit Adult Hippocampal Neurogenesis Through G9a/GLP-Epigenetic Signaling</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Zou</surname>
<given-names>Jian</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Walter</surname>
<given-names>T. Jordan</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Barnett</surname>
<given-names>Alexandra</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1764776"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Rohlman</surname>
<given-names>Aaron</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Crews</surname>
<given-names>Fulton T.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/29589"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Coleman</surname>
<given-names>Leon G.</given-names>
<suffix>Jr</suffix>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1112755"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Bowles Center for Alcohol Studies, University of North Carolina at Chapel Hill School of Medicine</institution>, <addr-line>Chapel Hill, NC</addr-line>, <country>United States</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Department of Pharmacology, University of North Carolina at Chapel Hill School of Medicine</institution>, <addr-line>Chapel Hill, NC</addr-line>, <country>United States</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Department of Psychiatry, University of North Carolina at Chapel Hill School of Medicine</institution>, <addr-line>Chapel Hill, NC</addr-line>, <country>United States</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Samantha Yeligar, Emory University, United States</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Fabia Filipello, Washington University in St. Louis, United States; Angeles Vinuesa, Instituto de Biolog&#xed;a y Medicina Experimental (IBYME) (CONICET), Argentina</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Leon G. Coleman Jr., <email xlink:href="mailto:leon_coleman@med.unc.edu">leon_coleman@med.unc.edu</email>
</p>
</fn>
<fn fn-type="other" id="fn002">
<p>This article was submitted to Nutritional Immunology, a section of the journal Frontiers in Immunology</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>13</day>
<month>05</month>
<year>2022</year>
</pub-date>
<pub-date pub-type="collection">
<year>2022</year>
</pub-date>
<volume>13</volume>
<elocation-id>866073</elocation-id>
<history>
<date date-type="received">
<day>30</day>
<month>01</month>
<year>2022</year>
</date>
<date date-type="accepted">
<day>07</day>
<month>04</month>
<year>2022</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2022 Zou, Walter, Barnett, Rohlman, Crews and Coleman</copyright-statement>
<copyright-year>2022</copyright-year>
<copyright-holder>Zou, Walter, Barnett, Rohlman, Crews and Coleman</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>Adult hippocampal neurogenesis (AHN) is involved in learning and memory as well as regulation of mood. Binge ethanol reduces AHN, though the mechanism is unknown. Microglia in the neurogenic niche are important regulators of AHN, and ethanol promotes proinflammatory microglia activation. We recently reported that extracellular vesicles (EVs) mediate ethanol-induced inflammatory signaling in microglia. Therefore, we investigated the role of EVs in ethanol-induced loss of adult hippocampal neurogenesis. At rest, microglia promoted neurogenesis through the secretion of pro-neurogenic extracellular vesicles (pn-EVs). Depletion of microglia using colony-stimulating factor 1 receptor (CSFR1) inhibition <italic>in vivo</italic> or using <italic>ex vivo</italic> organotypic brain slice cultures (OBSCs) caused a 30% and 56% loss of neurogenesis in the dentate, respectively, as measured by immunohistochemistry for doublecortin (DCX). Likewise, chemogenetic inhibition of microglia using a CD68.hM4di construct caused a 77% loss in OBSC, indicating a pro-neurogenic resting microglial phenotype. EVs from control OBSC were pro-neurogenic (pn-EVs), enhancing neurogenesis when transferred to other naive OBSC and restoring neurogenesis in microglia-depleted cultures. Ethanol inhibited neurogenesis and caused secretion of proinflammatory EVs (EtOH-EVs). EtOH-EVs reduced hippocampal neurogenesis in na&#xef;ve OBSC by levels similar to ethanol. Neurogenesis involves complex regulation of chromatin structure that could involve EV signaling. Accordingly, EtOH-EVs were found to be enriched with mRNA for the euchromatin histone lysine methyltransferase (Ehm2t/G9a), an enzyme that reduces chromatin accessibility through histone-3 lysine-9 di-methylation (H3K9me2). EtOH-EVs induced G9a and H3K9me2 by 2-fold relative to pn-EVs in na&#xef;ve OBSCs. Pharmacological inhibition of G9a with either BIX-01294 or UNC0642 prevented loss of neurogenesis caused by both EtOH and EtOH-EVs. Thus, this work finds that proinflammatory EtOH-EVs promote the loss of adult hippocampal neurogenesis through G9a-mediated epigenetic modification of chromatin structure.</p>
</abstract>
<kwd-group>
<kwd>alcohol</kwd>
<kwd>inflammation</kwd>
<kwd>neurogenesis</kwd>
<kwd>microglia</kwd>
<kwd>epigenetics</kwd>
<kwd>G9a</kwd>
</kwd-group>
<contract-num rid="cn001">AA024829, AA028924, AA028599, AA020024</contract-num>
<contract-sponsor id="cn001">National Institute on Alcohol Abuse and Alcoholism<named-content content-type="fundref-id">10.13039/100000027</named-content>
</contract-sponsor>
<counts>
<fig-count count="7"/>
<table-count count="0"/>
<equation-count count="0"/>
<ref-count count="76"/>
<page-count count="14"/>
<word-count count="7743"/>
</counts>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<title>1 Introduction</title>
<p>Heavy alcohol use and alcohol use disorder (AUD) are significant causes of morbidity worldwide. Chronic alcohol (i.e., ethanol) abuse causes dysfunction of key behaviors that contribute to ongoing misuse and age-related functional decline such as depressed mood, cognitive decline, and deficits in learning and memory plasticity. Adult hippocampal neurogenesis (AHN) occurs in the dentate gyrus and plays an important role in each of these functions (<xref ref-type="bibr" rid="B1">1</xref>&#x2013;<xref ref-type="bibr" rid="B3">3</xref>). Chronic binge alcohol intake causes a loss of AHN with corresponding behavioral deficits (<xref ref-type="bibr" rid="B4">4</xref>&#x2013;<xref ref-type="bibr" rid="B8">8</xref>). However, the underlying cause of the ethanol-induced loss of AHN is unknown.</p>
<p>AHN requires cooperation of multiple cell types and epigenetic regulation of specific transcriptomic cassettes (<xref ref-type="bibr" rid="B9">9</xref>&#x2013;<xref ref-type="bibr" rid="B12">12</xref>). Proinflammatory activation of microglia, the resident monocyte/macrophage in brain, blunts AHN in infection or stress models (<xref ref-type="bibr" rid="B13">13</xref>&#x2013;<xref ref-type="bibr" rid="B17">17</xref>). However, recently, resting microglia have been found to promote AHN through their secretome (<xref ref-type="bibr" rid="B18">18</xref>&#x2013;<xref ref-type="bibr" rid="B20">20</xref>). Therefore, insults that modulate microglial activation state can regulate neurogenesis. Binge levels of ethanol promote proinflammatory microglial activation (<xref ref-type="bibr" rid="B21">21</xref>&#x2013;<xref ref-type="bibr" rid="B23">23</xref>). Interventions that reduce induction of proinflammatory cytokines in brain, such as indomethacin and exercise, protect against ethanol inhibition of AHN (<xref ref-type="bibr" rid="B24">24</xref>). Therefore, we hypothesized that loss of AHN caused by ethanol involves secretion of anti-neurogenic factors from proinflammatory microglia. However, it is unknown how secreted factors from microglia alter transcriptional profiles in neuro-progenitors, to result in loss of AHN. In both embryonic and adult stages, epigenetic modifications of histone chromatin structure (e.g., acetylation and methylation) regulate neurogenesis (<xref ref-type="bibr" rid="B10">10</xref>&#x2013;<xref ref-type="bibr" rid="B12">12</xref>, <xref ref-type="bibr" rid="B25">25</xref>&#x2013;<xref ref-type="bibr" rid="B28">28</xref>). Several enzymes are capable of remodeling chromatin structure. Several enzymes are capable of remodeling chromatin structure. We focused on the euchromatin histone-methyl transferase (EHMT2/G9a) since it has been implicated in facilitating changes in neuronal phenotype in response to ethanol (<xref ref-type="bibr" rid="B29">29</xref>, <xref ref-type="bibr" rid="B30">30</xref>). G9a forms an enzymatic complex with a highly homologous protein G9a-like protein (GLP) to promote monomethylation and dimethylation of the histone 3 lysine 9 locus (H3K9me and H3K9me2 respectively), to play key roles in neurodevelopment (<xref ref-type="bibr" rid="B12">12</xref>). G9a is increased by ethanol, and alters neuron-specific genes in the basal forebrain (<xref ref-type="bibr" rid="B29">29</xref>, <xref ref-type="bibr" rid="B30">30</xref>). Further, H3K9 methylation status is thought to regulate to neural cell proliferation (<xref ref-type="bibr" rid="B28">28</xref>). Therefore, we hypothesized that the regulation of AHN by ethanol and microglia involves secretion of EVs capable of regulating G9a/GLP-mediated epigenetic modifications of chromatin structure.</p>
<p>We recently reported that ethanol induction of proinflammatory signaling in brain involves the secretion of extracellular vesicles (EVs) from microglia (<xref ref-type="bibr" rid="B31">31</xref>). EVs are small, lipid-bilayer particles released from virtually all cell types that can affect the function of target cells (<xref ref-type="bibr" rid="B32">32</xref>). These proinflammatory EtOH-EVs were produced by microglia and reproduced the induction of proinflammatory cytokines caused by ethanol, and blocking their secretion prevented cytokine induction caused by ethanol. EVs have emerged as key mediators of disease pathology across organ systems (<xref ref-type="bibr" rid="B32">32</xref>&#x2013;<xref ref-type="bibr" rid="B34">34</xref>). EVs facilitate the transfer of diverse cargo (i.e., protein, lipid, mRNA, miRNA, lncRNA, DNA) to target cells and/or elicit responses through interaction with cell surface receptors. EVs may cause epigenetic modifications to chromatin and DNA (<xref ref-type="bibr" rid="B35">35</xref>). In the context of ethanol exposure, EVs may participate in mediating transgenerational epigenetic inheritance (<xref ref-type="bibr" rid="B36">36</xref>) and regulating fetal neural stem cell development (<xref ref-type="bibr" rid="B37">37</xref>). Therefore, we hypothesized that proinflammatory EVs secreted in response to ethanol regulate AHN through epigenetic mechanisms. To study mechanisms regulating AHN we used both <italic>in vivo</italic> and <italic>ex vivo</italic> primary organotypic brain slice (OBSC) experiments. OBSC has all the brain cellular components and extracellular matrix of the adult hippocampal neurogenic niche and matures <italic>ex vivo</italic> to a neurological phenotype consistent with young adulthood with mature synapses and ongoing AHN (<xref ref-type="bibr" rid="B38">38</xref>&#x2013;<xref ref-type="bibr" rid="B42">42</xref>). The use of OBSCs allows for EV transfer experiments to specifically identify the role of EVs. We found that resting microglia promote AHN through the secretion of pro-neurogenic (pn) EVs. EVs secreted by ethanol (EtOH-EVs) were proinflammatory and blunted AHN through a euchromatic histone-methyl transferase (EHMT2/G9a) epigenetic mechanism.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<title>2 Materials and Methods</title>
<sec id="s2_1">
<title>2.1 Animals</title>
<p>Adult C57BL/6 mice were obtained from Jackson Laboratory. Pregnant Sprague Dawley rat mothers from Charles River (Raleigh, NC, USA) were used for all slice culture preparation. All protocols followed in this study were approved by the Institutional Animal Care and Use Committee at the University of North Carolina at Chapel Hill (protocols 20-231.0 and 21-224.0) and were in accordance with National Institutes of Health regulations for the care and use of animals in research.</p>
</sec>
<sec id="s2_2">
<title>2.2 Materials</title>
<p>The CSF1R inhibitor PLX-3397 was obtained from MCE (Monmouth Junction, NJ, USA). PLX-5622 was provided by Plexxikon (Berkeley, CA, USA). Antibodies were purchased from the following vendors: DCX (Santa Cruz, sc-271390, USA), Ki67 (abcam, ab16667, Boston, USA), G9a (abcam, ab185050, Boston, USA), H3K9me (abcam, ab32521, Boston, MA, USA), beta actin (abcam, ab8229). The G9a inhibitor BIX-01294 was purchased from Selleckchem (Houston, TX, USA) and UNC0642 is from Santa Cruz (Santa Cruz, CA, USA).</p>
</sec>
<sec id="s2_3">
<title>2.3 Microglial Depletion <italic>In Vivo</italic>
</title>
<p>Microglia were depleted brain-wide using the colony stimulating factor 1 receptor (CSF1R) antagonist PLX-5622 supplemented in chow (1200 ppm) as described previously (<xref ref-type="bibr" rid="B43">43</xref>). Briefly, mice were given PLX-supplemented or normal chow for three weeks. Mice were sacrificed by intracardial perfusion with paraformaldehyde, and brains processed for immunohistochemistry (IHC) as we have reported previously (<xref ref-type="bibr" rid="B43">43</xref>, <xref ref-type="bibr" rid="B44">44</xref>).</p>
</sec>
<sec id="s2_4">
<title>2.4 Primary Organotypic Brain Slice Culture (OBSC)</title>
<p>Primary organotypic brain slice cultures (OBSCs) were prepared from the hippocampal-entorhinal cortex formation of postnatal day (P)7 pups using previously established techniques of Stoppini and colleagues (<xref ref-type="bibr" rid="B45">45</xref>) with modifications as we have described previously (<xref ref-type="bibr" rid="B31">31</xref>, <xref ref-type="bibr" rid="B46">46</xref>, <xref ref-type="bibr" rid="B47">47</xref>). Briefly, a Sprague Dawley rat mother with a litter of 12 pups on P6 were obtained from Charles River (Raleigh, NC, USA) and housed overnight in the animal facility. All neonates at P7 were decapitated, the brains were removed, and hippocampal-entorhinal complex dissected in Gey&#x2019;s buffer (Sigma-Aldrich, St. Louis, MO, USA). Slices (~25/pup) were transversely cut with a McIlwain tissue chopper at a thickness of 375 &#xb5;m and placed onto a 30 mm diameter Millicell low height culture insert (Millipore, PICMORG50), 10-13 slices/tissue insert. Slices from both sexes were pooled together. Slices were cultured with MEM containing 25 mM HEPES and Hank&#x2019;s salts, supplemented with 25% horse serum (HS) + 5.5 g/L glucose + 2 mM L-glutamine in a humidified 5% CO2 incubator at 36.5&#xb0;C for 7 days <italic>in vitro</italic> (DIV), followed by 4DIV in MEM + 12% HS, and then slices were cultured with MEM + 6% HS until the end of experiments. Two replicates were performed for each experimental condition, with each experiment repeated at least twice. Serum-free N2-supplemented MEM was used to mix with MEM containing 25% HS throughout experiments. OBSC slices were incubated for a total of 14 days prior to treatment as described by Stoppini et&#xa0;al. to allow for functional maturation of synapses (<xref ref-type="bibr" rid="B45">45</xref>). OBSC slices are long-lived with undetectable cell death up to 42 days in culture in our previous report (<xref ref-type="bibr" rid="B21">21</xref>).</p>
<p>For transfection of the hM4di DREADD in microglia, OBSCs were treated with either control AAV9.EGFP or AAV9.CD68.hm4Di.mCherry (VectorBuilder) for 24 h prior to administration of the hM4di agonist CNO for 4 days.</p>
</sec>
<sec id="s2_5">
<title>2.5 Microglial Depletion in OBSC</title>
<p>For microglial depletion in OBSC, slices at 4DIV were treated with the CSF1R inhibitor PLX-3397 (1&#xb5;M), chosen for solubility in media, for 7 days in regular culture medium (MEM containing 25% HS), followed by 3DIV in MEM + 12% HS to deplete microglia. We used 1&#xb5;M PLX-3397 since we have previously reported that this successfully depletes &gt;90% of microglia in our <italic>ex vivo</italic> slice culture model (<xref ref-type="bibr" rid="B21">21</xref>). At the end of PLX3397 treatment, slices were either immediately removed for analysis or followed by microglial repopulation protocol in MEM + 6%HS without PLX-3397 (<xref ref-type="bibr" rid="B21">21</xref>).</p>
</sec>
<sec id="s2_6">
<title>2.6 Immunohistochemistry (IHC) and Quantification <italic>In Vivo</italic> and in OBSC</title>
<sec id="s2_6_1">
<title>2.6.1 <italic>In Vivo</italic>:</title>
<p>IHC was performed on PFA-perfused mice as we have reported previously (<xref ref-type="bibr" rid="B43">43</xref>). Briefly, perfused brains were dehydrated in 30% sucrose. Brains were then sliced at 40&#xb5;M thickness using a freezing microtome. Free-floating sections were washed in 0.1M PBS, endogenous peroxidases neutralized by incubation in 0.3% H<sub>2</sub>O<sub>2</sub> for 30 min, washed again in PBS, and permeabilized and blocked for 1 h in 0.25% Triton-X100/5% normal serum at room temperature (RT). Sections were then incubated overnight at 4&#xb0;C in primary antibody in blocking solution. The next day sections were washed in PBS and incubated in biotinylated secondary antibody (1:200; Vector Laboratories, Burlingame, CA, USA) for 1 h at RT. After washes sections were incubated in avidin&#x2013;biotin complex solution (Vectastain ABC Kit, Vector Laboratories, Burlingame, CA, Cat. # PK6100) for 1 h at RT. Immunoreactivity was visualized using nickel-enhanced diaminobenzidine (Sigma-Aldrich, St. Louis, MO, USA, Cat. # D5637). Tissue was mounted onto slides, dehydrated, and coverslips placed. At least three sections per mouse were quantified for immunoreactivity (+IR)</p>
</sec>
<sec id="s2_6_2">
<title>2.6.2 <italic>OBSC:</italic>
</title>
<p>At the end of each experiment, OBSC slices were quickly washed in cold PBS and fixed with 4% paraformaldehyde in 0.1M PBS for 24 h at 4&#xb0;C. Floating OBSC slices were washed with PBS and incubated with 0.6% H<sub>2</sub>O<sub>2</sub> to inhibit endogenous peroxidase. After further washing with PBS, slices were blocked with 3% rabbit serum containing 0.25% Triton X100 for 1 h at RT and then incubated with mouse anti-DCX or anti-H3K9me2 for 48 h at 4&#xb0;C. DCX+IR was detected using an ABC kit and followed by the DAB method. For quantification of DCX IR, DCX+ cell and processes in DG region of the hippocampus were imaged live at 8x magnification, background corrected, and DCX IR measured with the Keynce BZ-H4XF imaging software (<italic>in vivo</italic>) or ImageJ (OBSC).</p>
</sec>
</sec>
<sec id="s2_7">
<title>2.7 EV Isolation and Assessment by Nanoparticle Tracking Analysis and Transmission Electron Microscopy (TEM)</title>
<sec id="s2_7_1">
<title>2.7.1 EV Isolation:</title>
<p>EVs were isolated by sequential centrifugation from OBSC media as we have reported previously (<xref ref-type="bibr" rid="B31">31</xref>, <xref ref-type="bibr" rid="B48">48</xref>). Briefly, media were centrifuged at 300 g for 10 min and followed by 6000g for 10 min to remove cellular debris. The supernatant was then centrifuged at 21,000g for 96 min at 4&#xb0;C to pellet EVs. This method isolates primarily microvesicles (MVs, 0.05-1.0&#xb5;m diameter) and larger exosomes (0.05-0.1&#xb5;m diameter) (<xref ref-type="bibr" rid="B32">32</xref>). EVs were resuspended in fresh MEM media.</p>
</sec>
<sec id="s2_7_2">
<title>2.7.2 <italic>TEM Negative Stain</italic>:</title>
<p>EVs were visualized by negative-stain transmission electron microscopy (TEM) in the UNC Microscopy Services Laboratory. Briefly, this involved floating a glow-discharged formvar/carbon-coated 400 mesh copper grid (Ted Pella, Inc., Redding, CA, USA) on a 20&#x3bc;l droplet of the sample suspension for 12 min. This was transferred quickly to 2 drops of deionized water followed by addition of a droplet of 2% aqueous uranyl acetate stain for 1 minute. The grid was blotted with filter paper and airdried. Samples were then visualized at 80kV using a JEOL JEM-1230 transmission electron microscope operating (JEOL USA INC., Peabody, MA, USA). Images were taken using a Gatan Orius SC1000 CCD camera with Gatan Microscopy Suite version 3.10.1002.0 software (Gatan, Inc., Pleasanton, CA, USA).</p>
</sec>
<sec id="s2_7_3">
<title>2.7.3 <italic>Nanoparticle Tracking Analysis (NTA)</italic>:</title>
<p>Media samples were diluted in 0.02 &#xb5;m filtered PBS and assessed by NTA on the ParticleMetrix ZetaView<sup>&#xae;</sup> PMX-420 Video Microscope in the Nanomedicines Characterization Core Facility at UNC as we have reported previously (<xref ref-type="bibr" rid="B31">31</xref>, <xref ref-type="bibr" rid="B49">49</xref>&#x2013;<xref ref-type="bibr" rid="B51">51</xref>).</p>
</sec>
</sec>
<sec id="s2_8">
<title>2.8 Ethanol Treatment and Conditioned EV Transfers in OBSC</title>
<p>All ethanol treatments with the indicated concentrations occurred in a desiccator containing 300ml water plus ethanol at the same concentration present in the culture media as we have reported previously (<xref ref-type="bibr" rid="B31">31</xref>, <xref ref-type="bibr" rid="B52">52</xref>, <xref ref-type="bibr" rid="B53">53</xref>). OBSC slices at 14DIV were exposed to ethanol (100mM) for 4 days in the absence or presence of G9a inhibitor BIX-01294. We have previously found this concentration <italic>ex vivo</italic> causes induction of immune genes that is similar to findings <italic>in vivo</italic> and in postmortem human AUD brain (<xref ref-type="bibr" rid="B48">48</xref>, <xref ref-type="bibr" rid="B53">53</xref>). Though this is a high concentration of alcohol for non-dependent individuals, patients with AUD reach these blood alcohol concentrations while being conscious and functional (<xref ref-type="bibr" rid="B54">54</xref>). At the end of experiments, slices were removed for further analysis.</p>
<p>For conditioned EV transfer experiments, pelleted EVs from control or ethanol-treated groups were resuspended in MEM + 6% horse serum. This media and serum concentration has been optimized in our previous studies for the assessment of neurogenesis in the OBSC (<xref ref-type="bibr" rid="B42">42</xref>). To account for potential effects of EVs in the media, all experiments include unconditioned media controls as recommended by the International Society for Extracellular Vesicles (ISEV) guidelines in situations when the use of exosome-depleted media is not desirable (<xref ref-type="bibr" rid="B55">55</xref>). We also perform EV supernatant controls (described below). We have reported that this technique recovers ~30% of total media MVs, thus a ratio of EVs pelleted from 2 slice culture wells to 1 new slice culture well is transferred (<xref ref-type="bibr" rid="B31">31</xref>). EVs were isolated from 1 mL of culture media. Each culture well had 10-13 hippocampal slices (300&#xb5;m thickness). 1.4x10<sup>10</sup> EVs were added to each recipient culture which is ~20% of the total slice media EVs at baseline, similar to our previous studies (<xref ref-type="bibr" rid="B31">31</xref>, <xref ref-type="bibr" rid="B49">49</xref>, <xref ref-type="bibr" rid="B50">50</xref>). At the end of EV treatment, slices were removed for either mRNA analysis by RT-PCR or immunostaining for measurement of neurogenesis. To determine if remaining proteins in the EV preparations mediate the effects of EVs two methods were employed. First, supernatant (SUPN) from the final spin of EV isolation was transferred to na&#xef;ve OBSC as we had done previously (<xref ref-type="bibr" rid="B31">31</xref>) to determine if soluble components in media mediate the effects as recommended by the ISEV guidelines (<xref ref-type="bibr" rid="B55">55</xref>). Briefly, SUPN from the final spin was diluted 1:1 with fresh media to ensure adequate nutrition and was then added to naive OBSC. Further, we also performed digestion of remaining proteins in the EV preparation using proteinase K as described previously (<xref ref-type="bibr" rid="B56">56</xref>). Briefly, pelleted EVs were resuspended in PBS and incubated with 20&#xb5;g/mL of Proteinase K (Prot K, Invitrogen) at 37&#xb0;C for 1 hour. Prot K activity was quenched by adding 5mM phenylmethylsulfonyl fluoride (10 min at RT). EVs were then re-pelleted (21,000g, 96 minutes) and resuspended in fresh MEM, then added to na&#xef;ve OBSC.</p>
</sec>
<sec id="s2_9">
<title>2.9 Measurement of mRNAs and Protein in EVs and OBSC Tissue</title>
<sec id="s2_9_1">
<title>2.9.1 RNA Isolation <italic>and Reverse Transcription</italic>:</title>
<p>Total RNA was isolated either from the pelleted EVs or OBSC slice tissue using miRNAeasy Kit (Qiagen Inc., CA, USA) according to manufacturer&#x2019;s protocol. Briefly, the pelleted EVs from 2-3 culture media or 10-13 pooled tissue slices/per group were dissolved in total of 700ul Trizol lysis buffer as we have previously reported (<xref ref-type="bibr" rid="B21">21</xref>, <xref ref-type="bibr" rid="B31">31</xref>). After centrifugation at 12,000g for 15 min, supernatant was removed for total RNA purification. The total amount of RNA was quantified by Nanodrop&#x2122;. For reverse transcription, either 200ng of RNA from EVs or 2 &#x3bc;g of RNA from slices was used to synthesize the first strand of cDNA using random primers (Invitrogen) and reverse transcriptase Moloney murine leukemia virus (Invitrogen). After a 1:2 dilution with water, 2 &#x3bc;l of the first strand cDNA solution was used for RT-PCR.</p>
</sec>
<sec id="s2_9_2">
<title>2.9.2 <italic>RT-PCR</italic>:</title>
<p>The primer sequences for real time RT-PCR were as follows: TNF&#x3b1;-F: AGCCCTGGTATGAGCCCATGTA, R:CCGGACTCCGTGATGTCTAAG; IL-1&#x3b2;-F:TTGTGCAAG TGTCTGAAGCA, R: TGTCAGCCTCAAAGAACAGG; G9a-F:CTCCGGTCCCTTGTCTCC, R:CT ATGAGAGGTGTCCCCCAA; &#x3b2;-Actin-F:CTACAATGAGCTGCGTGTGGC, R: CAGGTCCAGAC GCAGGATGGC; 18S-F: CGGGGAATCAGGGTTCGATT, R:TCGGGAGTGGGTAATTTGCG. Primer sequences were validated using the NCBI Primer-BLAST, with only primers that targeted the desired mRNA and had single-peak melt curves (showing amplification of a single product) being used. SYBER Green Supermix (AB system, UK) was used as a RT-PCR solution. The real time RT-PCR was run with initial activation for 10 min at 95&#xb0;C and followed by either 48 cycles (EV mRNA) or 40 cycles (tissue mRNA) of denaturation (95&#xb0;C, 40 s), annealing (58&#xb0;C, 45 s) and extension (72&#xb0;C, 40 s). The threshold cycle (<italic>C</italic>
<sub>T</sub>) of each target product was determined and normalized to a reference housekeeping gene. For all analyses in OBSC tissue, &#x3b2;-actin was used as the housekeeping gene. For measurement of mRNAs in EVs, 18S was used as the housekeeping gene since actin mRNA was not detected in the vesicles. Difference in <italic>C</italic>
<sub>T</sub> values (&#x394;<italic>C</italic>
<sub>T</sub>) of two genes was calculated <inline-formula>
<mml:math display="inline" id="im1">
<mml:mrow>
<mml:mo stretchy="false">[</mml:mo>
<mml:mtext>difference</mml:mtext>
<mml:mo>=</mml:mo>
<mml:msup>
<mml:mn>2</mml:mn>
<mml:mrow>
<mml:mo>&#x2212;</mml:mo>
<mml:msubsup>
<mml:mo stretchy="false">(</mml:mo>
<mml:mtext>T</mml:mtext>
<mml:mi>C</mml:mi>
</mml:msubsup>
<mml:mi mathvariant="normal">&#x2009;</mml:mi>
<mml:mi mathvariant="normal">o</mml:mi>
<mml:mi mathvariant="normal">f</mml:mi>
<mml:mi mathvariant="normal">&#x2009;</mml:mi>
<mml:mtext>target&#x2009;enes</mml:mtext>
<mml:mo>&#x2212;</mml:mo>
<mml:msubsup>
<mml:mi mathvariant="normal">&#x2009;</mml:mi>
<mml:mtext>T</mml:mtext>
<mml:mi>C</mml:mi>
</mml:msubsup>
<mml:mtext>&#x2009;of&#x2009;</mml:mtext>
<mml:mi>&#x3b2;</mml:mi>
<mml:mo>-</mml:mo>
<mml:mtext>actin</mml:mtext>
<mml:mo stretchy="false">)</mml:mo>
</mml:mrow>
</mml:msup>
<mml:mtext>&#x2009;</mml:mtext>
<mml:mo>=</mml:mo>
<mml:msubsup>
<mml:mn>2</mml:mn>
<mml:mtext>T</mml:mtext>
<mml:mrow>
<mml:mo>&#x2212;</mml:mo>
<mml:mi>&#x394;</mml:mi>
<mml:mi>C</mml:mi>
</mml:mrow>
</mml:msubsup>
</mml:mrow>
</mml:math>
</inline-formula> and the result was expressed as the percentage compared to control.</p>
</sec>
<sec id="s2_9_3">
<title>2.9.3 <italic>Western Blot</italic>:</title>
<p>OBSC sections (4-6) were pooled and lysed with Tris buffer and centrifuged at 21,000g to remove the nuclear fraction as we previously reported (<xref ref-type="bibr" rid="B48">48</xref>). Protein concentrations were measured using a Pierce BCA assay kit with the manufacturer&#x2019;s instructions (ThermoFisher Scientific). Samples were diluted in RIPA and DTT containing reducing buffer (Pierce TM Cat. # 39000) to a final amount of 40 &#x3bc;g protein per well. Protein samples were separated on a 4&#x2013;15% Ready Gel Tris-HCL gel (BioRad) and transferred onto PVDF membranes (BioRad). PVDF membranes were incubated at 4&#xb0;C overnight with primary antibody. The following day, secondary antibody incubation (Li-Cor IRDye<sup>&#xae;</sup> 680 or 800) was performed, and membranes visualized using the LiCor Odyssey&#x2122; imaging system. Values for proteins of interest were normalized to beta-actin expression for each sample.</p>
</sec>
</sec>
<sec id="s2_10">
<title>2.10 Statistical Analyses</title>
<p>For experiments when only two groups were compared, <italic>t</italic>-tests were performed. Statistical analyses for experiments with multiple treatment groups were performed using One-way ANOVAs, with Sidak&#x2019;s <italic>post hoc</italic> tests for multiple comparisons. Differences were considered statistically significant if <italic>p</italic> &lt; 0.05.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<title>3 Results</title>
<sec id="s3_1">
<title>3.1 Microglia Promote Neurogenesis Through the Secretion of Pro-Neurogenic Extracellular Vesicles (pn-EVs)</title>
<p>Microglia have been found to promote adult hippocampal neurogenesis through their secretome (<xref ref-type="bibr" rid="B18">18</xref>&#x2013;<xref ref-type="bibr" rid="B20">20</xref>). EVs are a key aspect of the microglial secretome (<xref ref-type="bibr" rid="B31">31</xref>); therefore we assessed their role in neurogenesis. First, we determined the impact of microglial depletion on neurogenesis both <italic>in vivo</italic> and <italic>ex vivo</italic>. Microglia were depleted using the CSF1R antagonist PLX-5622 as reported previously (<xref ref-type="bibr" rid="B43">43</xref>). PLX5622 effectively removed Iba1+ microglia in the hippocampus with ~96% depletion of microglia (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1A, B</bold>
</xref>). We then assessed hippocampal neurogenesis in the dentate gyrus using immunohistochemistry (IHC) for doublecortin (DCX). DCX is a cytoskeleton marker of neuroprogenitors expressed during maturation of dendrites and other neuronal structures. DCX was reduced by 30% in microglia-depleted mice (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1C, D</bold>
</xref>, *<italic>p&lt;</italic>0.05). Likewise, a 24% reduction in Ki67, a marker of proliferation, was found (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1E, F</bold>
</xref>). The role of microglia in neurogenesis was then assessed in OBSC, where PLX depletion of microglia caused a 56% reduction in DCX in the dentate gyrus (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1G, H</bold>
</xref>). To confirm that the loss of microglial activity underlies the loss of neurogenesis rather than factors released by dying microglia or off-target effects of CSF1R-inhibition, we next inhibited microglial activation using a chemogenetic approach. Microglial activity was inhibited by transfection with the hM4di inhibitory designer receptor exclusively activated by designer drugs (DREADD) using a viral construct (AAV9.CD68.hm4di) as we have reported previously (<xref ref-type="bibr" rid="B21">21</xref>). In the presence of microglial hM4di expression, a significant treatment effect across groups was found (ANOVA F<sub>5,61 </sub>= 7.148, ****<italic>p&lt;</italic>0.0001) with the hM4di agonist CNO causing a 77% reduction in neurogenesis in the dentate gyrus as measured by DCX staining (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1I, J</bold>
</xref>, ***<italic>p&lt;</italic>0.001, Sidak&#x2019;s post-test). Neither hM4di transfection alone nor CNO alone significantly altered neurogenesis. Thus, microglia in healthy mouse dentate gyrus and OBSC brain slice culture promote hippocampal neurogenesis both <italic>in vivo</italic> and <italic>ex vivo</italic>. Since the microglial secretome has been implicated in hippocampal neuroprogenitor survival, we next studied the role of secreted extracellular vesicles.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Microglia at rest promote adult hippocampal neurogenesis. <bold>(A-F)</bold> Adult mice were given either normal or PLX-5622-supplemented chow for 3 weeks to deplete microglia. <bold>(A)</bold> PLX chow caused robust depletion of microglia as measured by Iba-1 IHC. <bold>(B)</bold> Quantification of Iba-1 staining in hippocampus found ~96% depletion of microglia. ****<italic>p &lt; </italic> 0.0001, <italic>t-</italic>test vs. control. Scale bar: 500&#xb5;m <bold>(C)</bold> Representative images of DCX staining in hippocampal dentate gyrus showing loss of neurogenesis with microglial depletion. Scale bar 100 &#xb5;m. <bold>(D)</bold> Quantification found a ~30% reduction in DCX immunoreactivity. *<italic>p &lt; </italic> 0.05, <italic>t-</italic>test vs. control. <bold>(E)</bold> Representative images of ki67 immunostaining after EtOH in dentate regions of the hippocampus in control and microglia depleted (PLX) mice. <bold>(F)</bold> Ethanol caused a 24% reduction in ki67. *<italic>p &lt; </italic>0.05, <italic>t-</italic>test. <bold>(G, H)</bold> OBSC were treated with PLX-3397 (1&#xb5;M) for 10 days to deplete microglia and determine its effect on neurogenesis. <bold>(G)</bold> Representative images of DCX in hippocampal region of OBSC showing loss of neurogenesis with microglial depletion. Scale bar: 100&#xb5;m. <bold>(H)</bold> Quantification found a 56% reduction in DCX staining with microglial depletion. **<italic>p &lt; </italic>0.01, <italic>t-</italic>test vs. control. <bold>(I, J)</bold> Microglial inhibition reduces neurogenesis. OBSC were treated with either AAV9.CD68.hM4di or AAV9.EGFP control for 24 hours prior to treatment with CNO (1&#xb5;M or 5&#xb5;M) or vehicle for 4 days, followed by IHC for DCX. <bold>(I)</bold> Quantification of DCX found that neither viral transfection alone nor CNO alone significantly altered neurogenesis. Addition of CNO to microglial hM4di-transfected slices caused a 77% reduction in DCX with 5&#xb5;M CNO. 1-Way ANOVA, F<sub>5,61 </sub>= 7.148, <italic>p&lt; </italic> 0.0001. ***<italic>p &lt;</italic> 0.001, Sidak&#x2019;s <italic>post-hoc</italic> test vs. AAV9.CD68.hM4di alone <bold>(J)</bold> Representative images of DCX +/- CNO and AAV9 transfection. Scale bar: 100&#xb5;m.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-866073-g001.tif"/>
</fig>
<p>To determine the effect of OBSC EVs on neurogenesis, we used EV transfer experiments using our previously established protocols (<xref ref-type="bibr" rid="B31">31</xref>). EVs were transferred from either normal or microglia-depleted OBSC donors to either normal (microglia +) or microglia-depleted OBSC recipient cultures (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>). A significant treatment effect was found across the groups (F<sub>5,39</sub> = 9.705, <italic>p&lt;</italic>0.0001). As above, microglial depletion with PLX alone caused a robust reduction in neurogenesis as measured by DCX (62%, <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2C</bold>
</xref>, *<italic>p&lt;</italic>0.05 vs. Control, Sidak&#x2019;s post-test) that was clearly visible (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2D</bold>
</xref>, top panel). EVs transferred from normal microglia-containing cultures were pro-neurogenic (pn-EVs), increasing levels of neurogenesis in normal slices by 56% (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2C, D</bold>
</xref> middle panel, *<italic>p&lt;</italic>0.05 vs. Control, Sidak&#x2019;s post-test). pn-EVs also increased the expression of the pro-neurogeneic cytokine IL-4 (<xref ref-type="bibr" rid="B57">57</xref>). IL-4 was increased by 82% (<xref ref-type="supplementary-material" rid="SF1">
<bold>Supplementary Figure&#xa0;1A</bold>
</xref>, *<italic>p&lt;</italic>0.05, Sidak&#x2019;s post-test). Further, pn-EVs restored the loss of DCX in PLX microglia-depleted slices, increasing DCX by 290% relative to vehicle PLX slices (***<italic>p=</italic>0.001, vs. PLX alone, Sidak&#x2019;s post-test) EVs isolated from microglia-depleted-cultures, however (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2C, D</bold>
</xref> lower panel), did not increase DCX in neither control (<italic>p=</italic>0.43 vs. control alone) nor microglia-depleted (<italic>p=</italic>0.78, vs. PLX alone) recipient OBSCs. This indicates that microglial EVs at baseline promote neurogenesis through the generation of pn-EVs.</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>EVs from microglia-containing cultures are pro-neurogenic. <bold>(A)</bold> Experimental design for EV transfer experiments from normal microglia-containing and PLX microglia-depleted OBSCs. EVs from each donor condition were transferred to either microglia-containing (Control) or microglia-depleted (PLX) OBSC recipients. <bold>(B)</bold> Western blot analysis shows expression of EV markers Annexin A1, CD63 and CD81 in pn-EVs and PLX-EVs. <bold>(C)</bold> Quantification of treatment effect on DCX immunostaining (One-way ANOVA, F<sub>5,39</sub> = 9.705, <italic>p &lt; </italic>0.0001). Microglial depletion with PLX-3397 (1&#xb5;M, 10 days) caused a 62% reduction in DCX in the dentate region of the OBSC (*<italic>p &lt; </italic>0.05 vs. control, Sidak&#x2019;s post-test). EVs from control OBSC (pn-EVs) increased basal levels of DCX by 55% (gray bar with dots, *<italic>p &lt; </italic>0.05 vs. Control, Sidak&#x2019;s post-test) and increased DCX in microglia-depleted recipient OBSCs by 290% (white bar with dots, ***<italic>p &lt; </italic>0.001 vs. PLX alone, Sidak&#x2019;s post-test). EVs from microglia-depleted OBSC donors (PLX-EVs), however, did not significantly change DCX levels in control (<italic>p=</italic>0.43 vs. control alone, Sidak&#x2019;s post-test) or microglia-depleted OBSC slices (<italic>p=</italic>0.78, vs. PLX alone, Sidak&#x2019;s post-test) N for each group is included within each bar. <bold>(D)</bold> Representative images of DCX IHC in OBSC treatment groups. Scale bar 100 &#xb5;m.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-866073-g002.tif"/>
</fig>
</sec>
<sec id="s3_2">
<title>3.2 Ethanol Induces Secretion of Proinflammatory EVs (EtOH-EVs) That Inhibit Hippocampal Neurogenesis</title>
<p>We recently reported that EVs play a key role in proinflammatory induction caused by ethanol, reproducing the effects of ethanol treatment (<xref ref-type="bibr" rid="B31">31</xref>). Though EtOH did not increase the number of EVs released as measured by nanoparticle tracking analysis, it altered EV contents and function (<xref ref-type="bibr" rid="B31">31</xref>). Proinflammatory stimuli such as binge ethanol are known to blunt neurogenesis (<xref ref-type="bibr" rid="B13">13</xref>, <xref ref-type="bibr" rid="B15">15</xref>, <xref ref-type="bibr" rid="B58">58</xref>), with the microglial secretome playing an important role in this regulation (<xref ref-type="bibr" rid="B18">18</xref>&#x2013;<xref ref-type="bibr" rid="B20">20</xref>). Therefore, we investigated the role of EtOH-induced EVs on hippocampal neurogenesis. EVs were isolated from OBSC media with control or EtOH treatment as we have previously reported (<xref ref-type="bibr" rid="B31">31</xref>). NTA analysis confirmed EVs in the 50-300nm diameter size range in both control/pn-EVs and EtOH-EVs (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref>). The phenotype of EVs was then assessed by TEM negative staining. TEM confirmed the presence of EVs with the expected morphology (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3B</bold>
</xref>). Western blot further confirmed the presence of EVs with positive expression of the MV marker Annexin A1, the exosomal marker CD63, and the shared MV/exosomal marker CD81 (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3C</bold>
</xref>). EtOH-conditioned EVs were proinflammatory, with adoptive transfer to na&#xef;ve slices causing a significant treatment effect (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3D</bold>
</xref>, F<sub>3,8</sub> = 9.211, <italic>p=</italic>0.0055). <italic>Post-hoc</italic> analyses confirmed a 4-fold increase in gene expression of TNF&#x3b1; (*<italic>p&lt;</italic>0.05, Sidak&#x2019;s post-test) and a 6-fold increase in IL-1&#x3b2; (**<italic>p&lt;</italic>0.01 Sidak&#x2019;s post-test) consistent with our previous work (<xref ref-type="bibr" rid="B31">31</xref>).</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>EVs secreted by ethanol are proinflammatory. EVs were isolated from OBSC media after either ethanol (EtOH-EVs) or vehicle control (pro-neurogenic, pn-EVs). <bold>(A)</bold> NTA assessment of OBSC media showed similar size distributions between Control/pn-EVs and EtOH-EVs, mostly between 50-300nm in diameter. Averaged distributions from 3 samples per group depicted. <bold>(B)</bold> Transmitting electron microscopy confirmed the presence EVs with the expected size and cup-shaped morphology. <bold>(C)</bold> Western blot (WB) analysis of EV markers found Annexin A1, CD63, and CD81 in both pn-EVs and EtOH-EVs. <bold>(D)</bold> EtOH-EVs were transferred to na&#xef;ve OBSC slices, and levels of proinflammatory cytokines in slices measured by RT-PCR. A significant main effect of treatment was found (One-way ANOVA F<sub>3,8</sub> = 9.211, <italic>p=</italic>0.0055). EtOH-EVs caused robust inductions of TNF&#x3b1; (4-fold) and IL-1&#x3b2; (6-fold), *<italic>p &lt; </italic>0.05, **<italic>p &lt; </italic>0.01 Sidak&#x2019;s post-tests.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-866073-g003.tif"/>
</fig>
<p>Next, we assessed the effect of EtOH and EtOH-EVs on neurogenesis. A significant main effect of treatment was found on neurogenesis as measured by DCX (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4A, B</bold>
</xref>, F<sub>5, 58</sub> = 20.9, <italic>p</italic>&lt;0.0001) and ki67 (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4C, D</bold>
</xref>, F<sub>3, 22</sub> = 18.25, <italic>p</italic>&lt;0.0001). Ethanol reduced DCX expression by 48% compared to control (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4A, B</bold>
</xref>, ***<italic>p&lt;</italic>0.001, Sidak&#x2019;s post-test), consistent with previous findings <italic>in vivo</italic> and <italic>ex vivo</italic> (<xref ref-type="bibr" rid="B6">6</xref>, <xref ref-type="bibr" rid="B24">24</xref>, <xref ref-type="bibr" rid="B59">59</xref>). EVs from control OBSC were pro-neurogenic (pn) with a 67% increase in DCX (****<italic>p&lt;</italic>0.0001 vs. Control, Sidak&#x2019;s post-test). However, EVs from EtOH-treated OBSC reduced DCX staining by ~52% compared to controls (***<italic>p&lt;</italic>0.001) similar to the effects of ethanol. There was no significant difference between EtOH treated and EtOH-EV treated EVs (<italic>p=</italic>0.998). Likewise, reductions in ki67 were seen caused by ethanol (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4D</bold>
</xref>, 77%, **<italic>p&lt;</italic>0.01 vs. control) and EtOH-EVs (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4D</bold>
</xref>, 62% vs. pn-EVs, ****<italic>p&lt;</italic>0.0001). In order to determine if remaining media proteins in the EV preparations mediate this effect, we also assessed the effects of the EV supernatant on AHN, as recommended by the ISEV guidelines (<xref ref-type="bibr" rid="B55">55</xref>). This experiment is needed in order to attribute biological effects to EVs rather than a soluble component, and avoids the confounding of effects of components from size exclusion columns on biological function of recipient cells (<xref ref-type="bibr" rid="B55">55</xref>). We previously reported that EVs, but not EV depleted supernatant cause proinflammatory gene induction in brain slices (<xref ref-type="bibr" rid="B31">31</xref>). Likewise, we found that neither supernatant (SUPN) from control/pn-EV preparations, nor SUPN from EtOH-EV preparations had any effect on DCX (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4B</bold>
</xref>). Further, proteinase K digestion of EtOH-EV preparations to degrade all protein species outside of the EV membrane had no impact on the loss of DCX (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4B</bold>
</xref>) or ki67 (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4D</bold>
</xref>) caused by EtOH-EVs. This indicates that the observed effects of EtOH-EVs are not due to remaining protein in the isolated EVs. Thus, EVs secreted in response to ethanol are proinflammatory and anti-neurogenic, phenocopying the effects of ethanol. Since neurogenesis involves complex changes in chromatin accessibility to allow lineage specific gene transcription, we sought to investigate if EtOH-EV inhibition of neurogenesis involved an epigenetic mechanism.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>EVs secreted by ethanol blunt neurogenesis. OBSCs were treated for 4 days with either vehicle, ethanol, pn-EVs, EtOH-EVs, supernatant (SUPN) from EV preparations, or EtOH-EVs treated with proteinase K (Prot K) to degrade free proteins. Neurogenesis measured by IHC for DCX. <bold>(A)</bold> Representative images showing enhancement of neurogenesis by pn-EVs and a clear reduction of neurogenesis by EtOH and EtOH-EVs. Scale bar 100 &#xb5;m. <bold>(B)</bold> Quantification of DCX staining found a significant main effect of treatment (F<sub>5, 58</sub> = 20.9, p &lt; 0.0001). A 48% reduction in DCX was caused by EtOH, a 67% increase by pn-EVs relative to control. EtOH-EVs caused a 52% reduction compared to pn-EVs. SUPN isolated from pn-EV and EtOH-EV preparations had no effect on DCX. Prot K digestion of free proteins had no effect on reduction of DCX caused by EtOH-EVs. <bold>(C)</bold> Representative images of ki67 immunostaining in OBSC in control, EtOH, control/pn-EVs and EtOH-EVs. The neurogenic niche in the OBSC is outlined by the dashed lines. <bold>(D)</bold> Quantification of ki67 found a main effect of treatment (one-way ANOVA, F<sub>3,41 =</sub> 21.75, <italic>p &lt; </italic>0.0001.) Ethanol-EVs caused a 45% reduction in 60% reduction in ki67 staining compared to pn-EVs. Prot K digestion free proteins had no impack on loss of Ki67 caused by EtOH-EVs.**<italic>p &lt; </italic>0.01, ***<italic>p &lt; </italic>0.001, ****<italic>p &lt; </italic>0.00001 Sidak&#x2019;s post-test. Each dot represents an individual culture slice.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-866073-g004.tif"/>
</fig>
</sec>
<sec id="s3_3">
<title>3.3 EtOH-EVs Are Enriched With Euchromatin Histone Lysine Methyltransferase (Ehmt2)/G9a mRNA and Increase Histone-3 Lysine-9 Di-Methylation (H3K9me2)</title>
<p>Neurogenesis involves a complex orchestration of differential transcriptional programs that are regulated by chromatin modifications (<xref ref-type="bibr" rid="B10">10</xref>&#x2013;<xref ref-type="bibr" rid="B12">12</xref>). EVs contain complex cargo including mRNAs, non-coding RNAs, miRNAs, and proteins that could potentially regulate epigenetic chromatin modifications that could regulate neurogenesis (<xref ref-type="bibr" rid="B33">33</xref>, <xref ref-type="bibr" rid="B60">60</xref>). Therefore, we investigated whether EVs alter epigenetic modifications that regulate neurogenesis. The euchromatin histone lysine methyltransferase (Ehmt2/G9a) facilitates di-methylation of the lysine 9 residue on histone 3 (H3K9me2) to repress gene expression. G9a is involved in lineage specification during embryonic neurogenesis (<xref ref-type="bibr" rid="B12">12</xref>), and G9a-associated epigenetic marks are reduced by environmental enrichment-enhanced neurogenesis (<xref ref-type="bibr" rid="B11">11</xref>). G9a mRNA was increased by 2.5-fold (***<italic>p&lt;</italic>0.001, <xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5A</bold>
</xref>) in microglia-depleted slices, consistent with an association between its induction and a loss of neurogenesis. In EtOH-EVs, we found that G9a mRNA was increased by more than 3-fold relative to control pn-EVs (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5B</bold>
</xref>, <italic>*p</italic>&lt;0.05). In OBSC tissue, a main effect of treatment was found on G9a mRNA after treatment with either ethanol or EtOH-EVs (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5C</bold>
</xref>, One-way ANOVA, F<sub>3,17</sub> = 12.90, <italic>p</italic>=0.0001). Both ethanol and EtOH-EVs increased expression of G9a mRNA by 3-fold (<italic>****p&lt;</italic>0.0001, Sidak&#x2019;s post-test) and 2-fold (*<italic>p&lt;</italic>0.05, Sidak&#x2019;s), respectively, compared to controls with no effect of pn-EVs (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5C</bold>
</xref>). Since G9a mRNA was increased in OBSC by ethanol, we assessed if its associated H3K9me2 mark was also increased. IHC revealed H3K9me2 staining primarily in the neuronal granular region of the dentate and at the neurogenic niche (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5D</bold>
</xref>, dashed line). Ethanol increased H3K9me2 in the neuronal granular region of the dentate by 30% (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5D</bold>
</xref>). We then assessed the effect of EtOH-EV treatment of OBSCs on both G9a and H3K9me2 by western blot to confirm RT-PCR and IHC findings. EtOH-EVs caused a ~2-fold increase in both G9a protein (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5E</bold>
</xref>, **<italic>p&lt;</italic>0.01) and H3K9me2 (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5F</bold>
</xref>, **<italic>p&lt;</italic>0.01) in OBSC tissue. Since we found induction of G9a and H3K9me2, we next investigated if pharmacological inhibition of the G9a/GLP complex could prevent the loss of neurogenesis caused by ethanol and EtOH-EVs.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Microglia depletion and ethanol-EVs increase G9a in OBSC. <bold>(A)</bold> G9a mRNA was measured in control or PLX-microglial depleted OBSC. PLX resulted in a 2.5-fold increase in G9a relative to controls. N = 6 experimental replicates. <italic>***p &lt; </italic>0.001, <italic>t-</italic>test <bold>(B)</bold> EVs were isolated from OBSC media after either ethanol (EtOH-EVs) or vehicle control (pn-EVs). RT-PCR of mRNA isolated from EVs found a 3.5-fold increase of G9a mRNA in EtOH-EVs. N = 2 experimental replicates/group. <bold>(C)</bold> G9a mRNA was increased in OBSC slice tissue after treatment with either ethanol (3-fold) or EtOH-EVs (2-fold). *<italic>p &lt; </italic>0.05, <italic>****p &lt; </italic>0.0001, Sidak&#x2019;s post-test. <bold>(D)</bold> IHC found EtOH increased the number of H3K9me2 immunoreactive (+IR) pixels/mm<sup>2</sup> in the dentate granular (g) cell region of OBSC by 30%. The dashed white line marks the border of the hilus (h), which is the neurogenic region. Each dot represents an OBSC slice. <italic>*p &lt; </italic>0.05, <italic>t-</italic>test Scale bar 100 &#xb5;m. <bold>(E, F)</bold> OBSCs were treated with either control (pn-EVs) or EtOH-EVs. Western blot found that EtOH EVs increased of levels of <bold>(E)</bold> G9a protein (2-fold) and <bold>(F)</bold> H3K9me2 (2.1-fold). Each dot represents 4-6 pool OBSC slices. <italic>*p &lt; </italic>0.05, ***<italic>p &lt; </italic>0.001, <italic>t-</italic>test. Insert with representative western blot images of G9a, H3K9me2 and actin.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-866073-g005.tif"/>
</fig>
</sec>
<sec id="s3_4">
<title>3.4 Pharmacological Inhibition of G9a/GLP Prevents Loss of Neurogenesis by EtOH and EtOH-EVs</title>
<p>Since we found that ethanol and EtOH-EVs block adult hippocampal neurogenesis and increase expression of G9a, we next determined if inhibition of G9a signaling would prevent the loss of neurogenesis. We first measured G9a expression levels in OBSC after microglial depletion with PLX, which blunts neurogenesis (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1</bold>
</xref> and <xref ref-type="fig" rid="f2">
<bold>2</bold>
</xref>). G9a methyl-transferase activity was then blocked using pharmacological inhibitors of the G9a/GLP complex &#x2013; BIX-01294 (BIX), and UNC0642 (UNC) (<xref ref-type="bibr" rid="B61">61</xref>, <xref ref-type="bibr" rid="B62">62</xref>). A main effect of treatment was observed (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6A</bold>
</xref>, One-way ANOVA F<sub>13,68 </sub>= 6.8, ****<italic>p&lt;</italic>0.0001). As above, ethanol robustly inhibited hippocampal neurogenesis in OBSC (74% reduction, <xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6A, B</bold>
</xref>, ****<italic>p&lt;</italic>0.0001 vs. control Sidak&#x2019;s post-test). Neither BIX (500nM) nor UNC (1&#xb5;M) alone impacted DCX levels in control OBSC (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5A</bold>
</xref>). However, both UNC (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6A, B</bold>
</xref>) and BIX (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6C, D</bold>
</xref>) prevented the ethanol-induced loss of neurogenesis, returning DCX to control levels (<italic>##p&lt;</italic>0.01, <italic>###p&lt;</italic>0.001 vs. EtOH, Sidak&#x2019;s post-test). Regarding the effects of EVs, EtOH-EVs again reduced DCX (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6C</bold>
</xref>, *<italic>p&lt;</italic>0.01 vs. pn-EVs, Sidak&#x2019;s post-test). Further, like the effects of G9a inhibition on ethanol-treated OBSCs, BIX prevented the loss of neurogenesis caused by EtOH-EVs (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6C, D</bold>
</xref>, <italic>##p&lt;</italic>0.01 vs. EtOH-EVs) while UNC showed a trend toward a reversal (p=0.18). In order to confirm that BIX and UNC effectively inhibit G9a/GLP complex activity at these concentrations, we measured H3K9me2 in EtOH-EV-treated OBSC +/- these inhibitors by IHC. A main effect of treatment was found (F<sub>2,12</sub> = 22.9, <italic>p</italic>&lt;0.0001) with both UNC (****<italic>p&lt;</italic>0.0001, Sidak&#x2019;s post-test) and BIX (***<italic>p&lt;</italic>0.001) reducing H3K9me2 levels by 49% and 46% respectively (<xref ref-type="supplementary-material" rid="SF1">
<bold>Supplementary Figure&#xa0;1B</bold>
</xref>), consistent with predictions from prior studies (<xref ref-type="bibr" rid="B61">61</xref>, <xref ref-type="bibr" rid="B62">62</xref>). Thus, G9a/GLP complex activity facilitates the loss of hippocampal neurogenesis caused by EtOH and EtOH-EVs.</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Pharmacological inhibition of G9a prevents loss of neurogenesis caused by ethanol and EtOH-EVs. OBSCs were treated with either EtOH or EtOH-EVs +/- G9a inhibitors BIX-01294 (BIX) or UNC0642 (UNC). Neurogenesis was measured by IHC for DCX. <bold>(A)</bold> EtOH caused a 74% reduction of DCX that was prevented by UNC (1&#xb5;M) and BIX (500nM). 1-Way ANOVA, F<sub>13,68 </sub>= 6.8, <italic>****p &lt; </italic>0.0001 vs. control, ##<italic>p &lt; </italic>0.01 and <italic>###p &lt; </italic>0.001 vs. EtOH, Sidak&#x2019;s <italic>post-hoc</italic> multiple comparison&#x2019;s test. <bold>(B)</bold> Representative images show loss of neurogenesis with EtOH that was prevented by G9a inhibitors. <bold>(C)</bold> pn-EVs increased DCX by 37%, while EtOH-EVs caused a 50% reduction in DCX relative to control pn-EVs. One-way ANOVA, F<sub>4,23 </sub>= 4.05, *<italic>p &lt; </italic>0.01 vs. pn-EVs, <italic>##p &lt; </italic>0.01 vs. EtOH-EVs, Sidak&#x2019;s post-test. <bold>(D)</bold> Images showing G9a inhibitors blocked the loss of neurogenesis caused by EtOH-EVs.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-866073-g006.tif"/>
</fig>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<title>4 Discussion</title>
<p>Adult hippocampal neurogenesis is an important neurological process that is inhibited by ethanol (<xref ref-type="bibr" rid="B5">5</xref>, <xref ref-type="bibr" rid="B63">63</xref>). Chronic ethanol abuse causes dysfunction in hippocampal behaviors linked with AHN such as learning plasticity, memory, and mood (<xref ref-type="bibr" rid="B1">1</xref>&#x2013;<xref ref-type="bibr" rid="B4">4</xref>, <xref ref-type="bibr" rid="B64">64</xref>, <xref ref-type="bibr" rid="B65">65</xref>). Thus, strategies that ameliorate the loss of AHN caused by alcohol could have a therapeutic benefit for behavioral dysfunction caused by alcohol abuse. Here, we report that extracellular vesicles from resting microglia promote adult hippocampal neurogenesis. However, EVs secreted in response to ethanol cause deficits in neurogenesis through a G9a/GLP-mediated mechanism (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7</bold>
</xref>). EtOH-EVs mimicked the effects of ethanol on neurogenesis and were enriched with G9a mRNA. Both ethanol and EtOH-EVs increased G9a levels in recipient cultures, and G9a inhibitors prevented the ethanol- and EtOH-EV-induced loss of hippocampal neurogenesis. This identifies a novel EV-epigenetic signaling system that could be targeted to improve cognitive and behavioral deficits associated with ethanol.</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>Summary of findings. At rest, microglia secrete pro-neurogenic EVs (pn-EVs) to promote neurogenesis (gray branches). Ethanol causes proinflammatory activation of microglia, with secretion of proinflammatory EtOH-EVs (Crews et&#xa0;al., 2021) now found to be enriched with G9a mRNA. EtOH induces G9a and H3K9me2 (yellow) in the neurogenic niche of the dentate gyrus to blunt neurogenesis (gray branches). Inhibition of G9a activity with UNC and BIX prevent loss of neurogenesis caused by EtOH and EtOH-EVs.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-866073-g007.tif"/>
</fig>
<p>Both stressful and proinflammatory stimuli cause reductions in adult hippocampal neurogenesis (<xref ref-type="bibr" rid="B15">15</xref>&#x2013;<xref ref-type="bibr" rid="B17">17</xref>). Microglia have recently been identified as regulators of AHN, with their phagocytic secretome increasing AHN (<xref ref-type="bibr" rid="B18">18</xref>, <xref ref-type="bibr" rid="B19">19</xref>). In our previous report, we found that microglia induce EtOH-EVs that further promote the proinflammatory effects of ethanol (<xref ref-type="bibr" rid="B31">31</xref>). Here we find that resting microglia promote AHN through production of pro-neurogenic EVs. However, in the presence of ethanol, EtOH-EVs inhibit AHN through G9a. Here we find that G9a inhibitors blocked the EtOH- and EtOH-EV-induced loss of neurogenesis. Previously we reported the proinflammatory activity of EtOH-EVs was blocked by the anti-inflammatory inhibitor of HMGB1, GLY (<xref ref-type="bibr" rid="B31">31</xref>). However, GLY had no effect on G9a or H3K9me2 levels in these studies (not shown). This suggests that G9a-epigenetic signaling is either upstream or required in parallel with HMGB1 for proinflammatory gene activation to occur. Regarding adult hippocampal neurogenesis, a role of G9a/Ehmt2 has not been reported previously. However, other studies are consistent with this work, suggesting histone methylation represses AHN (<xref ref-type="bibr" rid="B66">66</xref>). A loss of the histone lysine-specific demethylase 1 (LSD1), which demethylates H3K9 (<xref ref-type="bibr" rid="B27">27</xref>) (resulting in increased methylation), was found to reduce neural stem cell proliferation (<xref ref-type="bibr" rid="B28">28</xref>), consistent with our finding. Global increases in H3K9 acetylation, the &#x201c;opposing&#x201d; epigenetic mark of H3K9me2, were found to increase differentiation of adult progenitors into neurons (<xref ref-type="bibr" rid="B10">10</xref>). Further, pro-neurogenic environmental enrichment reduced H3K9 methylation at the promoter of the neurogenesis promoting growth factor BDNF, increasing its expression (<xref ref-type="bibr" rid="B11">11</xref>). Thus, methylation of H3K9 in adulthood seems to inhibit AHN, though details regarding this regulation need to be explored further in future work. Though little is known about G9a regulation of adult hippocampal neuronal proliferation and differentiation, this &#x201c;anti-neurogenic&#x201d; role in adulthood seems to differ from its actions during embryonic development.</p>
<p>During embryogenesis, G9a promotes neuronal differentiation and suppresses expression of non-neuronal genes (<xref ref-type="bibr" rid="B12">12</xref>, <xref ref-type="bibr" rid="B25">25</xref>, <xref ref-type="bibr" rid="B26">26</xref>). However, evidence in adults suggests that H3K9me2 silences neuron lineage-specific genes in fully differentiated cholinergic neurons to promote a loss of the cholinergic phenotype after ethanol (<xref ref-type="bibr" rid="B30">30</xref>). Thus, the role of G9a appears to differ during embryonic and adult stages. This study is the first report to our knowledge that investigates the role of G9a in adult hippocampal neurogenesis. The impact of G9a on differentiation of other cell types in the adult hippocampus, however, remains unknown. It is possible that EtOH- or EtOH-EV-induced increases in G9a could promote differentiation of progenitors into other cell types, resulting in less neurogenesis. Further studies are needed to fully define the specific roles of G9a in proliferation and differentiation across cell types in the adult brain. It is important to note that the inhibitors of G9a signaling inhibit the G9a/GLP complex, also acting on GLP. Thus, the observed effects could be due to G9a or GLP. Our goal here is not to differentiate specifically between the roles GLP and G9a, rather to identify epigenetic mechanisms ex-vivo that can be moved <italic>in vivo</italic> in future work, with well-established inhibitors.</p>
<p>Though we found increased G9a mRNA in EtOH-EVs and induction of G9a in na&#xef;ve OBSC by EtOH-EVs, it is unclear whether EtOH-EVs cause this increase through transfer of their mRNA. EVs can exert their influence in a variety of ways, many of which involve activation of immune pathways (<xref ref-type="bibr" rid="B67">67</xref>, <xref ref-type="bibr" rid="B68">68</xref>). This can include transfer of contents to recipient cells (e.g., mRNAs, miRNAs), delivery of their contents to cell surface receptors (e.g., cytokines), or delivery of bioactive lipid species or damage-associated molecular pattern molecules (DAMPs, e.g., HMGB1). Recent studies have found that EVs play key roles in mediating multiple alcohol-related pathologies. In the periphery, this includes modulation of peripheral monocyte activity (<xref ref-type="bibr" rid="B69">69</xref>), promoting induction of monocyte chemoattractant protein-1 in hepatocytes (<xref ref-type="bibr" rid="B70">70</xref>), and induction of fibrotic genes in hepatic stellate cells through miRNA delivery (<xref ref-type="bibr" rid="B71">71</xref>). In the brain, microglial EVs promote hypothalamic neuronal death caused by ethanol during the embryonic period through delivery of the complement protein C1q (<xref ref-type="bibr" rid="B72">72</xref>) as well as neuronal death in adulthood through delivery of the miRNA let-7b (<xref ref-type="bibr" rid="B48">48</xref>). Astrocytes can also, in response to ethanol, secrete EVs that damage neurons involving a TLR4 neuro-immune pathway (<xref ref-type="bibr" rid="B73">73</xref>). An unexpected finding was that EVs from microglial-depleted cultures showed a trend toward a reduction of DCX in control OBSCs. It is possible that a loss of trophic factors in PLX-EVs or the presence of neurotoxic factors secreted in PLX-EVs mediate this, though future studies are needed to determine this. Nonetheless, EVs promote central and peripheral ethanol pathology, often through immune mechanisms. Consistent with this, we recently reported that EtOH-EVs induced by microglia seem to drive proinflammatory gene induction caused by ethanol (<xref ref-type="bibr" rid="B31">31</xref>). In that previous report, our studies suggested that MVs rather than exosomes mediate the pro-inflammatory signaling caused by EtOH-EVs. Here, we did not distinguish between the effects of MVs versus exosomes on AHN. Both MVs and exosomes are critical EVs, capable of modulating responses in recipient cells. Several factors known to regulate AHN have been found in exosomes (<xref ref-type="bibr" rid="B74">74</xref>), and MVs derived from mesenchymal stem cells are also able to promote neurogenesis (<xref ref-type="bibr" rid="B75">75</xref>). Thus, both MVs and exosomes could be involved in our observation, and should be investigated further in future work. This current work now implicates a role for EV modulation of epigenetic modifications to chromatin structure in both the induction of proinflammatory gene induction and loss of AHN caused by ethanol.</p>
<p>In summary, we found that microglia promote neurogenesis through secretion of pn-EVs and that EtOH-EVs inhibit adult hippocampal neurogenesis. The G9a/GLP complex is implicated in the loss of neurogenesis caused by ethanol and EtOH-EVs. In future work, we plan to investigate the ability of pn-EVs to reverse loss of AHN <italic>in vivo.</italic> The use of EVs as therapeutic agents could represent a promising biological medicine approach (<xref ref-type="bibr" rid="B76">76</xref>). Future studies will also investigate the gene targets of G9a in different cell types in brain, both <italic>ex vivo</italic> and <italic>in vitro</italic>, as well as the ability of G9a inhibitors to alter alcohol effects <italic>in vivo.</italic> Elucidating the targets of G9a and its function <italic>in vivo</italic> will determine if targeting this epigenetic pathway could be a beneficial therapeutic approach for mood and cognitive dysfunction in AUD.</p>
</sec>
<sec id="s5" sec-type="data-availability">
<title>Data Availability Statement</title>
<p>The original contributions presented in the study are included in the article/<xref ref-type="supplementary-material" rid="SF1">
<bold>Supplementary Material</bold>
</xref>, further inquiries can be directed to the corresponding author.</p>
</sec>
<sec id="s6" sec-type="ethics-statement">
<title>Ethics Statement</title>
<p>The animal study was reviewed and approved by UNC Institutional Animal Care and Use Committee (IACUC).</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author Contributions</title>
<p>JZ and LGC drafted the text and figures. All authors contributed to the article and approved the submitted version.</p>
</sec>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>This research was funded by NIH, grant numbers: AA024829, AA028924, AA028599, AA020024, and The Bowles Center for Alcohol Studies.</p>
</sec>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of Interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s10" sec-type="disclaimer">
<title>Publisher&#x2019;s Note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
</body>
<back>
<ack>
<title>Acknowledgments</title>
<p>The Microscopy Services Laboratory, Department of Pathology and Laboratory Medicine, is supported in part by P30 CA016086 Cancer Center Core Support Grant to the UNC Lineberger Comprehensive Cancer Center.</p>
</ack>
<sec id="s11" sec-type="supplementary-material">
<title>Supplementary Material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fimmu.2022.866073/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fimmu.2022.866073/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="DataSheet_1.zip" id="SF1" mimetype="application/zip">
<label>Supplementary Figure&#xa0;1</label>
<caption>
<p>EtOH-EVs blunt IL-4 and UNC and BIX Inhibit G9a/GLP activity. <bold>(A)</bold> OBSCs were treated with either pn-EVs, or EtOH-EVs for 96 hours. pn-EVs caused an 82% increase in IL-4 gene expression (one-way ANOVA, F<sub>2,6 </sub>= 7.98, <italic>p &lt; </italic>0.0001). *<italic>p &lt; </italic>0.05, **<italic>p &lt; </italic>0.01, ****<italic>p &lt; </italic>0.0001, Sidak&#x2019;s post<italic>-</italic>test. <bold>(B)</bold> OBSCs were treated with EtOH-EVs for 96 hours +/- UNC (1&#xb5;M) or BIX (500nM). H3K9me2 was measured in slices by IHC. A main effect of treatment was found (One-way ANOVA, F<sub>2,12</sub> = 22.9, <italic>p</italic>&lt;0.0001) with UNC and BIX reducing H3K9me2 levels by 49% and 47% respectively, ***<italic>p &lt; </italic>0.001 ****<italic>p &lt; </italic>0.0001, Sidak&#x2019;s post-test.</p>
</caption>
</supplementary-material>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Anacker</surname> <given-names>C</given-names>
</name>
<name>
<surname>Hen</surname> <given-names>R</given-names>
</name>
</person-group>. <article-title>Adult Hippocampal Neurogenesis and Cognitive Flexibility - Linking Memory and Mood</article-title>. <source>Nat Rev Neurosci</source> (<year>2017</year>) <volume>18</volume>(<issue>6</issue>):<page-range>335&#x2013;46</page-range>. doi: <pub-id pub-id-type="doi">10.1038/nrn.2017.45</pub-id>
</citation>
</ref>
<ref id="B2">
<label>2</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jessberger</surname> <given-names>S</given-names>
</name>
<name>
<surname>Clark</surname> <given-names>RE</given-names>
</name>
<name>
<surname>Broadbent</surname> <given-names>NJ</given-names>
</name>
<name>
<surname>Clemenson</surname> <given-names>GD</given-names> <suffix>Jr</suffix>
</name>
<name>
<surname>Consiglio</surname> <given-names>A</given-names>
</name>
<name>
<surname>Lie</surname> <given-names>DC</given-names>
</name>
<etal/>
</person-group>. <article-title>Dentate Gyrus-Specific Knockdown of Adult Neurogenesis Impairs Spatial and Object Recognition Memory in Adult Rats</article-title>. <source>Learn Mem</source> (<year>2009</year>) <volume>16</volume>(<issue>2</issue>):<page-range>147&#x2013;54</page-range>. doi: <pub-id pub-id-type="doi">10.1101/lm.1172609</pub-id>
</citation>
</ref>
<ref id="B3">
<label>3</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Suarez-Pereira</surname> <given-names>I</given-names>
</name>
<name>
<surname>Canals</surname> <given-names>S</given-names>
</name>
<name>
<surname>Carrion</surname> <given-names>AM</given-names>
</name>
</person-group>. <article-title>Adult Newborn Neurons are Involved in Learning Acquisition and Long-Term Memory Formation: The Distinct Demands on Temporal Neurogenesis of Different Cognitive Tasks</article-title>. <source>Hippocampus</source> (<year>2015</year>) <volume>25</volume>(<issue>1</issue>):<fpage>51</fpage>&#x2013;<lpage>61</lpage>. doi: <pub-id pub-id-type="doi">10.1002/hipo.22349</pub-id>
</citation>
</ref>
<ref id="B4">
<label>4</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vetreno</surname> <given-names>RP</given-names>
</name>
<name>
<surname>Crews</surname> <given-names>FT</given-names>
</name>
</person-group>. <article-title>Binge Ethanol Exposure During Adolescence Leads to a Persistent Loss of Neurogenesis in the Dorsal and Ventral Hippocampus That Is Associated With Impaired Adult Cognitive Functioning</article-title>. <source>Front Neurosci</source> (<year>2015</year>) <volume>9</volume>:<elocation-id>35</elocation-id>. doi: <pub-id pub-id-type="doi">10.3389/fnins.2015.00035</pub-id>
</citation>
</ref>
<ref id="B5">
<label>5</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Crews</surname> <given-names>FT</given-names>
</name>
<name>
<surname>Nixon</surname> <given-names>K</given-names>
</name>
</person-group>. <article-title>Mechanisms of Neurodegeneration and Regeneration in Alcoholism</article-title>. <source>Alcohol Alcohol</source> (<year>2009</year>) <volume>44</volume>(<issue>2</issue>):<page-range>115&#x2013;27</page-range>. doi: <pub-id pub-id-type="doi">10.1093/alcalc/agn079</pub-id>
</citation>
</ref>
<ref id="B6">
<label>6</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Broadwater</surname> <given-names>MA</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>W</given-names>
</name>
<name>
<surname>Crews</surname> <given-names>FT</given-names>
</name>
<name>
<surname>Spear</surname> <given-names>LP</given-names>
</name>
</person-group>. <article-title>Persistent Loss of Hippocampal Neurogenesis and Increased Cell Death Following Adolescent, But Not Adult, Chronic Ethanol Exposure</article-title>. <source>Dev Neurosci</source> (<year>2014</year>) <volume>36</volume>(<issue>3-4</issue>):<fpage>297</fpage>&#x2013;<lpage>305</lpage>. doi: <pub-id pub-id-type="doi">10.1159/000362874</pub-id>
</citation>
</ref>
<ref id="B7">
<label>7</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sakharkar</surname> <given-names>AJ</given-names>
</name>
<name>
<surname>Vetreno</surname> <given-names>RP</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>H</given-names>
</name>
<name>
<surname>Kokare</surname> <given-names>DM</given-names>
</name>
<name>
<surname>Crews</surname> <given-names>FT</given-names>
</name>
<name>
<surname>Pandey</surname> <given-names>SC</given-names>
</name>
</person-group>. <article-title>A Role for Histone Acetylation Mechanisms in Adolescent Alcohol Exposure-Induced Deficits in Hippocampal Brain-Derived Neurotrophic Factor Expression and Neurogenesis Markers in Adulthood</article-title>. <source>Brain Struct Funct</source> (<year>2016</year>) <volume>221</volume>(<issue>9</issue>):<page-range>4691&#x2013;703</page-range>. doi: <pub-id pub-id-type="doi">10.1007/s00429-016-1196-y</pub-id>
</citation>
</ref>
<ref id="B8">
<label>8</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Swartzwelder</surname> <given-names>HS</given-names>
</name>
<name>
<surname>Healey</surname> <given-names>KL</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>W</given-names>
</name>
<name>
<surname>Dubester</surname> <given-names>K</given-names>
</name>
<name>
<surname>Miller</surname> <given-names>KM</given-names>
</name>
<name>
<surname>Crews</surname> <given-names>FT</given-names>
</name>
</person-group>. <article-title>Changes in Neuroimmune and Neuronal Death Markers After Adolescent Alcohol Exposure in Rats are Reversed by Donepezil</article-title>. <source>Sci Rep</source> (<year>2019</year>) <volume>9</volume>(<issue>1</issue>):<fpage>12110</fpage>. doi: <pub-id pub-id-type="doi">10.1038/s41598-019-47039-1</pub-id>
</citation>
</ref>
<ref id="B9">
<label>9</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vicidomini</surname> <given-names>C</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>N</given-names>
</name>
<name>
<surname>Sahay</surname> <given-names>A</given-names>
</name>
</person-group>. <article-title>Communication, Cross Talk, and Signal Integration in the Adult Hippocampal Neurogenic Niche</article-title>. <source>Neuron</source> (<year>2020</year>) <volume>105</volume>(<issue>2</issue>):<page-range>220&#x2013;35</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.neuron.2019.11.029</pub-id>
</citation>
</ref>
<ref id="B10">
<label>10</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hsieh</surname> <given-names>J</given-names>
</name>
<name>
<surname>Nakashima</surname> <given-names>K</given-names>
</name>
<name>
<surname>Kuwabara</surname> <given-names>T</given-names>
</name>
<name>
<surname>Mejia</surname> <given-names>E</given-names>
</name>
<name>
<surname>Gage</surname> <given-names>FH</given-names>
</name>
</person-group>. (2004). <article-title>Histone Deacetylase Inhibition-Mediated Neuronal Differentiation of Multipotent Adult Neural Progenitor Cells</article-title>. <source>Proc Natl Acad Sci USA</source> (<year>2004</year>) 101(<issue>47</issue>):<page-range>16659&#x2013;64</page-range>. doi: <pub-id pub-id-type="doi">10.1073/pnas.0407643101</pub-id>
</citation>
</ref>
<ref id="B11">
<label>11</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kuzumaki</surname> <given-names>N</given-names>
</name>
<name>
<surname>Ikegami</surname> <given-names>D</given-names>
</name>
<name>
<surname>Tamura</surname> <given-names>R</given-names>
</name>
<name>
<surname>Hareyama</surname> <given-names>N</given-names>
</name>
<name>
<surname>Imai</surname> <given-names>S</given-names>
</name>
<name>
<surname>Narita</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Hippocampal Epigenetic Modification at the Brain-Derived Neurotrophic Factor Gene Induced by an Enriched Environment</article-title>. <source>Hippocampus</source> (<year>2011</year>) <volume>21</volume>(<issue>2</issue>):<page-range>127&#x2013;32</page-range>. doi: <pub-id pub-id-type="doi">10.1002/hipo.20775</pub-id>
</citation>
</ref>
<ref id="B12">
<label>12</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Deimling</surname> <given-names>SJ</given-names>
</name>
<name>
<surname>Olsen</surname> <given-names>JB</given-names>
</name>
<name>
<surname>Tropepe</surname> <given-names>V</given-names>
</name>
</person-group>. <article-title>The Expanding Role of the Ehmt2/G9a Complex in Neurodevelopment</article-title>. <source>Neurogen (Austin)</source> (<year>2017</year>) <volume>4</volume>(<issue>1</issue>):<elocation-id>e1316888</elocation-id>. doi: <pub-id pub-id-type="doi">10.1080/23262133.2017.1316888</pub-id>
</citation>
</ref>
<ref id="B13">
<label>13</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ekdahl</surname> <given-names>CT</given-names>
</name>
<name>
<surname>Claasen</surname> <given-names>JH</given-names>
</name>
<name>
<surname>Bonde</surname> <given-names>S</given-names>
</name>
<name>
<surname>Kokaia</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Lindvall</surname> <given-names>O</given-names>
</name>
</person-group>. <article-title>Inflammation Is Detrimental for Neurogenesis in Adult Brain</article-title>. <source>Proc Natl Acad Sci USA</source> (<year>2003</year>) <volume>100</volume>(<issue>23</issue>):<page-range>13632&#x2013;7</page-range>. doi: <pub-id pub-id-type="doi">10.1073/pnas.2234031100</pub-id>
</citation>
</ref>
<ref id="B14">
<label>14</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Monje</surname> <given-names>ML</given-names>
</name>
<name>
<surname>Toda</surname> <given-names>H</given-names>
</name>
<name>
<surname>Palmer</surname> <given-names>TD</given-names>
</name>
</person-group>. <article-title>Inflammatory Blockade Restores Adult Hippocampal Neurogenesis</article-title>. <source>Science</source> (<year>2003</year>) <volume>302</volume>(<issue>5651</issue>):<page-range>1760&#x2013;5</page-range>. doi: <pub-id pub-id-type="doi">10.1126/science.1088417</pub-id>
</citation>
</ref>
<ref id="B15">
<label>15</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Borsini</surname> <given-names>A</given-names>
</name>
<name>
<surname>Cattaneo</surname> <given-names>A</given-names>
</name>
<name>
<surname>Malpighi</surname> <given-names>C</given-names>
</name>
<name>
<surname>Thuret</surname> <given-names>S</given-names>
</name>
<name>
<surname>Harrison</surname> <given-names>NA</given-names>
</name>
<name>
<surname>Consortium</surname> <given-names>MRCI</given-names>
</name>
<etal/>
</person-group>. <article-title>Interferon-Alpha Reduces Human Hippocampal Neurogenesis and Increases Apoptosis via Activation of Distinct STAT1-Dependent Mechanisms</article-title>. <source>Int J Neuropsychopharmacol</source> (<year>2017</year>) <volume>21</volume>(<issue>2</issue>):<fpage>187</fpage>&#x2013;<lpage>200</lpage>. doi: <pub-id pub-id-type="doi">10.1093/ijnp/pyx083</pub-id>
</citation>
</ref>
<ref id="B16">
<label>16</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Snyder</surname> <given-names>JS</given-names>
</name>
<name>
<surname>Soumier</surname> <given-names>A</given-names>
</name>
<name>
<surname>Brewer</surname> <given-names>M</given-names>
</name>
<name>
<surname>Pickel</surname> <given-names>J</given-names>
</name>
<name>
<surname>Cameron</surname> <given-names>HA</given-names>
</name>
</person-group>. <article-title>Adult Hippocampal Neurogenesis Buffers Stress Responses and Depressive Behaviour</article-title>. <source>Nature</source> (<year>2011</year>) <volume>476</volume>(<issue>7361</issue>):<page-range>458&#x2013;61</page-range>. doi: <pub-id pub-id-type="doi">10.1038/nature10287</pub-id>
</citation>
</ref>
<ref id="B17">
<label>17</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Goshen</surname> <given-names>I</given-names>
</name>
<name>
<surname>Kreisel</surname> <given-names>T</given-names>
</name>
<name>
<surname>Ben-Menachem-Zidon</surname> <given-names>O</given-names>
</name>
<name>
<surname>Licht</surname> <given-names>T</given-names>
</name>
<name>
<surname>Weidenfeld</surname> <given-names>J</given-names>
</name>
<name>
<surname>Ben-Hur</surname> <given-names>T</given-names>
</name>
<etal/>
</person-group>. <article-title>Brain Interleukin-1 Mediates Chronic Stress-Induced Depression in Mice <italic>via</italic> Adrenocortical Activation and Hippocampal Neurogenesis Suppression</article-title>. <source>Mol Psychiatry</source> (<year>2008</year>) <volume>13</volume>(<issue>7</issue>):<page-range>717&#x2013;28</page-range>. doi: <pub-id pub-id-type="doi">10.1038/sj.mp.4002055</pub-id>
</citation>
</ref>
<ref id="B18">
<label>18</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Diaz-Aparicio</surname> <given-names>I</given-names>
</name>
<name>
<surname>Paris</surname> <given-names>I</given-names>
</name>
<name>
<surname>Sierra-Torre</surname> <given-names>V</given-names>
</name>
<name>
<surname>Plaza-Zabala</surname> <given-names>A</given-names>
</name>
<name>
<surname>Rodriguez-Iglesias</surname> <given-names>N</given-names>
</name>
<name>
<surname>Marquez-Ropero</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Microglia Actively Remodel Adult Hippocampal Neurogenesis Through the Phagocytosis Secretome</article-title>. <source>J Neurosci</source> (<year>2020</year>) <volume>40</volume>(<issue>7</issue>):<page-range>1453&#x2013;82</page-range>. doi: <pub-id pub-id-type="doi">10.1523/JNEUROSCI.0993-19.2019</pub-id>
</citation>
</ref>
<ref id="B19">
<label>19</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Osman</surname> <given-names>AM</given-names>
</name>
<name>
<surname>Rodhe</surname> <given-names>J</given-names>
</name>
<name>
<surname>Shen</surname> <given-names>X</given-names>
</name>
<name>
<surname>Dominguez</surname> <given-names>CA</given-names>
</name>
<name>
<surname>Joseph</surname> <given-names>B</given-names>
</name>
<name>
<surname>Blomgren</surname> <given-names>K</given-names>
</name>
</person-group>. <article-title>The Secretome of Microglia Regulate Neural Stem Cell Function</article-title>. <source>Neuroscience</source> (<year>2019</year>) <volume>405</volume>:<fpage>92</fpage>&#x2013;<lpage>102</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.neuroscience.2017.10.034</pub-id>
</citation>
</ref>
<ref id="B20">
<label>20</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kreisel</surname> <given-names>T</given-names>
</name>
<name>
<surname>Wolf</surname> <given-names>B</given-names>
</name>
<name>
<surname>Keshet</surname> <given-names>E</given-names>
</name>
<name>
<surname>Licht</surname> <given-names>T</given-names>
</name>
</person-group>. <article-title>Unique Role for Dentate Gyrus Microglia in Neuroblast Survival and in VEGF-Induced Activation</article-title>. <source>Glia</source> (<year>2019</year>) <volume>67</volume>(<issue>4</issue>):<fpage>594</fpage>&#x2013;<lpage>618</lpage>. doi: <pub-id pub-id-type="doi">10.1002/glia.23505</pub-id>
</citation>
</ref>
<ref id="B21">
<label>21</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Coleman</surname> <given-names>LG</given-names> <suffix>Jr</suffix>
</name>
<name>
<surname>Zou</surname> <given-names>J</given-names>
</name>
<name>
<surname>Crews</surname> <given-names>FT</given-names>
</name>
</person-group>. <article-title>Microglial Depletion and Repopulation in Brain Slice Culture Normalizes Sensitized Proinflammatory Signaling</article-title>. <source>J Neuroinflam</source> (<year>2020</year>) <volume>17</volume>(<issue>1</issue>):<fpage>27</fpage>. doi: <pub-id pub-id-type="doi">10.1186/s12974-019-1678-y</pub-id>
</citation>
</ref>
<ref id="B22">
<label>22</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fernandez-Lizarbe</surname> <given-names>S</given-names>
</name>
<name>
<surname>Montesinos</surname> <given-names>J</given-names>
</name>
<name>
<surname>Guerri</surname> <given-names>C</given-names>
</name>
</person-group>. <article-title>Ethanol Induces TLR4/TLR2 Association, Triggering an Inflammatory Response in Microglial Cells</article-title>. <source>J Neurochem</source> (<year>2013</year>) <volume>126</volume>(<issue>2</issue>):<page-range>261&#x2013;73</page-range>. doi: <pub-id pub-id-type="doi">10.1111/jnc.12276</pub-id>
</citation>
</ref>
<ref id="B23">
<label>23</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>He</surname> <given-names>J</given-names>
</name>
<name>
<surname>Crews</surname> <given-names>FT</given-names>
</name>
</person-group>. <article-title>Increased MCP-1 and Microglia in Various Regions of the Human Alcoholic Brain</article-title>. <source>Exp Neurol</source> (<year>2008</year>) <volume>210</volume>(<issue>2</issue>):<page-range>349&#x2013;58</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.expneurol.2007.11.017</pub-id>
</citation>
</ref>
<ref id="B24">
<label>24</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vetreno</surname> <given-names>RP</given-names>
</name>
<name>
<surname>Lawrimore</surname> <given-names>CJ</given-names>
</name>
<name>
<surname>Rowsey</surname> <given-names>PJ</given-names>
</name>
<name>
<surname>Crews</surname> <given-names>FT</given-names>
</name>
</person-group>. <article-title>Persistent Adult Neuroimmune Activation and Loss of Hippocampal Neurogenesis Following Adolescent Ethanol Exposure: Blockade by Exercise and the Anti-Inflammatory Drug Indomethacin</article-title>. <source>Front Neurosci</source> (<year>2018</year>) <volume>12</volume>:<elocation-id>200</elocation-id>. doi: <pub-id pub-id-type="doi">10.3389/fnins.2018.00200</pub-id>
</citation>
</ref>
<ref id="B25">
<label>25</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fiszbein</surname> <given-names>A</given-names>
</name>
<name>
<surname>Kornblihtt</surname> <given-names>AR</given-names>
</name>
</person-group>. <article-title>Histone Methylation, Alternative Splicing and Neuronal Differentiation</article-title>. <source>Neurogen (Austin).</source> (<year>2016</year>) <volume>3</volume>(<issue>1</issue>):<elocation-id>e1204844</elocation-id>. doi: <pub-id pub-id-type="doi">10.1080/23262133.2016.1204844</pub-id>
</citation>
</ref>
<ref id="B26">
<label>26</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Olsen</surname> <given-names>JB</given-names>
</name>
<name>
<surname>Wong</surname> <given-names>L</given-names>
</name>
<name>
<surname>Deimling</surname> <given-names>S</given-names>
</name>
<name>
<surname>Miles</surname> <given-names>A</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>H</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Y</given-names>
</name>
<etal/>
</person-group>. <article-title>G9a and ZNF644 Physically Associate to Suppress Progenitor Gene Expression During Neurogenesis</article-title>. <source>Stem Cell Rep</source> (<year>2016</year>) <volume>7</volume>(<issue>3</issue>):<page-range>454&#x2013;70</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.stemcr.2016.06.012</pub-id>
</citation>
</ref>
<ref id="B27">
<label>27</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Metzger</surname> <given-names>E</given-names>
</name>
<name>
<surname>Wissmann</surname> <given-names>M</given-names>
</name>
<name>
<surname>Yin</surname> <given-names>N</given-names>
</name>
<name>
<surname>Muller</surname> <given-names>JM</given-names>
</name>
<name>
<surname>Schneider</surname> <given-names>R</given-names>
</name>
<name>
<surname>Peters</surname> <given-names>AH</given-names>
</name>
<etal/>
</person-group>. <article-title>LSD1 Demethylates Repressive Histone Marks to Promote Androgen-Receptor-Dependent Transcription</article-title>. <source>Nature</source> (<year>2005</year>) <volume>437</volume>(<issue>7057</issue>):<page-range>436&#x2013;9</page-range>. doi: <pub-id pub-id-type="doi">10.1038/nature04020</pub-id>
</citation>
</ref>
<ref id="B28">
<label>28</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sun</surname> <given-names>G</given-names>
</name>
<name>
<surname>Alzayady</surname> <given-names>K</given-names>
</name>
<name>
<surname>Stewart</surname> <given-names>R</given-names>
</name>
<name>
<surname>Ye</surname> <given-names>P</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>S</given-names>
</name>
<name>
<surname>Li</surname> <given-names>W</given-names>
</name>
<etal/>
</person-group>. <article-title>Histone Demethylase LSD1 Regulates Neural Stem Cell Proliferation</article-title>. <source>Mol Cell Biol</source> (<year>2010</year>) <volume>30</volume>(<issue>8</issue>):<fpage>1997</fpage>&#x2013;<lpage>2005</lpage>. doi: <pub-id pub-id-type="doi">10.1128/MCB.01116-09</pub-id>
</citation>
</ref>
<ref id="B29">
<label>29</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Crews</surname> <given-names>FT</given-names>
</name>
<name>
<surname>Fisher</surname> <given-names>R</given-names>
</name>
<name>
<surname>Deason</surname> <given-names>C</given-names>
</name>
<name>
<surname>Vetreno</surname> <given-names>RP</given-names>
</name>
</person-group>. <article-title>Loss of Basal Forebrain Cholinergic Neurons Following Adolescent Binge Ethanol Exposure: Recovery With the Cholinesterase Inhibitor Galantamine</article-title>. <source>Front Behav Neurosci</source> (<year>2021</year>) <volume>15</volume>:<elocation-id>652494</elocation-id>. doi: <pub-id pub-id-type="doi">10.3389/fnbeh.2021.652494</pub-id>
</citation>
</ref>
<ref id="B30">
<label>30</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vetreno</surname> <given-names>RP</given-names>
</name>
<name>
<surname>Bohnsack</surname> <given-names>JP</given-names>
</name>
<name>
<surname>Kusumo</surname> <given-names>H</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>W</given-names>
</name>
<name>
<surname>Pandey</surname> <given-names>SC</given-names>
</name>
<name>
<surname>Crews</surname> <given-names>FT</given-names>
</name>
</person-group>. <article-title>Neuroimmune and Epigenetic Involvement in Adolescent Binge Ethanol-Induced Loss of Basal Forebrain Cholinergic Neurons: Restoration With Voluntary Exercise</article-title>. <source>Addict Biol</source> (<year>2020</year>) <volume>25</volume>(<issue>2</issue>):<elocation-id>e12731</elocation-id>. doi: <pub-id pub-id-type="doi">10.1111/adb.12731</pub-id>
</citation>
</ref>
<ref id="B31">
<label>31</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Crews</surname> <given-names>FT</given-names>
</name>
<name>
<surname>Zou</surname> <given-names>J</given-names>
</name>
<name>
<surname>Coleman</surname> <given-names>LG</given-names>
<suffix> Jr.</suffix>
</name>
</person-group> <article-title>Extracellular Microvesicles Promote Microglia-Mediated Pro-Inflammatory Responses to Ethanol</article-title>. <source>J Neurosci Res</source> (<year>2021</year>) <volume>99</volume>(<issue>8</issue>):<page-range>1940&#x2013;56</page-range>. doi: <pub-id pub-id-type="doi">10.1002/jnr.24813</pub-id>
</citation>
</ref>
<ref id="B32">
<label>32</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>van Niel</surname> <given-names>G</given-names>
</name>
<name>
<surname>D'Angelo</surname> <given-names>G</given-names>
</name>
<name>
<surname>Raposo</surname> <given-names>G</given-names>
</name>
</person-group>. <article-title>Shedding Light on the Cell Biology of Extracellular Vesicles</article-title>. <source>Nat Rev Mol Cell Biol</source> (<year>2018</year>) <volume>19</volume>(<issue>4</issue>):<page-range>213&#x2013;28</page-range>. doi: <pub-id pub-id-type="doi">10.1038/nrm.2017.125</pub-id>
</citation>
</ref>
<ref id="B33">
<label>33</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vassileff</surname> <given-names>N</given-names>
</name>
<name>
<surname>Cheng</surname> <given-names>L</given-names>
</name>
<name>
<surname>Hill</surname> <given-names>AF</given-names>
</name>
</person-group>. <article-title>Extracellular Vesicles - Propagators of Neuropathology and Sources of Potential Biomarkers and Therapeutics for Neurodegenerative Diseases</article-title>. <source>J Cell Sci</source> (<year>2020</year>) <volume>133</volume>(<issue>23</issue>):<fpage>1</fpage>&#x2013;<lpage>15</lpage>. doi: <pub-id pub-id-type="doi">10.1242/jcs.243139</pub-id>
</citation>
</ref>
<ref id="B34">
<label>34</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jeppesen</surname> <given-names>DK</given-names>
</name>
<name>
<surname>Fenix</surname> <given-names>AM</given-names>
</name>
<name>
<surname>Franklin</surname> <given-names>JL</given-names>
</name>
<name>
<surname>Higginbotham</surname> <given-names>JN</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Zimmerman</surname> <given-names>LJ</given-names>
</name>
<etal/>
</person-group>. <article-title>Reassessment of Exosome Composition</article-title>. <source>Cell</source> (<year>2019</year>) <volume>177</volume>(<issue>2</issue>):<fpage>428</fpage>&#x2013;<lpage>45.e18</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.cell.2019.02.029</pub-id>
</citation>
</ref>
<ref id="B35">
<label>35</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Di Liegro</surname> <given-names>CM</given-names>
</name>
<name>
<surname>Schiera</surname> <given-names>G</given-names>
</name>
<name>
<surname>Di Liegro</surname> <given-names>I</given-names>
</name>
</person-group>. <article-title>Extracellular Vesicle-Associated RNA as a Carrier of Epigenetic Information</article-title>. <source>Genes (Basel)</source> (<year>2017</year>) <volume>8</volume>(<issue>10</issue>):<fpage>1</fpage>&#x2013;<lpage>23</lpage>. doi: <pub-id pub-id-type="doi">10.3390/genes8100240</pub-id>
</citation>
</ref>
<ref id="B36">
<label>36</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rompala</surname> <given-names>GR</given-names>
</name>
<name>
<surname>Ferguson</surname> <given-names>C</given-names>
</name>
<name>
<surname>Homanics</surname> <given-names>GE</given-names>
</name>
</person-group>. <article-title>Coincubation of Sperm With Epididymal Extracellular Vesicle Preparations From Chronic Intermittent Ethanol-Treated Mice is Sufficient to Impart Anxiety-Like and Ethanol-Induced Behaviors to Adult Progeny</article-title>. <source>Alcohol</source> (<year>2020</year>) <volume>87</volume>:<page-range>111&#x2013;20</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.alcohol.2020.05.001</pub-id>
</citation>
</ref>
<ref id="B37">
<label>37</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tseng</surname> <given-names>AM</given-names>
</name>
<name>
<surname>Chung</surname> <given-names>DD</given-names>
</name>
<name>
<surname>Pinson</surname> <given-names>MR</given-names>
</name>
<name>
<surname>Salem</surname> <given-names>NA</given-names>
</name>
<name>
<surname>Eaves</surname> <given-names>SE</given-names>
</name>
<name>
<surname>Miranda</surname> <given-names>RC</given-names>
</name>
</person-group>. <article-title>Ethanol Exposure Increases miR-140 in Extracellular Vesicles: Implications for Fetal Neural Stem Cell Proliferation and Maturation</article-title>. <source>Alcoholism Clin Exp Res</source> (<year>2019</year>) <volume>43</volume>(<issue>7</issue>):<page-range>1414&#x2013;26</page-range>. doi: <pub-id pub-id-type="doi">10.1111/acer.14066</pub-id>
</citation>
</ref>
<ref id="B38">
<label>38</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Raineteau</surname> <given-names>O</given-names>
</name>
<name>
<surname>Rietschin</surname> <given-names>L</given-names>
</name>
<name>
<surname>Gradwohl</surname> <given-names>G</given-names>
</name>
<name>
<surname>Guillemot</surname> <given-names>F</given-names>
</name>
<name>
<surname>Gahwiler</surname> <given-names>BH</given-names>
</name>
</person-group>. <article-title>Neurogenesis in Hippocampal Slice Cultures</article-title>. <source>Mol Cell Neurosci</source> (<year>2004</year>) <volume>26</volume>(<issue>2</issue>):<page-range>241&#x2013;50</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.mcn.2004.01.003</pub-id>
</citation>
</ref>
<ref id="B39">
<label>39</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Noraberg</surname> <given-names>J</given-names>
</name>
<name>
<surname>Poulsen</surname> <given-names>FR</given-names>
</name>
<name>
<surname>Blaabjerg</surname> <given-names>M</given-names>
</name>
<name>
<surname>Kristensen</surname> <given-names>BW</given-names>
</name>
<name>
<surname>Bonde</surname> <given-names>C</given-names>
</name>
<name>
<surname>Montero</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Organotypic Hippocampal Slice Cultures for Studies of Brain Damage, Neuroprotection and Neurorepair</article-title>. <source>Curr Drug Targets CNS Neurol Disord</source> (<year>2005</year>) <volume>4</volume>(<issue>4</issue>):<page-range>435&#x2013;52</page-range>. doi: <pub-id pub-id-type="doi">10.2174/1568007054546108</pub-id>
</citation>
</ref>
<ref id="B40">
<label>40</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bonhoeffer</surname> <given-names>T</given-names>
</name>
<name>
<surname>Yuste</surname> <given-names>R</given-names>
</name>
</person-group>. <article-title>Spine Motility. Phenomenology, Mechanisms, and Function</article-title>. <source>Neuron</source> (<year>2002</year>) <volume>35</volume>(<issue>6</issue>):<page-range>1019&#x2013;27</page-range>. doi: <pub-id pub-id-type="doi">10.1016/S0896-6273(02)00906-6</pub-id>
</citation>
</ref>
<ref id="B41">
<label>41</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Weinhard</surname> <given-names>L</given-names>
</name>
<name>
<surname>di Bartolomei</surname> <given-names>G</given-names>
</name>
<name>
<surname>Bolasco</surname> <given-names>G</given-names>
</name>
<name>
<surname>Machado</surname> <given-names>P</given-names>
</name>
<name>
<surname>Schieber</surname> <given-names>NL</given-names>
</name>
<name>
<surname>Neniskyte</surname> <given-names>U</given-names>
</name>
<etal/>
</person-group>. <article-title>Microglia Remodel Synapses by Presynaptic Trogocytosis and Spine Head Filopodia Induction</article-title>. <source>Nat Commun</source> (<year>2018</year>) <volume>9</volume>(<issue>1</issue>):<fpage>1228</fpage>. doi: <pub-id pub-id-type="doi">10.1038/s41467-018-03566-5</pub-id>
</citation>
</ref>
<ref id="B42">
<label>42</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zou</surname> <given-names>J</given-names>
</name>
<name>
<surname>Crews</surname> <given-names>FT</given-names>
</name>
</person-group>. <article-title>Inflammasome-IL-1beta Signaling Mediates Ethanol Inhibition of Hippocampal Neurogenesis</article-title>. <source>Front Neurosci</source> (<year>2012</year>) <volume>6</volume>:<elocation-id>77</elocation-id>. doi: <pub-id pub-id-type="doi">10.3389/fnins.2012.00077</pub-id>
</citation>
</ref>
<ref id="B43">
<label>43</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Walter</surname> <given-names>TJ</given-names>
</name>
<name>
<surname>Crews</surname> <given-names>FT</given-names>
</name>
</person-group>. <article-title>Microglial Depletion Alters the Brain Neuroimmune Response to Acute Binge Ethanol Withdrawal</article-title>. <source>J Neuroinflam</source> (<year>2017</year>) <volume>14</volume>(<issue>1</issue>):<fpage>86</fpage>. doi: <pub-id pub-id-type="doi">10.1186/s12974-017-0856-z</pub-id>
</citation>
</ref>
<ref id="B44">
<label>44</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Qin</surname> <given-names>L</given-names>
</name>
<name>
<surname>Zou</surname> <given-names>J</given-names>
</name>
<name>
<surname>Barnett</surname> <given-names>A</given-names>
</name>
<name>
<surname>Vetreno</surname> <given-names>RP</given-names>
</name>
<name>
<surname>Crews</surname> <given-names>FT</given-names>
</name>
<name>
<surname>Coleman</surname> <given-names>LG</given-names>
</name>
</person-group>. <article-title>TRAIL Mediates Neuronal Death in AUD: A Link Between Neuroinflammation and Neurodegeneration</article-title>. <source>Int J Mol Sci</source> (<year>2021</year>) <volume>22</volume>(<issue>5</issue>):<fpage>2547</fpage>. doi: <pub-id pub-id-type="doi">10.3390/ijms22052547</pub-id>
</citation>
</ref>
<ref id="B45">
<label>45</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Stoppini</surname> <given-names>L</given-names>
</name>
<name>
<surname>Buchs</surname> <given-names>PA</given-names>
</name>
<name>
<surname>Muller</surname> <given-names>D</given-names>
</name>
</person-group>. <article-title>A Simple Method for Organotypic Cultures of Nervous Tissue</article-title>. <source>J Neurosci Methods</source> (<year>1991</year>) <volume>37</volume>(<issue>2</issue>):<page-range>173&#x2013;82</page-range>. doi: <pub-id pub-id-type="doi">10.1016/0165-0270(91)90128-M</pub-id>
</citation>
</ref>
<ref id="B46">
<label>46</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zou</surname> <given-names>JY</given-names>
</name>
<name>
<surname>Crews</surname> <given-names>FT</given-names>
</name>
</person-group>. <article-title>TNF Alpha Potentiates Glutamate Neurotoxicity by Inhibiting Glutamate Uptake in Organotypic Brain Slice Cultures: Neuroprotection by NF Kappa B Inhibition</article-title>. <source>Brain Res</source> (<year>2005</year>) <volume>1034</volume>(<issue>1-2</issue>):<fpage>11</fpage>&#x2013;<lpage>24</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.brainres.2004.11.014</pub-id>
</citation>
</ref>
<ref id="B47">
<label>47</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zou</surname> <given-names>J</given-names>
</name>
<name>
<surname>Crews</surname> <given-names>F</given-names>
</name>
</person-group>. <article-title>CREB and NF-kappaB Transcription Factors Regulate Sensitivity to Excitotoxic and Oxidative Stress Induced Neuronal Cell Death</article-title>. <source>Cell Mol Neurobiol</source> (<year>2006</year>) <volume>26</volume>(<issue>4-6</issue>):<fpage>385</fpage>&#x2013;<lpage>405</lpage>. doi: <pub-id pub-id-type="doi">10.1007/s10571-006-9045-9</pub-id>
</citation>
</ref>
<ref id="B48">
<label>48</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Coleman</surname> <given-names>LG</given-names> <suffix>Jr</suffix>
</name>
<name>
<surname>Zou</surname> <given-names>J</given-names>
</name>
<name>
<surname>Crews</surname> <given-names>FT</given-names>
</name>
</person-group>. <article-title>Microglial-Derived miRNA Let-7 and HMGB1 Contribute to Ethanol-Induced Neurotoxicity <italic>via</italic> TLR7</article-title>. <source>J Neuroinflam</source> (<year>2017</year>) <volume>14</volume>(<issue>1</issue>):<fpage>22</fpage>. doi: <pub-id pub-id-type="doi">10.1186/s12974-017-0799-4</pub-id>
</citation>
</ref>
<ref id="B49">
<label>49</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Willis</surname> <given-names>ML</given-names>
</name>
<name>
<surname>Mahung</surname> <given-names>C</given-names>
</name>
<name>
<surname>Wallet</surname> <given-names>SM</given-names>
</name>
<name>
<surname>Barnett</surname> <given-names>A</given-names>
</name>
<name>
<surname>Cairns</surname> <given-names>BA</given-names>
</name>
<name>
<surname>Coleman</surname> <given-names>LG</given-names> <suffix>Jr</suffix>
</name>
<etal/>
</person-group>. <article-title>Plasma Extracellular Vesicles Released After Severe Burn Injury Modulate Macrophage Phenotype and Function</article-title>. <source>J Leukocyte Biol</source> (<year>2021</year>) <volume>111</volume>:<fpage>33</fpage>&#x2013;<lpage>49</lpage>. doi: <pub-id pub-id-type="doi">10.1002/JLB.3MIA0321-150RR</pub-id>
</citation>
</ref>
<ref id="B50">
<label>50</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Maile</surname> <given-names>R</given-names>
</name>
<name>
<surname>Willis</surname> <given-names>M</given-names>
</name>
<name>
<surname>Herring</surname> <given-names>LE</given-names>
</name>
<name>
<surname>Prevatte</surname> <given-names>A</given-names>
</name>
<name>
<surname>Mahung</surname> <given-names>C</given-names>
</name>
<name>
<surname>Cairns</surname> <given-names>B</given-names>
</name>
<etal/>
</person-group>. <article-title>Burn Injury Induces Proinflammatory Plasma Extracellular Vesicles That Associate With Length of Hospital Stay in Women: CRP and SAA1 as Potential Prognostic Indicators</article-title>. <source>Int J Mol Sci</source> (<year>2021</year>) <volume>22</volume>(<issue>18</issue>):<fpage>1</fpage>&#x2013;<lpage>19</lpage>. doi: <pub-id pub-id-type="doi">10.3390/ijms221810083</pub-id>
</citation>
</ref>
<ref id="B51">
<label>51</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Desai</surname> <given-names>CS</given-names>
</name>
<name>
<surname>Khan</surname> <given-names>A</given-names>
</name>
<name>
<surname>Bellio</surname> <given-names>MA</given-names>
</name>
<name>
<surname>Willis</surname> <given-names>ML</given-names>
</name>
<name>
<surname>Mahung</surname> <given-names>C</given-names>
</name>
<name>
<surname>Ma</surname> <given-names>X</given-names>
</name>
<etal/>
</person-group>. <article-title>Characterization of Extracellular Vesicle miRNA Identified in Peripheral Blood of Chronic Pancreatitis Patients</article-title>. <source>Mol Cell Biochem</source> (<year>2021</year>) <volume>476</volume>:<page-range>4331&#x2013;41</page-range>. doi: <pub-id pub-id-type="doi">10.1007/s11010-021-04248-5</pub-id>
</citation>
</ref>
<ref id="B52">
<label>52</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zou</surname> <given-names>JY</given-names>
</name>
<name>
<surname>Crews</surname> <given-names>FT</given-names>
</name>
</person-group>. <article-title>Release of Neuronal HMGB1 by Ethanol Through Decreased HDAC Activity Activates Brain Neuroimmune Signaling</article-title>. <source>PloS One</source> (<year>2014</year>) <volume>9</volume>(<issue>2</issue>):<elocation-id>e87915</elocation-id>. doi: <pub-id pub-id-type="doi">10.1371/journal.pone.0087915</pub-id>
</citation>
</ref>
<ref id="B53">
<label>53</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Crews</surname> <given-names>FT</given-names>
</name>
<name>
<surname>Qin</surname> <given-names>L</given-names>
</name>
<name>
<surname>Sheedy</surname> <given-names>D</given-names>
</name>
<name>
<surname>Vetreno</surname> <given-names>RP</given-names>
</name>
<name>
<surname>Zou</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>High Mobility Group Box 1/Toll-Like Receptor Danger Signaling Increases Brain Neuroimmune Activation in Alcohol Dependence</article-title>. <source>Biol Psychiatry</source> (<year>2013</year>) <volume>73</volume>(<issue>7</issue>):<page-range>602&#x2013;12</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.biopsych.2012.09.030</pub-id>
</citation>
</ref>
<ref id="B54">
<label>54</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Olson</surname> <given-names>KN</given-names>
</name>
<name>
<surname>Smith</surname> <given-names>SW</given-names>
</name>
<name>
<surname>Kloss</surname> <given-names>JS</given-names>
</name>
<name>
<surname>Ho</surname> <given-names>JD</given-names>
</name>
<name>
<surname>Apple</surname> <given-names>FS</given-names>
</name>
</person-group>. <article-title>Relationship Between Blood Alcohol Concentration and Observable Symptoms of Intoxication in Patients Presenting to an Emergency Department</article-title>. <source>Alcohol Alcohol</source> (<year>2013</year>) <volume>48</volume>(<issue>4</issue>):<page-range>386&#x2013;9</page-range>. doi: <pub-id pub-id-type="doi">10.1093/alcalc/agt042</pub-id>
</citation>
</ref>
<ref id="B55">
<label>55</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Thery</surname> <given-names>C</given-names>
</name>
<name>
<surname>Witwer</surname> <given-names>KW</given-names>
</name>
<name>
<surname>Aikawa</surname> <given-names>E</given-names>
</name>
<name>
<surname>Alcaraz</surname> <given-names>MJ</given-names>
</name>
<name>
<surname>Anderson</surname> <given-names>JD</given-names>
</name>
<name>
<surname>Andriantsitohaina</surname> <given-names>R</given-names>
</name>
<etal/>
</person-group>. <article-title>Minimal Information for Studies of Extracellular Vesicles 2018 (MISEV2018): A Position Statement of the International Society for Extracellular Vesicles and Update of the MISEV2014 Guidelines</article-title>. <source>J Extracel Vesicle.</source> (<year>2018</year>) <volume>7</volume>(<issue>1</issue>):<fpage>1535750</fpage>. doi: <pub-id pub-id-type="doi">10.1080/20013078.2018.1535750</pub-id>
</citation>
</ref>
<ref id="B56">
<label>56</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cvjetkovic</surname> <given-names>A</given-names>
</name>
<name>
<surname>Jang</surname> <given-names>SC</given-names>
</name>
<name>
<surname>Konecna</surname> <given-names>B</given-names>
</name>
<name>
<surname>Hoog</surname> <given-names>JL</given-names>
</name>
<name>
<surname>Sihlbom</surname> <given-names>C</given-names>
</name>
<name>
<surname>Lasser</surname> <given-names>C</given-names>
</name>
<etal/>
</person-group>. <article-title>Detailed Analysis of Protein Topology of Extracellular Vesicles-Evidence of Unconventional Membrane Protein Orientation</article-title>. <source>Sci Rep</source> (<year>2016</year>) <volume>6</volume>:<fpage>36338</fpage>. doi: <pub-id pub-id-type="doi">10.1038/srep36338</pub-id>
</citation>
</ref>
<ref id="B57">
<label>57</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Rong</surname> <given-names>P</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>L</given-names>
</name>
<name>
<surname>He</surname> <given-names>H</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>T</given-names>
</name>
<name>
<surname>Fan</surname> <given-names>Y</given-names>
</name>
<etal/>
</person-group>. <article-title>IL4-Driven Microglia Modulate Stress Resilience Through BDNF-Dependent Neurogenesis</article-title>. <source>Sci Adv</source> (<year>2021</year>) <volume>7</volume>(<issue>12</issue>):<fpage>1</fpage>&#x2013;<lpage>14</lpage>. doi: <pub-id pub-id-type="doi">10.1126/sciadv.abb9888</pub-id>
</citation>
</ref>
<ref id="B58">
<label>58</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Macht</surname> <given-names>V</given-names>
</name>
<name>
<surname>Crews</surname> <given-names>FT</given-names>
</name>
<name>
<surname>Vetreno</surname> <given-names>RP</given-names>
</name>
</person-group>. <article-title>Neuroimmune and Epigenetic Mechanisms Underlying Persistent Loss of Hippocampal Neurogenesis Following Adolescent Intermittent Ethanol Exposure</article-title>. <source>Curr Opin Pharmacol</source> (<year>2020</year>) <volume>50</volume>:<fpage>9</fpage>&#x2013;<lpage>16</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.coph.2019.10.007</pub-id>
</citation>
</ref>
<ref id="B59">
<label>59</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nixon</surname> <given-names>K</given-names>
</name>
<name>
<surname>Crews</surname> <given-names>FT</given-names>
</name>
</person-group>. <article-title>Binge Ethanol Exposure Decreases Neurogenesis in Adult Rat Hippocampus</article-title>. <source>J Neurochem</source> (<year>2002</year>) <volume>83</volume>(<issue>5</issue>):<page-range>1087&#x2013;93</page-range>. doi: <pub-id pub-id-type="doi">10.1046/j.1471-4159.2002.01214.x</pub-id>
</citation>
</ref>
<ref id="B60">
<label>60</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ting</surname> <given-names>K</given-names>
</name>
<name>
<surname>Aitken</surname> <given-names>KJ</given-names>
</name>
<name>
<surname>Penna</surname> <given-names>F</given-names>
</name>
<name>
<surname>Samiei</surname> <given-names>AN</given-names>
</name>
<name>
<surname>Sidler</surname> <given-names>M</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>JX</given-names>
</name>
<etal/>
</person-group>. <article-title>Uropathogenic E. Coli (UPEC) Infection Induces Proliferation Through Enhancer of Zeste Homologue 2 (Ezh2)</article-title>. <source>PloS One</source> (<year>2016</year>) <volume>11</volume>(<issue>3</issue>):<elocation-id>e0149118</elocation-id>. doi: <pub-id pub-id-type="doi">10.1371/journal.pone.0149118</pub-id>
</citation>
</ref>
<ref id="B61">
<label>61</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vedadi</surname> <given-names>M</given-names>
</name>
<name>
<surname>Barsyte-Lovejoy</surname> <given-names>D</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>F</given-names>
</name>
<name>
<surname>Rival-Gervier</surname> <given-names>S</given-names>
</name>
<name>
<surname>Allali-Hassani</surname> <given-names>A</given-names>
</name>
<name>
<surname>Labrie</surname> <given-names>V</given-names>
</name>
<etal/>
</person-group>. <article-title>A Chemical Probe Selectively Inhibits G9a and GLP Methyltransferase Activity in Cells</article-title>. <source>Nat Chem Biol</source> (<year>2011</year>) <volume>7</volume>(<issue>8</issue>):<page-range>566&#x2013;74</page-range>. doi: <pub-id pub-id-type="doi">10.1038/nchembio.599</pub-id>
</citation>
</ref>
<ref id="B62">
<label>62</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>X</given-names>
</name>
<name>
<surname>Horton</surname> <given-names>JR</given-names>
</name>
<name>
<surname>Upadhyay</surname> <given-names>AK</given-names>
</name>
<name>
<surname>Spannhoff</surname> <given-names>A</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>J</given-names>
</name>
<etal/>
</person-group>. <article-title>Structural Basis for G9a-Like Protein Lysine Methyltransferase Inhibition by BIX-01294</article-title>. <source>Nat Struct Mol Biol</source> (<year>2009</year>) <volume>16</volume>(<issue>3</issue>):<page-range>312&#x2013;7</page-range>. doi: <pub-id pub-id-type="doi">10.1038/nsmb.1560</pub-id>
</citation>
</ref>
<ref id="B63">
<label>63</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Richardson</surname> <given-names>HN</given-names>
</name>
<name>
<surname>Chan</surname> <given-names>SH</given-names>
</name>
<name>
<surname>Crawford</surname> <given-names>EF</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>YK</given-names>
</name>
<name>
<surname>Funk</surname> <given-names>CK</given-names>
</name>
<name>
<surname>Koob</surname> <given-names>GF</given-names>
</name>
<etal/>
</person-group>. <article-title>Permanent Impairment of Birth and Survival of Cortical and Hippocampal Proliferating Cells Following Excessive Drinking During Alcohol Dependence</article-title>. <source>Neurobiol Dis</source> (<year>2009</year>) <volume>36</volume>(<issue>1</issue>):<fpage>1</fpage>&#x2013;<lpage>10</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.nbd.2009.05.021</pub-id>
</citation>
</ref>
<ref id="B64">
<label>64</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Geil</surname> <given-names>CR</given-names>
</name>
<name>
<surname>Hayes</surname> <given-names>DM</given-names>
</name>
<name>
<surname>McClain</surname> <given-names>JA</given-names>
</name>
<name>
<surname>Liput</surname> <given-names>DJ</given-names>
</name>
<name>
<surname>Marshall</surname> <given-names>SA</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>KY</given-names>
</name>
<etal/>
</person-group>. <article-title>Alcohol and Adult Hippocampal Neurogenesis: Promiscuous Drug, Wanton Effects</article-title>. <source>Prog Neuropsychopharmacol Biol Psychiatry</source> (<year>2014</year>) <volume>54</volume>:<page-range>103&#x2013;13</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.pnpbp.2014.05.003</pub-id>
</citation>
</ref>
<ref id="B65">
<label>65</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Canales</surname> <given-names>JJ</given-names>
</name>
</person-group>. <article-title>Deficient Plasticity in the Hippocampus and the Spiral of Addiction: Focus on Adult Neurogenesis</article-title>. <source>Curr Top Behav Neurosci</source> (<year>2013</year>) <volume>15</volume>:<fpage>293</fpage>&#x2013;<lpage>312</lpage>. doi: <pub-id pub-id-type="doi">10.1007/7854_2012_230</pub-id>
</citation>
</ref>
<ref id="B66">
<label>66</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sheehy</surname> <given-names>RN</given-names>
</name>
<name>
<surname>Quintanilla</surname> <given-names>LJ</given-names>
</name>
<name>
<surname>Song</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>Epigenetic Regulation in the Neurogenic Niche of the Adult Dentate Gyrus</article-title>. <source>Neurosci Lett</source> (<year>2022</year>) <volume>766</volume>:<fpage>136343</fpage>. doi: <pub-id pub-id-type="doi">10.1016/j.neulet.2021.136343</pub-id>
</citation>
</ref>
<ref id="B67">
<label>67</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rahman</surname> <given-names>MA</given-names>
</name>
<name>
<surname>Patters</surname> <given-names>BJ</given-names>
</name>
<name>
<surname>Kodidela</surname> <given-names>S</given-names>
</name>
<name>
<surname>Kumar</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>Extracellular Vesicles: Intercellular Mediators in Alcohol-Induced Pathologies</article-title>. <source>J Neuroimmune Pharmacol</source> (<year>2020</year>) <volume>15</volume>(<issue>3</issue>):<page-range>409&#x2013;21</page-range>. doi: <pub-id pub-id-type="doi">10.1007/s11481-019-09848-z</pub-id>
</citation>
</ref>
<ref id="B68">
<label>68</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tetta</surname> <given-names>C</given-names>
</name>
<name>
<surname>Ghigo</surname> <given-names>E</given-names>
</name>
<name>
<surname>Silengo</surname> <given-names>L</given-names>
</name>
<name>
<surname>Deregibus</surname> <given-names>MC</given-names>
</name>
<name>
<surname>Camussi</surname> <given-names>G</given-names>
</name>
</person-group>. <article-title>Extracellular Vesicles as an Emerging Mechanism of Cell-to-Cell Communication</article-title>. <source>Endocrine</source> (<year>2013</year>) <volume>44</volume>(<issue>1</issue>):<page-range>11&#x2013;9</page-range>. doi: <pub-id pub-id-type="doi">10.1007/s12020-012-9839-0</pub-id>
</citation>
</ref>
<ref id="B69">
<label>69</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Saha</surname> <given-names>B</given-names>
</name>
<name>
<surname>Momen-Heravi</surname> <given-names>F</given-names>
</name>
<name>
<surname>Kodys</surname> <given-names>K</given-names>
</name>
<name>
<surname>Szabo</surname> <given-names>G</given-names>
</name>
</person-group>. <article-title>MicroRNA Cargo of Extracellular Vesicles From Alcohol-Exposed Monocytes Signals Naive Monocytes to Differentiate Into M2 Macrophages</article-title>. <source>J Biol Chem</source> (<year>2016</year>) <volume>291</volume>(<issue>1</issue>):<page-range>149&#x2013;59</page-range>. doi: <pub-id pub-id-type="doi">10.1074/jbc.M115.694133</pub-id>
</citation>
</ref>
<ref id="B70">
<label>70</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Saha</surname> <given-names>B</given-names>
</name>
<name>
<surname>Momen-Heravi</surname> <given-names>F</given-names>
</name>
<name>
<surname>Furi</surname> <given-names>I</given-names>
</name>
<name>
<surname>Kodys</surname> <given-names>K</given-names>
</name>
<name>
<surname>Catalano</surname> <given-names>D</given-names>
</name>
<name>
<surname>Gangopadhyay</surname> <given-names>A</given-names>
</name>
<etal/>
</person-group>. <article-title>Extracellular Vesicles From Mice With Alcoholic Liver Disease Carry a Distinct Protein Cargo and Induce Macrophage Activation Through Heat Shock Protein 90</article-title>. <source>Hepatology</source> (<year>2018</year>) <volume>67</volume>(<issue>5</issue>):<fpage>1986</fpage>&#x2013;<lpage>2000</lpage>. doi: <pub-id pub-id-type="doi">10.1002/hep.29732</pub-id>
</citation>
</ref>
<ref id="B71">
<label>71</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Brandon-Warner</surname> <given-names>E</given-names>
</name>
<name>
<surname>Feilen</surname> <given-names>NA</given-names>
</name>
<name>
<surname>Culberson</surname> <given-names>CR</given-names>
</name>
<name>
<surname>Field</surname> <given-names>CO</given-names>
</name>
<name>
<surname>deLemos</surname> <given-names>AS</given-names>
</name>
<name>
<surname>Russo</surname> <given-names>MW</given-names>
</name>
<etal/>
</person-group>. <article-title>Processing of Mir17-92 Cluster in Hepatic Stellate Cells Promotes Hepatic Fibrogenesis During Alcohol-Induced Injury</article-title>. <source>Alcoholism Clin Exp Res</source> (<year>2016</year>) <volume>40</volume>(<issue>7</issue>):<page-range>1430&#x2013;42</page-range>. doi: <pub-id pub-id-type="doi">10.1111/acer.13116</pub-id>
</citation>
</ref>
<ref id="B72">
<label>72</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mukherjee</surname> <given-names>S</given-names>
</name>
<name>
<surname>Cabrera</surname> <given-names>MA</given-names>
</name>
<name>
<surname>Boyadjieva</surname> <given-names>NI</given-names>
</name>
<name>
<surname>Berger</surname> <given-names>G</given-names>
</name>
<name>
<surname>Rousseau</surname> <given-names>B</given-names>
</name>
<name>
<surname>Sarkar</surname> <given-names>DK</given-names>
</name>
</person-group>. <article-title>Alcohol Increases Exosome Release From Microglia to Promote Complement C1q Induced Cellular Death of Proopiomelanocortin Neurons in the Hypothalamus in a Rat Model of Fetal Alcohol Spectrum Disorders</article-title>. <source>J Neurosci</source> (<year>2020</year>) <volume>40</volume>:<page-range>7965&#x2013;79</page-range>. doi: <pub-id pub-id-type="doi">10.1523/JNEUROSCI.0284-20.2020</pub-id>
</citation>
</ref>
<ref id="B73">
<label>73</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ibanez</surname> <given-names>F</given-names>
</name>
<name>
<surname>Montesinos</surname> <given-names>J</given-names>
</name>
<name>
<surname>Urena-Peralta</surname> <given-names>JR</given-names>
</name>
<name>
<surname>Guerri</surname> <given-names>C</given-names>
</name>
<name>
<surname>Pascual</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>TLR4 Participates in the Transmission of Ethanol-Induced Neuroinflammation <italic>via</italic> Astrocyte-Derived Extracellular Vesicles</article-title>. <source>J Neuroinflam</source> (<year>2019</year>) <volume>16</volume>(<issue>1</issue>):<fpage>136</fpage>. doi: <pub-id pub-id-type="doi">10.1186/s12974-019-1529-x</pub-id>
</citation>
</ref>
<ref id="B74">
<label>74</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>C</given-names>
</name>
</person-group>. <article-title>Effects of Exosomes on Adult Hippocampal Neurogenesis and Neuropsychiatric Disorders</article-title>. <source>Mol Biol Rep</source> (<year>2022</year>). doi: <pub-id pub-id-type="doi">10.1007/s11033-022-07313-4</pub-id>
</citation>
</ref>
<ref id="B75">
<label>75</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lee</surname> <given-names>JY</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>E</given-names>
</name>
<name>
<surname>Choi</surname> <given-names>SM</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>DW</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>KP</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>I</given-names>
</name>
<etal/>
</person-group>. <article-title>Microvesicles From Brain-Extract-Treated Mesenchymal Stem Cells Improve Neurological Functions in a Rat Model of Ischemic Stroke</article-title>. <source>Sci Rep</source> (<year>2016</year>) <volume>6</volume>:<fpage>33038</fpage>. doi: <pub-id pub-id-type="doi">10.1038/srep33038</pub-id>
</citation>
</ref>
<ref id="B76">
<label>76</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Coleman</surname> <given-names>LG</given-names>
</name>
</person-group>. <article-title>The Emerging World of Subcellular Biological Medicine: Extracellular Vesicles as Novel Biomarkers, Targets, and Therapeutics</article-title>. <source>Neural Regener Res</source> (<year>2022</year>) <volume>17</volume>(<issue>5</issue>):<page-range>1020&#x2013;2</page-range>. doi: <pub-id pub-id-type="doi">10.4103/1673-5374.324846</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>