<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Immunol.</journal-id>
<journal-title>Frontiers in Immunology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Immunol.</abbrev-journal-title>
<issn pub-type="epub">1664-3224</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fimmu.2022.862491</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Immunology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>B-Cell Epitope Mapping of TprC and TprD Variants of <italic>Treponema pallidum</italic> Subspecies Informs Vaccine Development for Human Treponematoses</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Molini</surname>
<given-names>Barbara</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Fernandez</surname>
<given-names>Mark C.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1726237"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Godornes</surname>
<given-names>Charmie</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Vorobieva</surname>
<given-names>Anastassia</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1726251"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Lukehart</surname>
<given-names>Sheila A.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/16382"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Giacani</surname>
<given-names>Lorenzo</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/237321"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Department of Medicine, University of Washington</institution>, <addr-line>Seattle, WA</addr-line>, <country>United States</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>VIB-VUB Center for Structural Biology, VIB</institution>, <addr-line>Brussels</addr-line>, <country>Belgium</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Structural Biology Brussels, Vrije Universiteit Brussel</institution>, <addr-line>Brussels</addr-line>, <country>Belgium</country>
</aff>
<aff id="aff4">
<sup>4</sup>
<institution>Department of Global Health, University of Washington</institution>, <addr-line>Seattle, WA</addr-line>, <country>United States</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Pingyu Zhou, Tongji University, China</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Steven J. Norris, University of Texas Health Science Center at Houston, United States; Yi-Pin Lin, Wadsworth Center, United States; Feijun Zhao, University of South China, China</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Lorenzo Giacani, <email xlink:href="mailto:giacal@u.washington.edu">giacal@u.washington.edu</email>
</p>
</fn>
<fn fn-type="other" id="fn002">
<p>This article was submitted to Microbial Immunology, a section of the journal Frontiers in Immunology</p>
</fn>
<fn fn-type="equal" id="fn003">
<p>&#x2020;These authors have contributed equally to this work</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>29</day>
<month>03</month>
<year>2022</year>
</pub-date>
<pub-date pub-type="collection">
<year>2022</year>
</pub-date>
<volume>13</volume>
<elocation-id>862491</elocation-id>
<history>
<date date-type="received">
<day>26</day>
<month>01</month>
<year>2022</year>
</date>
<date date-type="accepted">
<day>07</day>
<month>03</month>
<year>2022</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2022 Molini, Fernandez, Godornes, Vorobieva, Lukehart and Giacani</copyright-statement>
<copyright-year>2022</copyright-year>
<copyright-holder>Molini, Fernandez, Godornes, Vorobieva, Lukehart and Giacani</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>Several recent studies have focused on the identification, functional analysis, and structural characterization of outer membrane proteins (OMPs) of <italic>Treponema pallidum</italic> (<italic>Tp</italic>). The <italic>Tp</italic> species encompasses the highly related <italic>pallidum</italic>, <italic>pertenue</italic>, and <italic>endemicum</italic> subspecies of this pathogen, known to be the causative agents of syphilis, yaws, and bejel, respectively. These studies highlighted the importance of identifying surface-exposed OMP regions and the identification of B-cell epitopes that could be protective and used in vaccine development efforts. We previously reported that the TprC and TprD OMPs of <italic>Tp</italic> are predicted to contain external loops scattered throughout the entire length of the proteins, several of which show a low degree of sequence variability among strains and subspecies. In this study, these models were corroborated using AlphaFold2, a state-of-the-art protein structure modeling software. Here, we identified B-cell epitopes across the full-length TprC and TprD variants using the Geysan pepscan mapping approach with antisera from rabbits infected with syphilis, yaws, and bejel strains and from animals immunized with refolded recombinant TprC proteins from three syphilis strains. Our results show that the humoral response is primarily directed to sequences predicted to be on surface-exposed loops of TprC and TprD proteins, and that the magnitude of the humoral response to individual epitopes differs among animals infected with various syphilis strains and <italic>Tp</italic> subspecies. Rather than exhibiting strain-specificity, antisera showed various degrees of cross-reactivity with variant sequences from other strains. The data support the further exploration of TprC and TprD as vaccine candidates.</p>
</abstract>
<kwd-group>
<kwd>
<italic>Treponema pallidum</italic>
</kwd>
<kwd>syphilis</kwd>
<kwd>Tpr proteins</kwd>
<kwd>B-cell epitope mapping</kwd>
<kwd>vaccine development</kwd>
</kwd-group>
<contract-sponsor id="cn001">Office of Research Central, University of Washington<named-content content-type="fundref-id">10.13039/100013350</named-content>
</contract-sponsor>
<contract-sponsor id="cn002">Office of Research Central, University of Washington<named-content content-type="fundref-id">10.13039/100013350</named-content>
</contract-sponsor>
<contract-sponsor id="cn003">Open Philanthropy Project<named-content content-type="fundref-id">10.13039/100014895</named-content>
</contract-sponsor>
<counts>
<fig-count count="6"/>
<table-count count="0"/>
<equation-count count="0"/>
<ref-count count="67"/>
<page-count count="15"/>
<word-count count="7785"/>
</counts>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<title>Introduction</title>
<p>The human treponematoses (syphilis, yaws, and bejel) are caused by a group of highly related pathogens classified as subspecies of the spirochete bacterium <italic>Treponema pallidum</italic> (<italic>Tp</italic>). Classically, the <italic>pallidum</italic> subspecies is said to causes syphilis, while the <italic>pertenue</italic> and <italic>endemicum</italic> subspecies are regarded as the causes of yaws and bejel, respectively (<xref ref-type="bibr" rid="B1">1</xref>), although the modes of transmission and the clinical manifestations may overlap among subspecies. These diseases are still a concern for public and global health, as they continue to result in substantial morbidity and mortality worldwide. According to the World Health Organization, the global prevalence of syphilis is ~20 million cases, with an incidence of ~6.3 million new cases every year (<xref ref-type="bibr" rid="B2">2</xref>). Although most of these infections occur in low- and middle-income countries, syphilis has resurged also in industrialized nations (<xref ref-type="bibr" rid="B3">3</xref>&#x2013;<xref ref-type="bibr" rid="B7">7</xref>). If left untreated, syphilis can progress to affect the cardiovascular and central nervous systems of patients, potentially leading to death (<xref ref-type="bibr" rid="B8">8</xref>). Additionally, vertical transmission of syphilis is estimated to account for ~1/3 of stillbirths in sub-Saharan Africa (<xref ref-type="bibr" rid="B9">9</xref>, <xref ref-type="bibr" rid="B10">10</xref>). Past public health initiatives to eliminate syphilis and congenital syphilis promoted by the CDC and WHO (<xref ref-type="bibr" rid="B11">11</xref>, <xref ref-type="bibr" rid="B12">12</xref>) have significantly aided in reducing syphilis incidence and in generating awareness of this disease, but have not achieved their intended elimination goals. Compared to syphilis, less accurate epidemiological data are available on yaws and bejel (<xref ref-type="bibr" rid="B13">13</xref>). While the ongoing yaws elimination campaign in Asia and Africa using mass administration of azithromycin has demonstrated promising results (<xref ref-type="bibr" rid="B14">14</xref>), such efforts could be undermined by the spreading of macrolide resistant <italic>Tp</italic> subsp. <italic>pertenue</italic>, as recently demonstrated in Papua New Guinea (<xref ref-type="bibr" rid="B15">15</xref>). Foci of bejel have been reported in the last two decades, mostly in the Near East and Sahelian Africa (<xref ref-type="bibr" rid="B16">16</xref>&#x2013;<xref ref-type="bibr" rid="B19">19</xref>), and bejel strains have recently reported to be transmitted sexually (<xref ref-type="bibr" rid="B20">20</xref>).</p>
<p>The chance of success of current and future control campaigns for all treponematoses would significantly increase if effective vaccines were available (<xref ref-type="bibr" rid="B21">21</xref>, <xref ref-type="bibr" rid="B22">22</xref>). The most rational approach to vaccine development for these infections requires a clear understanding of the type of immune response that is protective and the identification of suitable candidate antigens to be tested in a pre-clinical animal model (<xref ref-type="bibr" rid="B21">21</xref>, <xref ref-type="bibr" rid="B22">22</xref>). Furthermore, because there is very limited or no cross-immunity between subspecies of <italic>Tp</italic> and only sporadic cross-immunity between syphilis strains (<xref ref-type="bibr" rid="B23">23</xref>, <xref ref-type="bibr" rid="B24">24</xref>), the identification of antigenic differences in potential vaccine candidates among subspecies and strains is of pivotal importance, as such differences could be key to devising a broadly protective vaccine (<xref ref-type="bibr" rid="B22">22</xref>). There is consensus that vaccine candidates are most likely to be found among these spirochetes&#x2019; surface-exposed antigens, such as (but not limited to) integral outer membrane proteins (OMPs). Integral <italic>Tp</italic> OMPs will necessarily contain a membrane-embedded &#x3b2;-barrel domain composed of antiparallel &#x3b2;-strands joined together by loops that alternatively protrude toward the extracellular environment or the periplasm (<xref ref-type="bibr" rid="B25">25</xref>). Because <italic>Tp</italic> clearance from early lesions is dependent on opsonophagocytosis of <italic>Tp</italic> cells by activated macrophages (<xref ref-type="bibr" rid="B26">26</xref>, <xref ref-type="bibr" rid="B27">27</xref>), the identification of surface-exposed epitopes that can be targeted by immunization to induce opsonic antibodies and promote macrophage activation is key to vaccine development. Such tasks, however, have been historically challenging due to the inability to steadily propagate the <italic>Tp</italic> subspecies <italic>in vitro</italic>, which was only recently achieved (<xref ref-type="bibr" rid="B28">28</xref>), and also because of the uncommon fragility and limited protein content of these spirochetes&#x2019; OM (<xref ref-type="bibr" rid="B29">29</xref>, <xref ref-type="bibr" rid="B30">30</xref>). These limitations have been partially overcome by the ability to predict <italic>in silico</italic> OMP-encoding genes and the structure of their encoded proteins, enabling investigation using structural and functional experimental approaches (<xref ref-type="bibr" rid="B31">31</xref>, <xref ref-type="bibr" rid="B32">32</xref>).</p>
<p>Among <italic>Tp</italic> putative OMPs identified to date, there are several members of the <italic>
<underline>T</underline>. <underline>p</underline>allidum</italic> <underline>r</underline>epeat (Tpr) family of paralogous proteins, including TprC and TprD (encoded by the <italic>tp0117</italic> and <italic>tp0131</italic> genes in the reference Nichols strain, respectively) (<xref ref-type="bibr" rid="B33">33</xref>); these are reported to have OM localization and porin activity (<xref ref-type="bibr" rid="B34">34</xref>, <xref ref-type="bibr" rid="B35">35</xref>). These paralogs have been identified as vaccine candidates by past studies in which it was demonstrated that the N-terminal conserved region of these antigens elicited strong antibody and T-cell responses during infection, and immunization with this region attenuates syphilitic lesion development upon infectious challenge (<xref ref-type="bibr" rid="B36">36</xref>). In this study, we examine the protein sequence variation in TprC and TprD among <italic>T. pallidum</italic> strains and subspecies, and predict, then confirm, the locations of B cell epitopes using antisera from infected and immunized rabbits. Variant specificity and cross-reactivity are analyzed so that epitopes with broad coverage among strains and subspecies can be identified for future evaluation as vaccine antigens.</p>
</sec>
<sec id="s2" sec-type="results">
<title>Results</title>
<sec id="s2_1">
<title>Sequence Analysis of TprC and TprD Variants</title>
<p>Although the TprC and TprD proteins are identical in the Nichols, Chicago, and Bal73-1 strains, allelic variants of TprC and TprD exist among syphilis strains and the three <italic>Tp</italic> subspecies (<xref ref-type="bibr" rid="B35">35</xref>, <xref ref-type="bibr" rid="B37">37</xref>). Among the treponemal strains used in this study (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>), four alleles were found at the <italic>tprD</italic> locus, which include the reference <italic>tprD</italic> allele (found in the syphilis Nichols, Chicago, and Bal73-1 strains), and the <italic>tprD2</italic> allele (found in the syphilis strains MexicoA, Sea81-4, Bal3, and UW249) which encodes the TprD<sub>2</sub> protein (<xref ref-type="bibr" rid="B35">35</xref>). Also the subsp. <italic>pertenue</italic> SamoaD strain and subsp. <italic>endemicum</italic> IraqB strains harbor a <italic>tprD<sub>2</sub>
</italic> allele in the <italic>tprD</italic> locus, but their TprD<sub>2</sub> amino acid sequences differ from the subsp. <italic>pallidum</italic> TprD<sub>2</sub> sequence due to five amino acid substitutions scattered throughout the length of the protein (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>) (<xref ref-type="bibr" rid="B35">35</xref>). TprD2 has four unique regions that differentiate it from the reference TprD sequence. These include a large central region of 110 amino acids and three smaller regions toward the COOH-terminal end of the protein (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>) (<xref ref-type="bibr" rid="B35">35</xref>). As previously reported, the <italic>tprC</italic> locus of MexicoA, Sea81-4, and Bal3 encodes a TprC variant with a limited number of amino acid (aa) changes (15 aa for MexicoA, 9 aa for Sea81-4, and 9 aa for Bal3) compared to the reference TprC found in Nichols, Chicago, and Bal73-1 strains (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>) (<xref ref-type="bibr" rid="B35">35</xref>). The TprC protein of the <italic>pertenue</italic> and <italic>endemicum</italic> strains studied here also shows limited amino acid changes compared to the reference TprC (31 aa for SamoaD and 26 aa for IraqB; <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>), albeit higher compared to the subsp. <italic>pallidum</italic> strain (<xref ref-type="bibr" rid="B35">35</xref>). We previously reported that TprC and TprD/D<sub>2</sub> sequence variation does not occur randomly, but rather is localized in discrete variable regions (DVRs; <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>) (<xref ref-type="bibr" rid="B35">35</xref>). When TprC and TprD variants are compared (with the exclusion of TprD<sub>2</sub>), seven DVRs are found throughout the protein sequence, while 8 DVRs can be identified within the TprD<sub>2</sub> sequences (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>). To obtain predictions of TprC and TprD<sub>2</sub> structures from their amino acid sequences (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>) and map the DVRs on these models, we used the recently developed AlphaFold2 software (<uri xlink:href="https://AlphaFold.ebi.ac.uk/">https://AlphaFold.ebi.ac.uk/</uri>) (<xref ref-type="bibr" rid="B38">38</xref>). These new models revealed remarkably similar structures for TprC and TprD<sub>2</sub> and identified these proteins as relatively large &#x3b2;-barrel integral OMPs of 20 &#x3b2;-strands connected by ten external loops (ExLs, protruding toward the extracellular milieu), and nine periplasmic loops (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>). Elevated structural identity of the transmembrane region was also supported by a 0.75 backbone root-mean-square deviation (RMSD) score (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>). The local model quality, indicated by the Predicted Local Distance Difference Test (pLDDT) value was high in the transmembrane and periplasmic loop regions, and slightly lower in the predicted ExLs, suggesting conformational flexibility (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2B</bold>
</xref>). Except for two substitutions (aa 407 and 410 mapping to a periplasmic &#x3b2;-turn), all DVRs localized within a subset of the surface-exposed ExLs (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2C</bold>
</xref>). More specifically, DVRs were located in ExL1, ExL5-6 and ExL8-10 of the TprC and TprD<sub>2</sub> models; while ExL2-4 harbored conserved loops. ExL6 is also conserved between TprD<sub>2</sub> sequences from various isolates, although its shows only 60% of sequence identity to the ExL6 of other TprC and TprD variants (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>). DALI software (<xref ref-type="bibr" rid="B39">39</xref>) and PDB analyses to identify structurally similar porins (<xref ref-type="supplementary-material" rid="ST1">
<bold>Table S1</bold>
</xref>) showed that the highest-scoring structures did not contain the exact number of &#x3b2;-strands predicted by AlphaFold2 for TprC and TprD<sub>2</sub> &#x3b2;-barrels, but slightly higher or slightly lower, but well within the models of integral OMPs with no large periplasmic domains. These results suggest that these Tpr proteins belong to a new family of porins not yet represented in the PDB database.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Alignment of amino acid sequences of the TprC and TprD/D<sub>2</sub> variants. <italic>Tp.</italic> subsp. <italic>pallidum</italic> strains (Nichols, MexicoA, Sea81-4, Bal3, and UW249) are indicated in red font on the left of the sequence. The <italic>Tp</italic> subsp. <italic>pertenue</italic> strain (SamoaD) is in green font, and the <italic>Tp</italic> subsp. <italic>endemicum</italic> (IraqB) strain is in blue font. The Chicago and Bal73-1 TprC and TprD sequences (not shown) are identical to the Nichols strain. The MexicoA, Sea8-14, Bal3, UW249, SamoaD, and IraqB strains harbor a TprD<sub>2</sub> variant within the <italic>tprD</italic> locus. CSP, predicted cleavable signal peptide; ExL, External Loop. Amino acids encompassing the ExLs predicted by AlphaFold2 are highlighted in red with yellow text only in the top sequence. DVR, Discrete Variable Region. DVRs are highlighted in black along the ruler. *Indicates a DVR found in TprD<sub>2</sub> but not TprC and TprD variants.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-862491-g001.tif"/>
</fig>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Predicted structures of TprC and TprD<sub>2</sub> using AlphaFold2. TprC and TprD<sub>2</sub> sequences were obtained from the Sea81-4 genome (NZ_CP003679.1/CP003679.1). <bold>(A)</bold> Both TprC and TprD<sub>2</sub> are predicted to fold into similar 20-strands beta-barrels structures. The predicted structures are nearly identical in the transmembrane region (backbone RMSD = 0.75). <bold>(B)</bold> Compared to the scaffolding, slightly lower confidence in the structural models for TprC and TprD<sub>2</sub> are seen in the external loop regions based on the per-residue model confidence (pLDDT) mapped on the predicted TprC and TprD<sub>2</sub> structures, suggesting structural flexibility for these regions. Noteworthy, however, is that the largest loop (ExL7) is predicted to have a similar helical-rich structure in both TprC and TprD<sub>2</sub>. Full pLDDT analysis for TprC and TprD<sub>2</sub> is reported in <xref ref-type="supplementary-material" rid="ST1">
<bold>Figure S3</bold>
</xref>. <bold>(C)</bold> The DVRs (in red on the TprC model structure) identified by aligning TprC and TprD<sub>2</sub> sequences of different strains (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>) mostly localize in the predicted extracellular loops. <bold>(D)</bold> AlphaFold identified ten surface-exposed external loops (ExLs). Discrete variable regions (DVRs) based on <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref> alignments are predicted to be in ExL1, ExL5-6 and ExL8-10.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-862491-g002.tif"/>
</fig>
<p>
<italic>In silico</italic> prediction of B-cell epitopes using BepiPred2.0 (<uri xlink:href="http://www.cbs.dtu.dk/services/BepiPred/">http://www.cbs.dtu.dk/services/BepiPred/</uri>), IEDB (<uri xlink:href="https://www.iedb.org/">https://www.iedb.org/</uri>), and BCpreds (<uri xlink:href="http://ailab-projects1.ist.psu.edu:8080/bcpred/data.html">http://ailab-projects1.ist.psu.edu:8080/bcpred/data.html</uri>) (<xref ref-type="supplementary-material" rid="ST1">
<bold>Tables S2&#x2013;S5</bold>
</xref> and <xref ref-type="supplementary-material" rid="ST1">
<bold>Figure S1</bold>
</xref>) showed that the putative TprC and TprD ExLs were also enriched in immunogenic epitopes. Therefore, it is possible that the antigenic variability in the ExLs regions has functional significance in immunity to the <italic>T. pallidum</italic> subspecies. To validate the B-cell epitope prediction and evaluate the cross-reactivity of these epitopes across species and strains, we performed experimental B-cell epitope mapping of the TprC, and TprD/D<sub>2</sub> proteins with a Geysan pepscan approach based on overlapping synthetic peptides (<xref ref-type="bibr" rid="B40">40</xref>) using sera from animals infected with <italic>Tp</italic> subsp. <italic>pallidum</italic>, <italic>Tp</italic> subsp. <italic>pertenue</italic>, and <italic>Tp</italic> subsp. <italic>endemicum</italic> strains. Furthermore, we compared antibody reactivity in sera from infected rabbits with that of sera from rabbits immunized with a subset of full-length refolded recombinant TprC proteins.</p>
</sec>
<sec id="s2_2">
<title>Humoral Responses to Homologous TprC and TprD/D<sub>2</sub> Peptides in Experimentally Infected Rabbits</title>
<p>Groups of three laboratory rabbits were infected intratesticularly (IT) with one of seven syphilis strains (Nichols, Chicago, Bal73-1, MexicoA, Sea81-4, Bal3, and UW249), one yaws strain (SamoaD), and one bejel strain (IraqB). From these animals, serum samples were obtained at day 30, 60, and 90 post-infection. Pooled sera from animals in each infection group/time point were tested in ELISA to assess reactivity to homologous overlapping synthetic peptides (20-mers overlapping by 10 amino acids) representing the TprC and TprD/D<sub>2</sub> variants previously identified in each strain. The full list of synthetic peptides used in this study, with amino acids encompassing predicted ExLs highlighted in red with yellow text, and percentage amino acid homology among peptides across strains is shown in <xref ref-type="supplementary-material" rid="ST1">
<bold>Table S6</bold>
</xref>. Peptide nomenclature is explained in <xref ref-type="supplementary-material" rid="ST1">
<bold>Table S6</bold>
</xref> footnote. Cumulative absorbance data from the three timepoints (sum of the mean absorbance values for day 30, 60, 90 values for each infected rabbit group) are reported in <xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3A&#x2013;C</bold>
</xref>. Epitope mapping studies of the NH<sub>2</sub>-terminal portion of the protein resulted in the identification of six highly reactive peptide regions (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref>) representing sequences shared by all TprC and TprD genes in the studied subspecies <italic>pallidum</italic> strains: C1-C3, C6, C13-C14, C18, C20, and C25-C29. Based on AlphaFold2 structural predictions, 9 of these 13 peptides had at least 7 amino acids mapping to the predicted external loops of the protein, while only four reside in predicted transmembrane scaffolding and periplasmic loop regions (C1, C6, C20 and C25; <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref> and <xref ref-type="supplementary-material" rid="ST1">
<bold>Table S7</bold>
</xref>). It is noteworthy that all three B cell epitope prediction programs uniformly predicted all six of the experimentally determined epitope-containing regions of the NH<sub>2</sub>-terminal portion of the subspecies <italic>pallidum</italic> TprC and D proteins (<xref ref-type="supplementary-material" rid="ST1">
<bold>Tables S2&#x2013;S5</bold>
</xref> and <xref ref-type="supplementary-material" rid="ST1">
<bold>Figure S1</bold>
</xref>).</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Reactivity of sera from experimentally infected animals to homologous peptides representing the TprC, TprD and TprD<sub>2</sub> variants. <bold>(A)</bold> Reactivity to homologous peptides spanning TprC and TprD proteins of sera from rabbits infected with <italic>Tp</italic> subsp. <italic>pallidum</italic> (Nichols, Chicago, Bal73-1, MexicoA, Sea81-4, Bal3, and UW249B) collected at day 30, 60, and 90 post-infection. Nichols, Chicago, and Bal73-1 sequences are identical. <bold>(B)</bold> Reactivity to homologous peptides spanning TprC variants of immune sera from groups of rabbits infected with <italic>Tp</italic> subsp. <italic>pertenue</italic> (SamoaD) or <italic>Tp</italic> subsp. <italic>endemicum</italic> (IraqB) strains collected at day 30, 60, and 90 post-infection. <bold>(C)</bold> Reactivity to homologous peptides spanning TprD and TprD<sub>2</sub> variants of sera collected at day 30, 60, and 90 post-infection from all TprD<sub>2</sub>-containing <italic>Tp</italic> subspecies and strains studied here. Cumulative Absorbance values are the sum of the mean OD values obtained from all animals in the infection group at all three time points. Boxed peptides contain at least seven amino acids (35% of the peptide length) belonging to a predicted ExL. Strain names on x axis are abbreviated as follows: N, Nichols; M, MexicoA; Sea, Sea81-4; B, Bal3; U, UW249; S, SamoaD; I, IraqB.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-862491-g003.tif"/>
</fig>
<p>Several epitopes were also identified in the COOH-terminal region of these proteins, and corresponded to peptides the same regions in <italic>pallidum</italic> and non-<italic>pallidum</italic> subspecies: C46 and C47 homologs from Nichols (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref> and <xref ref-type="supplementary-material" rid="ST1">
<bold>Table S7</bold>
</xref>), SamoaD (S-C46, S-C47; <xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3B</bold>
</xref> and <xref ref-type="supplementary-material" rid="ST1">
<bold>Table S7</bold>
</xref>) and IraqB (I-C46, I-C47; <xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3B</bold>
</xref> and <xref ref-type="supplementary-material" rid="ST1">
<bold>Table S7</bold>
</xref>), C51 homologs from Nichols (N-C51), SamoaD and iraqB (S/I-C51) (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3A, B</bold>
</xref> and <xref ref-type="supplementary-material" rid="ST1">
<bold>Table S7</bold>
</xref>); and C53-C55 homologs from Nichols, Bal3/Sea81-4 (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref> and <xref ref-type="supplementary-material" rid="ST1">
<bold>Table S7</bold>
</xref>), and IraqB (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3B</bold>
</xref> and <xref ref-type="supplementary-material" rid="ST1">
<bold>Table S7</bold>
</xref>). Similarly, the C43, and D45-D47 (ExL8) peptides, mapping to the TprD<sub>2</sub> COOH-terminus were found to contain B-cell epitope(s) (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3C</bold>
</xref> and <xref ref-type="supplementary-material" rid="ST1">
<bold>Table S7</bold>
</xref>). Additional TprD<sub>2</sub> peptides found to be reactive were D33-D35 (ExL6), I-C39, D40-41 (ExL7), C49, and D51 (ExL9). In our 3D models of these proteins, all the reactive peptides in the COOH-terminus fall within predicted ExLs (<xref ref-type="supplementary-material" rid="ST1">
<bold>Tables S6&#x2013;S7</bold>
</xref> and <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>), except for C43, most of I-C39 (75%), C49, and C53, which are predicted transmembrane scaffolding sequences. Of these &#x201c;scaffold epitopes&#x201d;, only one (C43) was predicted by a B-cell prediction program (<xref ref-type="supplementary-material" rid="ST1">
<bold>Tables S2&#x2013;S5</bold>
</xref> and <xref ref-type="supplementary-material" rid="ST1">
<bold>Figure S1</bold>
</xref>).</p>
<p>The percentage of immune sera that showed reactivity to many of the peptides was variable. For example, peptides C3, and C13 were recognized by rabbits infected with 28% of the <italic>Tp</italic> subsp. <italic>pallidum</italic> strains; peptides C1, and C27 were recognized by rabbits infected with 42% of the strains; peptides C14 and C28 were recognized by rabbits infected with 57% of the strains; C6 was recognized by rabbits infected with 71% of the strains; and peptides C2 and C18 were recognized by rabbits infected with 85% of the <italic>Tp</italic> subsp. <italic>pallidum</italic> strains (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>). Overall, based upon the AlphaFold2 models, these results show that humoral reactivity elicited to these Tpr antigens during experimental infection is directed primarily to predicted surface-exposed regions of the TprC/D and TprD<sub>2</sub> proteins.</p>
</sec>
<sec id="s2_3">
<title>Reactivity to Non-Homologous TprC and TprD<sub>2</sub> Peptides</title>
<p>Epitope mapping using short peptides based on the TprC and TprD/D<sub>2</sub> sequences from multiple <italic>Tp</italic> strains and sera from infected animals also allowed us to investigate cross-reactivity to non-homologous peptides to determine the fine specificity of the antibody response to these antigens. Such analyses focused on peptides mapping to the proteins` COOH-terminal regions, due to the higher sequence variability in this region, compared to the more conserved NH<sub>2</sub>-terminal region (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>). Major variable regions include peptides C46 - C47 (mapping to the predicted ExL8), C51 (ExL9), and C55 (ExL10) (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref> and <xref ref-type="supplementary-material" rid="ST1">
<bold>Tables S6&#x2013;S7</bold>
</xref>). Four distinct variants of each of the C46, C47, and C55 peptides, and three variants of C51, representing all sequences found in the strains studied here, were tested against all nine pools of immune sera obtained at day-90 post-experimental infection.</p>
<p>As shown in <xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4A&#x2013;D</bold>
</xref>, very few sera were reactive only to their homologous peptide. For example, the Bal73-1and SamoaD antisera were primarily reactive only to their own C46 sequences (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4A</bold>
</xref>), although the Bal73-1 antiserum showed a very modest reactivity to the IraqB peptide variant (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4A</bold>
</xref>). When reactivity against the C47 peptide was analyzed, the Chicago, Bal73-1 sera reacted only to their own peptide, the IraqB antiserum reacted to all variants but the SamoaD peptide, and the Sea81-4 serum only saw the Nichols C46 variant, but not its homologous peptide. (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4B</bold>
</xref>). Only Chicago, Bal73-1, and SamoaD sera showed complete strain-specificity for the C51 peptides (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4C</bold>
</xref>), while none of the sera reactive to C55 showed complete strain-specificity (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4D</bold>
</xref>). When tested against TprD2 peptides, most antisera did not show any reactivity. There were, however, two exceptions, as the Chicago sera cumulatively showed reactivity to the D34 and D47 peptides, with OD values of 3.6 and 6.6, respectively. However, only the D47 peptide was consistently recognized at all time points, while D34 was recognized only at day 60. Overall, these data indicate that cross reactivity is possible, and perhaps suggest that immunization with a given sequence might generate cross-reactive antibodies able to overcome the obstacle of sequence diversity among TprC epitopes, a feature that is desirable in vaccine development as they may be broadly opsonic or neutralizing.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Reactivity of sera from experimentally infected animals to homologous and non-homologous peptides C46, C47, C51, and C55. Humoral reactivity of day-90 sera from experimentally infected animals to homologous and non-homologous TprC peptides. <bold>(A-D)</bold> reactivity to C46, C47, C51, and C55 variants. Strain names on x axes are abbreviated as follows: N, Nichols; M, MexicoA; Sea, Sea81-4; B, Bal3; U, UW249; S, SamoaD; I, IraqB.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-862491-g004.tif"/>
</fig>
</sec>
<sec id="s2_4">
<title>Humoral Response to TprC Peptides Following Rabbit Immunization With Full-Length Refolded Antigens</title>
<p>Refolded antigens, analyzed using circular dichroism (CD), were found to have a &#x3b2;-pleated sheet component of about 48% for all three antigen variants. Random coil was also found to be 48% of the protein structure, while only 4% was identified as alpha helices. Epitopes recognized following immunization with any of three recombinant full-length TprC variants from <italic>Tp</italic> subsp. <italic>pallidum</italic> strains (Nichols/Chicago/Bal73-1, Sea81-4/Bal3, and MexicoA) were also identified to evaluate differences with infection-induced antibody responses. Results showed that sera from animals immunized with the Nichols TprC sequence were highly reactive to peptides C1-C3, C6 and C47, and moderately reactive to peptides C5, C9, C16-18, C28, C32, C34-C35, C53 and C55 (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5A</bold>
</xref>). Of these 16 peptides, six mapped almost exclusively to putative surface-exposed loop regions (C28, C32, C34, C35, C47, and C55), five (C1, C5-C6, C16, and C53) mapped to predicted transmembrane scaffolding sequences, while five peptides (C2-C3, C9 and C17-C18) contained both surface-exposed loops and scaffold regions. Sequences of these peptides and location in the predicted protein models are reported in <xref ref-type="supplementary-material" rid="ST1">
<bold>Table S8</bold>
</xref>. When tested against non-homologous peptides (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5B</bold>
</xref>), the Nichols TprC-immunized sera strongly recognized the SamoaD/IraqB C2-C3 variants, and all three heterologous C47 variants (SamoaD, Iraq B, and Sea81-4), while modest reactivity was seen towards the MexicoA/UW249 C55 peptide variant, the SamoaD/IraqB C34, and both C26 variants from SamoaD and IraqB (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5B</bold>
</xref>). Immunization with the Bal3 variant of TprC elicited high reactivity to peptides C1-3, C6, and C13, and moderate reactivity to peptides C7, C16-18, C20, C43, C47, and C49 (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5C</bold>
</xref> and <xref ref-type="supplementary-material" rid="ST1">
<bold>Table S8</bold>
</xref>). Of these thirteen peptides, six (C2-C3, C13, C17-C18, and C47) mapped predominantly to ExLs, and seven (C1, C6, C7, C16, C20, C43, and C49) predominantly to the protein transmembrane scaffolding (<xref ref-type="supplementary-material" rid="ST1">
<bold>Table S8</bold>
</xref>). Cross-reactivity to non-homologous peptides was seen predominantly to the SamoaD/IraqB C2 and C3, IraqB C22, and all variants of C47 and C51 (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5D</bold>
</xref>). Antisera from rabbits immunized with the MexicoA TprC variants primarily recognized homologous peptides C1-3 and, secondarily, C5, C6, and C28 (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5E</bold>
</xref>). Of these six, one peptide mapped to the predicted ExL6 (C28), three mapped only to the transmembrane scaffolding (C1, C5-C6) and two mapped to a peptide predicted to contain portions of both (C2-C3) (<xref ref-type="supplementary-material" rid="ST1">
<bold>Table S8</bold>
</xref>). Cross-reactivity to the non-homologous SamoaD/IraqB C2 and C3 was also detected (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5F</bold>
</xref>). Overall, these data show that, as seen in infection-induced antibody responses, the humoral response following immunization with full-length TprC variants is mainly elicited by predicted surface-exposed sequences, rather than sequences mapping to the &#x3b2;-barrel transmembrane scaffolding, and that cross-reactivity to non-homologous peptides is possible.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Humoral reactivity to TprC peptides following immunization with refolded recombinant full-length TprC antigens. Reactivity to TprC homologous (left panels) and non-homologous peptides (right panels) in sera from rabbits immunized with Nichols <bold>(A, B)</bold>, Bal3 <bold>(C, D)</bold>, and Mexico A <bold>(E, F)</bold> variants of TprC. Asterisk (*) indicates significant reactivity compared to no antigen control. Peptides encompassing sequences predicted to be within ExLs are boxed. Peptide sequence and homology among strains are reported in <xref ref-type="supplementary-material" rid="ST1">
<bold>Table S6</bold>
</xref>. Strain names on x axes are abbreviated as follows: N, Nichols; M, MexicoA; Sea, Sea81-4; B, Bal3; U, UW249; S, SamoaD; I, IraqB.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-862491-g005.tif"/>
</fig>
<p>A side-by-side comparison of the infection- vs. immunization-induced humoral response to peptides is shown in <xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref>. For this comparison, the mean value of the cumulative reactivity seen in sera at day 30, 60, and 90 sera post-experimental infection is shown for each peptide. Sera from immunized animals were obtained three weeks after the last immunization. All sera were tested at the same dilution. In general, immunization-induced reactivity to most peptides appeared to be higher than that elicited by experimental infection; specific examples include C1-C3, C5, C9, C16-C17, C28, C32, C34-C35, N-C47, and C53 peptides (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6A</bold>
</xref>). For Nichols-clade <italic>T. pallidum</italic> strains (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6A</bold>
</xref>), which contain identical <italic>tprC</italic> and <italic>tprD</italic> loci, this was most noticeable for epitopes located in the NH<sub>2</sub>- and COOH-terminal regions of the protein. In contrast, infection-induced antibody responses to epitopes in the central part of the protein were comparable to or higher than those induced by immunization. For TprD2-containing subsp. <italic>pallidum</italic> strains (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6B, C</bold>
</xref>), immunization-induced responses were limited to the NH<sub>2</sub>-terminal portion of the protein (including ExL1-3) and virtually no immunization-induced antibodies were detected for epitopes in the central and COOH-terminal regions, although these were recognized by infection-induced responses. Overall, these data support that, in most cases, immunization elicits a higher reactivity to TprC B-cell epitopes compared to experimental infection, particularly for those epitopes located in the NH<sub>2</sub>-terminal portion of the protein. These data support the preferential use of the amino portion of TprC, which contains multiple conserved ExLs, for vaccine studies.</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Comparison of reactivity of sera from infected animals vs. immunized animals. <bold>(A-C)</bold> Reactivity to peptides following immunization with TprC variants compared to experimental infection. Data shown are means +/- SEM of 3 rabbits per group: 3 weeks post final boost (immunized) and mean +/- SEM of values for days 30, 60, 90 post-infection (infected). Asterisk (*) indicates a significant difference in reactivity compared to the reactivity value following immunization. Peptides encompassing sequences predicted to be within ExLs are boxed. Strain names on x axes are abbreviated as follows: N, Nichols; M, MexicoA; Sea, Sea81-4; B, Bal3; U, UW249; S, SamoaD; I, IraqB.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-862491-g006.tif"/>
</fig>
</sec>
</sec>
<sec id="s3" sec-type="discussion">
<title>Discussion</title>
<p>The continuing prevalence of syphilis, in the face of highly effective therapy and active control programs, highlights the need for a protective vaccine. The development of such a vaccine calls for a deeper understanding of the mechanisms of protective immunity and the antigens and adjuvants that induce protection. Our laboratories have been examining these issues for many years (<xref ref-type="bibr" rid="B22">22</xref>, <xref ref-type="bibr" rid="B31">31</xref>, <xref ref-type="bibr" rid="B36">36</xref>, <xref ref-type="bibr" rid="B41">41</xref>&#x2013;<xref ref-type="bibr" rid="B48">48</xref>). Much of that work has focused on the Tpr antigens of <italic>T. pallidum</italic>. In this current study, B-cell epitope mapping studies of the TprC/D and TprD<sub>2</sub> proteins of <italic>Tp</italic> reveal that antibodies arising during experimental infection recognize sequences predicted, using state-of-the-art modeling systems, to fall largely in the proteins&#x2019; surface-exposed loops. Because opsonic antibodies are required for efficient ingestion and killing of <italic>T. pallidum</italic> by macrophages, surface-exposed epitopes are attractive targets as vaccine candidate antigens.</p>
<p>A broadly protective vaccine would need to be effective against most strains of <italic>T. pallidum</italic>, optimally including the agents of syphilis as well as the endemic treponematoses yaws and bejel. Because some of the external loops of Tpr C/D and TprD<sub>2</sub> demonstrate sequence heterogeneity among strains and subspecies of <italic>T. pallidum</italic>, we expected that these epitopes might be strain-specific, similar to the specificity demonstrated for the variable regions of TprK (<xref ref-type="bibr" rid="B43">43</xref>, <xref ref-type="bibr" rid="B45">45</xref>, <xref ref-type="bibr" rid="B49">49</xref>). For this reason, we included seven strains of <italic>Tp</italic> subsp. <italic>pallidum</italic> as well as strains from the subspecies <italic>pertenue</italic> and <italic>endemicum</italic> in our work. Unexpectedly, we saw cross reactivity of antibodies toward the variant peptides (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref>). These findings support the use of TprC/D as at least one component of broadly effective candidate vaccine. It was intriguing that in two instances (Sea81-4 serum for C47; and MexicoA serum for C55) antisera only recognized non-homologous peptides (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4B, D</bold>
</xref>). In the case of the Sea81-4 serum, reactivity was detected at day 30 post-infection, but not the at later time points. For the MexicoA serum, one could hypothesize that masking of key epitope residues occurred for the non-recognized homologous peptide during absorption to the ELISA plate which, in turn, could have reduced assay sensitivity, as discussed for peptide arrays by Cretich et al. (<xref ref-type="bibr" rid="B50">50</xref>).</p>
<p>The AlphaFold2 structural predictions for TprC/D and TprD<sub>2</sub>, as well as our CD analyses of purified refolded recombinant TprC variants, support our model (<xref ref-type="bibr" rid="B35">35</xref>) that these Tprs are membrane-localized 20-stranded &#x3b2;-barrel proteins containing numerous surface-exposed loops. Very similar models for TprC were previously obtained using I-TASSER (<xref ref-type="bibr" rid="B51">51</xref>) (<uri xlink:href="https://zhanggroup.org/I-TASSER/">https://zhanggroup.org/I-TASSER/</uri>) (<xref ref-type="bibr" rid="B35">35</xref>). Interestingly, when AlphaFold2 and I-TASSER results are compared, the only difference is that I-TASSER splits ExL6 (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>) into two external loops separated by a &#x3b2;-hairpin, so that I-TASSER predictions harbor 11 external loops instead of 10. AlphaFold2, on the contrary, predicts a significantly larger ExL6, mapping approximately to the proteins&#x2019; central domains. AlphaFold2 is the new standard for <italic>ab-initio</italic> structural prediction, and in the 2020 Critical Assessment of protein Structure Prediction (CASP) global challenge, it outperformed any other structure prediction algorithm, including I-TASSER (<uri xlink:href="https://predictioncenter.org/casp14/zscores_final.cgi">https://predictioncenter.org/casp14/zscores_final.cgi</uri>). Furthermore, in a recent preprint (<xref ref-type="bibr" rid="B52">52</xref>), AlphaFold2 was shown to work well on structural prediction for membrane proteins, although the exercise focused mostly on alpha-helical membrane proteins, and additional analyses are necessary to establish the same benchmark for &#x3b2;-barrel proteins.</p>
<p>In previous work by Anand et al. (<xref ref-type="bibr" rid="B34">34</xref>, <xref ref-type="bibr" rid="B53">53</xref>) significantly different models for the TprC/D proteins were reported, compared to those provided here. These models, however, are not supported by AlphaFold2, which finds the structure of all Subfamily I and Subfamily II Tpr family members to be very similar to the structures for TprC/D and TprD<sub>2</sub> in <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>. Although there is not unanimous agreement on the structure of these antigens within our scientific community, our epitope mapping data support our AlphaFold2 models, predicting a predominantly &#x3b2;-barrel structure for TprC and TprD/D2 (<xref ref-type="bibr" rid="B34">34</xref>, <xref ref-type="bibr" rid="B53">53</xref>). Further studies and integration of all the structural, functional, and immunological data are needed to establish a consensus on the structure of these antigens until crystallographic (or equally reliable) data become available.</p>
<p>This study also provides evidence that infection with different strains might lead to differences in the breadth and intensity of the humoral response against the same epitope, as reported previously for responses to longer portions of the Tpr proteins (<xref ref-type="bibr" rid="B54">54</xref>). It is the case, for example, of rabbits infected with the Sea81-4 strain of <italic>Tp</italic> that overall recognize more TprC/D peptides compared to other <italic>Tp</italic> subsp. <italic>pallidum</italic> strains. The biological basis for these differences is unclear at this time, in part due to the limitations of our understanding of <italic>Tp</italic> biology and syphilis pathogenesis. As the technical gap in the approaches to study this difficult pathogen narrows, and genomics, proteomics, and transcriptomics data populate public repositories, more light will be shed on the causes of differential reactivity. Overall, however, it is plausible to postulate that enhanced serological reactivity might be due to an overall increased expression of the target antigen in each strain. This hypothesis is supported by previous work where we showed the <italic>tprC</italic> mRNA level was higher in the Sea81-4 strain compared to other <italic>Tp</italic> subsp. <italic>pallidum</italic> strains (Nichols, Chicago, Bal73-1) used in this study (<xref ref-type="bibr" rid="B55">55</xref>).</p>
<p>Our studies further demonstrated that epitopes in TprC/D and TprD<sub>2</sub> are nearly-uniformly distributed across the length of the protein, even though the most reactive peptide epitopes are in the NH<sub>2</sub>- and COOH-terminal regions. Previously published (<xref ref-type="bibr" rid="B36">36</xref>) experiments have shown that both of these regions in the Nichols TprC protein contain protective epitopes, as immunization with these antigen fragments significantly attenuated lesion development upon infectious challenge (<xref ref-type="bibr" rid="B36">36</xref>), and polyclonal antisera elicited by immunization with these portions facilitated treponemal ingestion by macrophages in opsonophagocytosis assays compared to normal rabbit sera (<xref ref-type="bibr" rid="B36">36</xref>). Further work, however, will be necessary to identify which specific surface-exposed sequences provide targets for opsonic antibodies, which may not coincide with sero-dominant epitopes, as the pathogen gains an obvious advantage by exposing to the immune system epitopes with little or no protective value. Assuming that differentially recognized peptides are located on the antigens&#x2019; protective epitopes, one could hypothesize that protective epitopes are immunologically sub-dominant during natural infection, which, <italic>per se</italic> could represent an additional strategy the pathogen uses to survive in the host despite the immune response that naturally develops to these antigens. If this was found to be the case, effort would need to be put into outflanking and overcoming immunodominance to target subdominant protective epitopes. Upon immunization, the immunodominance hierarchy is established at the germinal center, where B cells compete for the antigen through based on binding affinity, and subsequently undergo clonal expansion to become plasma cells or memory B cells (<xref ref-type="bibr" rid="B56">56</xref>). Controlling this process to drive antibody responses to increase recognition of subdominant protective epitopes would therefore be of primary importance. A possible strategy, referred to as germline targeting, relies upon the activation and expansion of rare but specific B cell lineages in na&#xef;ve individuals (<xref ref-type="bibr" rid="B57">57</xref>, <xref ref-type="bibr" rid="B58">58</xref>). For patients that are no longer na&#xef;ve due to natural exposure to the pathogen, however, the same outcome would need to be achieved by manipulating established B cell immunodominance hierarchies and remodel antibody responses toward more desired targets (<xref ref-type="bibr" rid="B57">57</xref>, <xref ref-type="bibr" rid="B58">58</xref>).</p>
<p>Protective B-cell epitopes (contrary to T-cell epitopes) are often conformational, and even when a significant portion of an epitope appears to be a short linear peptide, as in our study, it does not necessarily mean that the peptide represents the full epitope or, if it does, that the sequence will not require a certain conformation to elicit optimal bioactivity. For this reason, in the immunization studies performed in this study, we used CD-confirmed refolded recombinant antigens. The immunization-induced antibodies generally identified the same epitopes seen in infection, supporting the role of refolding in mimicking native structure, but immunization also resulted in recognition of a broader range of epitopes than seen during infection, including transmembrane scaffolding regions. This is likely because the scaffold regions are not shielded by the outer membrane in an immunization setting and are thus more easily processed for recognition. Thus, the design of vaccine immunogens is critical. Possible approaches vary from placing epitopes within chimeric antigens that could work as scaffold or, alternatively, using portions of the protein containing protective epitopes as structural elements of the antigen, or even using single &#x3b2;-hairpins instead of the full-length antigens. The work reported here represents an important step in evaluating TprC/D and TprD<sub>2</sub> epitopes as part of the process that will lead to an effective vaccine for syphilis.</p>
</sec>
<sec id="s4" sec-type="materials|methods">
<title>Materials and Methods</title>
<sec id="s4_1">
<title>Strain Propagation and Experimental Infection</title>
<p>Outbred adult male New Zealand White rabbits ranging from 3.0-4.0 Kg were obtained from R&amp;R Rabbitry (Stanwood, WA). Prior to entry into the study, serum from each animal was tested with both a treponemal (FTA-ABS) and a non-treponemal (VDRL; BD, Franklin Lakes, NJ) test to rule out infection with the rabbit syphilis agent <italic>Treponema paraluiscuniculi</italic>. Only rabbits seronegative in both tests were used for either propagation or experimental infection for sample collection. <italic>Tp s</italic>trains were propagated by intratesticular (IT) inoculation and harvested at peak orchitis as previously described (<xref ref-type="bibr" rid="B60">60</xref>). For experimental infections, groups of three rabbits were infected IT with a total of 5x10<sup>7</sup> <italic>Tp</italic> cells per testis. In total, nine <italic>Tp</italic> isolates (one isolate per rabbit group) were used: seven <italic>Tp</italic> subsp. <italic>pallidum</italic> isolates (Nichols, Chicago, Bal73-1, Sea81-4, Bal3, MexicoA, and UW249), one <italic>Tp</italic> subsp. <italic>endemicum</italic> (IraqB) and one <italic>Tp</italic> subsp. <italic>pertenue</italic> (SamoaD) (<xref ref-type="supplementary-material" rid="ST1">
<bold>Table S9</bold>
</xref>). Briefly, on the day of infection bacteria were extracted from rabbit testes in sterile saline containing 10% normal rabbit serum (NRS), and testicular extract was collected in sterile 15-ml tubes. Extracts were centrifuged twice at 1,000 rpm (180 x g) for 10 minutes in an Eppendorf 5810R centrifuge (Eppendorf, Hauppauge, NY) to remove gross rabbit cellular debris. Treponemes were enumerated under a dark-field microscope (DFM) and percentage of motile organisms was recorded. Extracts were then diluted in serum-saline to the desired concentration (5x10<sup>7</sup>/ml). Following IT injection, treponemal motility was assessed again to ensure that the time elapsed before injection into the new host did not affect pathogen viability. After IT inoculation, establishment of infection was assessed by monitoring development of orchitis during the following three weeks as well as by performing FTA-ABS and VDRL tests on sera collected at day 30 post-inoculation. Immune sera were collected from the animals at day 30, 60, and 90 post-infection. Animals were then euthanized. Extracted sera were heat-inactivated at 56&#xb0;C for 30 min and stored at -20&#xb0;C until use for ELISAs.</p>
</sec>
<sec id="s4_2">
<title>Amplification and Cloning of Full-Length <italic>tprC</italic> Gene Variants for Expression of Recombinant Antigens</title>
<p>Sequences for the <italic>tprC</italic> gene of <italic>Tp</italic> isolates (Nichols, Sea81-4, and MexicoA) were previously cloned (<xref ref-type="bibr" rid="B35">35</xref>). For expression, the <italic>tprC</italic> sequences were sub-cloned into the pET23b+ vector (Life Technologies) between <underline>BamHI</underline> and <underline>HindIII</underline> using the primers C-S (5&#x2019;-cg<underline>ggatccg</underline>atgg gcgtactcactccgca) and C-As (5&#x2019;-gc<underline>aagctt</underline>ccatgtcactttcattccac). For sub-cloning, the <italic>tprC</italic> ORF was amplified in a 100-&#x3bc;l final volume using 0.4 units of GoTaq polymerase (Promega) with approximately 10 ng of DNA template. MgCl<sub>2</sub> and dNTP final concentrations were 1.5 mM and 200 &#x3bc;M, respectively. Initial denaturation and final extension (72&#xb0;C) were for 10 min each. Denaturation (94&#xb0;C), annealing (60&#xb0;C), and extension (72&#xb0;C) were carried out for 1 min each for a total of 35 cycles. Amplicons were purified, digested, and ligated into the pET23b+ vector. As a result of cloning into pET23b+, 28 additional amino acids were added to the TprC ORFs (14 NH<sub>2</sub>-terminal and 14 COOH-terminal amino acids), including the COOH-terminal 6&#xd7;His tag for affinity purification. Ligation products were used to transform OneShot TOP10 chemically competent <italic>E. coli</italic> cells (Life Technologies) according to the provided protocol. Transformations were plated on LB-Ampicillin (100 &#x3bc;g/ml) agar plates for selection. For each cloning reaction, individual colonies were screened for the presence of insert-containing plasmids using primers annealing upstream and downstream of the pET23b+ vector poly-linker (T7 promoter and terminator primers). Positive plasmids were extracted from overnight liquid cultures obtained from replica colonies by using the Plasmid Mini kit (Qiagen, Germantown, MD), and two to five clones for each strain were sequenced to ensure sequence fidelity to the previously cloned templates (<xref ref-type="bibr" rid="B35">35</xref>). For expression of recombinant antigens, a suitable clone for each <italic>tprC</italic> gene variant was used to transform <italic>E. coli</italic> Rosetta (DE3) competent cells (Life Technologies).</p>
</sec>
<sec id="s4_3">
<title>Expression, Purification and Refolding of Recombinant Proteins</title>
<p>
<italic>E. coli</italic> cells were grown overnight in LB media supplemented with ampicillin (100 &#x3bc;g/ml). The following day, multiple flasks containing 200 ml of auto-inducing media (<xref ref-type="bibr" rid="B61">61</xref>), were inoculated with 20 ml of overnight culture in a 2-liter baffled flask and grown at room temperature for 72 h at 175 rpm in a shaking incubator. Expression of recombinant antigens in induced and un-induced controls was assessed by immunoblot using a monoclonal anti-poly-histidine antibody (Millipore-Sigma, diluted 1:2000) after SDS-PAGE. Prior to purification, presence of the recombinant protein in the soluble and insoluble cellular fractions was evaluated by SDS-PAGE and immunoblot. Recombinant TprC purification was carried on under denaturing conditions. Briefly, <italic>E. coli</italic> cell pellets were resuspended in 5 ml/g of dry culture weight of binding buffer (50 mM NaH<sub>2</sub>PO<sub>4</sub>, 10 mM imidazole, pH 8.0) w/o denaturing agent, and the suspension was sonicated in ice with 100 pulses of 6 s each, with each pulse being separated by 10-s intervals. Insoluble components (containing the desired products) were precipitated by centrifugation and resuspended in 5 ml/g of culture weight of binding buffer (50 mM NaH<sub>2</sub>PO<sub>4</sub>, 5 mM imidazole, pH 8.0) containing 6M Guanidine-HCl denaturing agent and sonicated again as above. Insoluble components were precipitated again by centrifugation and the supernates were saved. For affinity chromatography, 5.0 ml of nickel-agarose (Ni-NTA agarose, Qiagen) was packaged into a 1.5x14 cm column (Bio-Rad, Carlsbad, CA) and washed with 3 column volumes of molecular-grade H<sub>2</sub>O and 6 column volumes of binding buffer + denaturing agent. Cell lysate was then loaded, and the flow was adjusted to 1 ml/min. Unbound proteins were washed using 10 bed volumes of binding buffer, followed by 6 column volumes of wash buffer (50 mM NaH<sub>2</sub>PO<sub>4</sub>, 20 mM imidazole, pH 8.0) containing denaturing agent. Washing continued until the <italic>A</italic>
<sub>280</sub> of the flow through was &lt;0.01 AU. Recombinant TprC was eluted with 15 ml of elution buffer (50 mM NaH<sub>2</sub>PO<sub>4</sub>, 300 mM imidazole, pH 8.0) containing denaturing agent. Eluted fractions devoid of visible contaminants by SDS-PAGE and Coomassie staining were pooled, and protein concentration was assessed by micro-bicinchoninic (BCA) assay (Thermo-Fisher). Pooled fractions were then dialyzed in PBS using a 10 kDa MWCO Slide-A-Lyzer dialysis cassette (Thermo-Fisher) over 12 hours, ensuring PBS change every ~4 hours. Precipitated protein, resulting from elimination of Guanidine-HCl during dialysis was transferred into microcentrifuge tubes and spun down at full speed. After removing the supernate, the pellet was resuspended in a volume of PBS containing 6M urea suitable to achieve a protein concentration of ~4 mg/ml, and protein concentration was then reassessed using the micro-BCA assay kit (Thermo-Fisher). Prior to immunizations, urea was eliminated using Profoldin (Hudson, MA) M7 renaturing columns for membrane proteins, which were used according to the manufacturer&#x2019;s protocol. M7 renaturing columns were found to provide the best yield when screened along with 19 other conditions offered by Profoldin. Lipid composition of the elute buffer included lysophosphatidylcholine (&#x223c;5 mM), arginine (&#x223c;150 mM), glycerol (&#x223c;10%), dodecyl maltoside (0.7 mM), and Tris-HCl (0.1 mM), pH 7.5). Following buffer exchange, soluble protein concentration was evaluated using micro-BCA assay and analyzed by circular dichroism (CD) to evaluate percentage of &#x3b2;-sheet, alpha-helix, and random coil. CD spectra (190 to 260 nm) were acquired in triplicate at room temperature using 0.5 mg/ml of recombinant refolded TprC in a Jasco-1500 high-performance CD spectrometer. CD spectra were analyzed using the online platform Dichroweb (<uri xlink:href="http://dichroweb.cryst.bbk.ac.uk/html/home.shtml">http://dichroweb.cryst.bbk.ac.uk/html/home.shtml</uri>) (<xref ref-type="bibr" rid="B62">62</xref>) and the spectra from buffer alone for background subtraction.</p>
</sec>
<sec id="s4_4">
<title>Rabbit Immunization</title>
<p>Groups of three rabbits each were immunized with one of the purified, refolded recombinant TprC variants. Rabbits were injected with 125 &#x3bc;g of refolded protein every 3 weeks for a total of three immunizations. Prior to injection, antigen was mixed with an equal volume of in Titermax Gold Adjuvant (Millipore-Sigma), a water-in oil emulsion containing squalene, the block co-polymer CRL-8300, and a microparticle stabilizers to obtain a final volume of 1 ml. Immunogen-adjuvant preparation was performed according to the manufacturer`s instruction, and immunizations were performed <italic>via</italic> four 250 &#x3bc;l injections (each containing 31.25 &#x3bc;g of protein) into 4 intramuscular sites. Three weeks after the last boost, immunized animals were deeply anaesthetized, bled through cardiac puncture, and then euthanized.</p>
</sec>
<sec id="s4_5">
<title>ELISA Using Synthetic Peptides</title>
<p>Overlapping synthetic peptides (20-mers overlapping by 10 aa) were designed to represent the sequences of all TprC and TprD/D<sub>2</sub> loci present in each of the seven strains examined in this study starting after the predicted signal peptide (AA 1-22; <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref> and <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>). Only the C56 peptide and its variants (<xref ref-type="supplementary-material" rid="ST1">
<bold>Table S6</bold>
</xref>), which represent the proteins&#x2019; COOH-terminus, were synthesized as 26-mers. A total of 120 peptides (<xref ref-type="supplementary-material" rid="ST1">
<bold>Table S6</bold>
</xref>) were produced by Genscript (Piscataway, NJ). Upon receipt, lyophilized peptides were rehydrated in sterile PBS to a stock solution of 200 &#x3bc;g/ml. Solubility of hydrophobic peptides was increased by adding up to 4% (v/v) DMSO per manufacturer&#x2019;s instruction when needed (peptides C1, C4-7, C10, C15-16, C20, C25, C38-C39, C43-44, C53; <xref ref-type="supplementary-material" rid="ST1">
<bold>Table S6</bold>
</xref>). Reconstituted peptides were stored at -20&#xb0;C until use. For ELISA, peptides were further diluted to 10 &#x3bc;g/ml in PBS, and 50 &#x3bc;l of working dilution (500 ng total) were used to coat the wells of a 96-well Microwell Maxisorp flat-bottom plate (Thermo-Fisher, Waltham, MA) as previously described (<xref ref-type="bibr" rid="B44">44</xref>). Absorbance was measured at OD<sub>405</sub> using a Molecular Devices SpectraMax Plus microplate reader (Molecular Devices, San Jose, CA). A micro-BCA protein assay (Thermo Fisher) was performed in plates coated with Ag and washed to demonstrate that all peptides bound to the well surfaces in the plates (data not shown). For each serum from each group, the value of each replicate experimental wells minus background reactivity (i.e., three times the mean of the wells tested with pooled uninfected rabbit serum) was calculated and plotted. If residual value for the No-antigen control wells was present after subtraction, statistical significance was calculated with one-way ANOVA with the Bonferroni correction of multiple comparisons or t-test, with significance set at <italic>p</italic>&lt;0.05. Except for figures showing cumulative absorbance, graphs represent the mean &#xb1; SEM for triplicate wells tested with pooled sera from the 3 rabbits in each group after background subtraction.</p>
</sec>
<sec id="s4_6">
<title>TprC/D and D2 Structure Modeling</title>
<p>We used the ColabFold interface (<xref ref-type="bibr" rid="B63">63</xref>) to construct Multiple Sequence Alignments (MSA) for the TprC and TprD<sub>2</sub> query sequences by searching UniRef30 (<xref ref-type="bibr" rid="B64">64</xref>), Mgnify (<xref ref-type="bibr" rid="B65">65</xref>) and ColabFold sequence databases with MMSeq2 (<xref ref-type="bibr" rid="B66">66</xref>). The MSA was used as input for structure prediction with AlphaFold2 (<xref ref-type="bibr" rid="B38">38</xref>) using the default settings (template=False, amber_relax=False, 3 recycles). Visualization was performed using PyMol software (<uri xlink:href="https://pymol.org">https://pymol.org</uri>
<italic>)</italic> (<xref ref-type="bibr" rid="B67">67</xref>).</p>
</sec>
</sec>
<sec id="s5" sec-type="data-availability">
<title>Data Availability Statement</title>
<p>The original contributions presented in the study are included in the article/<xref ref-type="supplementary-material" rid="ST1">
<bold>Supplementary Material</bold>
</xref>. Further inquiries can be directed to the corresponding author.</p>
</sec>
<sec id="s6" sec-type="ethics-statement">
<title>Ethics Statement</title>
<p>Animal care was provided in accordance with the procedures described in the Guide for the Care and Use of Laboratory Animals under protocols approved by the University of Washington Institutional Animal Care and Use Committee (IACUC, PI: Sheila Lukehart). The protocol number assigned by the IACUC committee that approved this study is 2090-08.</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author Contributions</title>
<p>BM: Performed experiments, analyzed data, and reviewed manuscript. MF: performed experiments, analyzed data, and reviewed manuscript. CG: performed experiments, reviewed manuscript. AV: generated Tpr models, reviewed manuscript. SL: experiment conceptualization, analyzed data, reviewed manuscript. LG: analyzed data and wrote manuscript. All authors contributed to the article and approved the submitted version.</p>
</sec>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>Research reported in this publication was supported by National Institute of Allergy &amp; Infectious Diseases of the National Institutes of Health under award number R01AI042143 grant (to SL). Tpr models using AlphaFold2 were generated thanks to support from Open Philanthropy (to LG). This work was also partially supported also by the National Institute for Allergy and Infectious Diseases of the National Institutes of Health grant number U19AI144133 (Project 2. Project 2 leader: LG; PI: Anna Wald, University of Washington). The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</p>
</sec>
<sec id="s9">
<title>Author Disclaimer</title>
<p>The content is solely the responsibility of the authors and does not necessarily represent the official views of the Funders.</p>
</sec>
<sec id="s10" sec-type="COI-statement">
<title>Conflict of Interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s11" sec-type="disclaimer">
<title>Publisher&#x2019;s Note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
</body>
<back>
<ack>
<title>Acknowledgments</title>
<p>The authors are grateful to Janelle Deane for aiding with some of the experimental procedures.</p>
</ack>
<sec id="s12" sec-type="supplementary-material">
<title>Supplementary Material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fimmu.2022.862491/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fimmu.2022.862491/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="Table_1.xlsx" id="ST1" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet"/>
<supplementary-material xlink:href="Table_2.docx" id="ST2" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document"/>
<supplementary-material xlink:href="Table_3.docx" id="ST3" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document"/>
<supplementary-material xlink:href="Table_4.docx" id="ST4" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document"/>
<supplementary-material xlink:href="Table_5.docx" id="ST5" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document"/>
<supplementary-material xlink:href="Table_6.docx" id="ST6" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Giacani</surname> <given-names>L</given-names>
</name>
<name>
<surname>Lukehart</surname> <given-names>SA</given-names>
</name>
</person-group>. <article-title>The Endemic Treponematoses</article-title>. <source>Clin Microbiol Rev</source> (<year>2014</year>) <volume>27</volume>(<issue>1</issue>):<fpage>89</fpage>&#x2013;<lpage>115</lpage>. doi: <pub-id pub-id-type="doi">10.1128/CMR.00070-13</pub-id>
</citation>
</ref>
<ref id="B2">
<label>2</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rowley</surname> <given-names>J</given-names>
</name>
<name>
<surname>Vander Hoorn</surname> <given-names>S</given-names>
</name>
<name>
<surname>Korenromp</surname> <given-names>E</given-names>
</name>
<name>
<surname>Low</surname> <given-names>N</given-names>
</name>
<name>
<surname>Unemo</surname> <given-names>M</given-names>
</name>
<name>
<surname>Abu-Raddad</surname> <given-names>LJ</given-names>
</name>
<etal/>
</person-group>. <article-title>Chlamydia, Gonorrhoea, Trichomoniasis and Syphilis: Global Prevalence and Incidence Estimates, 2016</article-title>. <source>Bull World Health Organ</source> (<year>2019</year>) <volume>97</volume>(<issue>8</issue>):<fpage>548</fpage>&#x2013;<lpage>62p</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.2471/blt.18.228486</pub-id>
</citation>
</ref>
<ref id="B3">
<label>3</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Savage</surname> <given-names>EJ</given-names>
</name>
<name>
<surname>Marsh</surname> <given-names>K</given-names>
</name>
<name>
<surname>Duffell</surname> <given-names>S</given-names>
</name>
<name>
<surname>Ison</surname> <given-names>CA</given-names>
</name>
<name>
<surname>Zaman</surname> <given-names>A</given-names>
</name>
<name>
<surname>Hughes</surname> <given-names>G</given-names>
</name>
</person-group>. <article-title>Rapid Increase in Gonorrhoea and Syphilis Diagnoses in England in 2011</article-title>. <source>Euro Surveill</source> (<year>2012</year>) <volume>17</volume>(<issue>29</issue>). doi: <pub-id pub-id-type="doi">10.2807/ese.17.29.20224-en</pub-id>
</citation>
</ref>
<ref id="B4">
<label>4</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Savage</surname> <given-names>EJ</given-names>
</name>
<name>
<surname>Hughes</surname> <given-names>G</given-names>
</name>
<name>
<surname>Ison</surname> <given-names>C</given-names>
</name>
<name>
<surname>Lowndes</surname> <given-names>CM</given-names>
</name>
</person-group>. <article-title>Syphilis and Gonorrhoea in Men Who Have Sex With Men: A European Overview</article-title>. <source>Euro Surveill</source> (<year>2009</year>) <volume>14</volume>(<issue>47</issue>). doi: <pub-id pub-id-type="doi">10.2807/ese.14.47.19417-en</pub-id>
</citation>
</ref>
<ref id="B5">
<label>5</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Simms</surname> <given-names>I</given-names>
</name>
<name>
<surname>Fenton</surname> <given-names>KA</given-names>
</name>
<name>
<surname>Ashton</surname> <given-names>M</given-names>
</name>
<name>
<surname>Turner</surname> <given-names>KM</given-names>
</name>
<name>
<surname>Crawley-Boevey</surname> <given-names>EE</given-names>
</name>
<name>
<surname>Gorton</surname> <given-names>R</given-names>
</name>
<etal/>
</person-group>. <article-title>The Re-Emergence of Syphilis in the United Kingdom: The New Epidemic Phases</article-title>. <source>Sex Transm Dis</source> (<year>2005</year>) <volume>32</volume>(<issue>4</issue>):<page-range>220&#x2013;6</page-range>. doi: <pub-id pub-id-type="doi">10.1097/01.olq.0000149848.03733.c1</pub-id>
</citation>
</ref>
<ref id="B6">
<label>6</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tucker</surname> <given-names>JD</given-names>
</name>
<name>
<surname>Cohen</surname> <given-names>MS</given-names>
</name>
</person-group>. <article-title>China&#x2019;s Syphilis Epidemic: Epidemiology, Proximate Determinants of Spread, and Control Responses</article-title>. <source>Curr Opin Infect Dis</source> (<year>2011</year>) <volume>24</volume>(<issue>1</issue>):<page-range>50&#x2013;5</page-range>. doi: <pub-id pub-id-type="doi">10.1097/QCO.0b013e32834204bf</pub-id>
</citation>
</ref>
<ref id="B7">
<label>7</label>
<citation citation-type="book">
<person-group person-group-type="author">
<collab>CDC</collab>
</person-group>. <source>2018 Sexually Transmitted Disease Surveillance</source>. <publisher-loc>Atlanta, GA</publisher-loc>: <publisher-name>US Department of Health and Human Services: Centers for Disease Control and Prevention</publisher-name> (<year>2019</year>).</citation>
</ref>
<ref id="B8">
<label>8</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>LaFond</surname> <given-names>RE</given-names>
</name>
<name>
<surname>Lukehart</surname> <given-names>SA</given-names>
</name>
</person-group>. <article-title>Biological Basis for Syphilis</article-title>. <source>Clin Microbiol Rev</source> (<year>2006</year>) <volume>19</volume>(<issue>1</issue>):<fpage>29</fpage>&#x2013;<lpage>49</lpage>. doi: <pub-id pub-id-type="doi">10.1128/CMR.19.1.29-49.2006</pub-id>
</citation>
</ref>
<ref id="B9">
<label>9</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Goldenberg</surname> <given-names>RL</given-names>
</name>
<name>
<surname>Thompson</surname> <given-names>C</given-names>
</name>
</person-group>. <article-title>The Infectious Origins of Stillbirth</article-title>. <source>Am J Obstet Gynecol</source> (<year>2003</year>) <volume>189</volume>(<issue>3</issue>):<page-range>861&#x2013;73</page-range>. doi: <pub-id pub-id-type="doi">10.1067/S0002-9378(03)00470-8</pub-id>
</citation>
</ref>
<ref id="B10">
<label>10</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Moline</surname> <given-names>HR</given-names>
</name>
<name>
<surname>Smith</surname> <given-names>JF</given-names> <suffix>Jr.</suffix>
</name>
</person-group> <article-title>The Continuing Threat of Syphilis in Pregnancy</article-title>. <source>Curr Opin Obstet Gynecol</source> (<year>2016</year>) <volume>28</volume>(<issue>2</issue>):<page-range>101&#x2013;4</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1097/gco.0000000000000258</pub-id>
</citation>
</ref>
<ref id="B11">
<label>11</label>
<citation citation-type="book">
<person-group person-group-type="author">
<collab>CDC</collab>
</person-group>. <source>The National Plan to Eliminate Syphilis in the United States</source>. <publisher-loc>Atlanta, GA</publisher-loc>: <publisher-name>U.S. Department of Health and Human Services: Centers for Disease Control and Prevention</publisher-name> (<year>1999</year>).</citation>
</ref>
<ref id="B12">
<label>12</label>
<citation citation-type="book">
<person-group person-group-type="author">
<collab>WHO</collab>
</person-group>. <source>The Global Elimination of Congenital Syphilis: Rationale and Strategy for Action</source>. <publisher-loc>Geneva</publisher-loc>: <publisher-name>WHO Press</publisher-name> (<year>2007</year>).</citation>
</ref>
<ref id="B13">
<label>13</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mitj&#xe0;</surname> <given-names>O</given-names>
</name>
<name>
<surname>Marks</surname> <given-names>M</given-names>
</name>
<name>
<surname>Konan</surname> <given-names>DJ</given-names>
</name>
<name>
<surname>Ayelo</surname> <given-names>G</given-names>
</name>
<name>
<surname>Gonzalez-Beiras</surname> <given-names>C</given-names>
</name>
<name>
<surname>Boua</surname> <given-names>B</given-names>
</name>
<etal/>
</person-group>. <article-title>Global Epidemiology of Yaws: A Systematic Review</article-title>. <source>Lancet Glob Health</source> (<year>2015</year>) <volume>3</volume>(<issue>6</issue>):<page-range>e324&#x2013;31</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/s2214-109x(15)00011-x</pub-id>
</citation>
</ref>
<ref id="B14">
<label>14</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mitj&#xe0;</surname> <given-names>O</given-names>
</name>
<name>
<surname>Houinei</surname> <given-names>W</given-names>
</name>
<name>
<surname>Moses</surname> <given-names>P</given-names>
</name>
<name>
<surname>Kapa</surname> <given-names>A</given-names>
</name>
<name>
<surname>Paru</surname> <given-names>R</given-names>
</name>
<name>
<surname>Hays</surname> <given-names>R</given-names>
</name>
<etal/>
</person-group>. <article-title>Mass Treatment With Single-Dose Azithromycin for Yaws</article-title>. <source>N Engl J Med</source> (<year>2015</year>) <volume>372</volume>(<issue>8</issue>):<page-range>703&#x2013;10</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1056/NEJMoa1408586</pub-id>
</citation>
</ref>
<ref id="B15">
<label>15</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mitj&#xe0;</surname> <given-names>O</given-names>
</name>
<name>
<surname>Godornes</surname> <given-names>C</given-names>
</name>
<name>
<surname>Houinei</surname> <given-names>W</given-names>
</name>
<name>
<surname>Kapa</surname> <given-names>A</given-names>
</name>
<name>
<surname>Paru</surname> <given-names>R</given-names>
</name>
<name>
<surname>Abel</surname> <given-names>H</given-names>
</name>
<etal/>
</person-group>. <article-title>Re-Emergence of Yaws After Single Mass Azithromycin Treatment Followed by Targeted Treatment: A Longitudinal Study</article-title>. <source>Lancet</source> (<year>2018</year>) <volume>391</volume>(<issue>10130</issue>):<page-range>1599&#x2013;607</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/s0140-6736(18)30204-6</pub-id>
</citation>
</ref>
<ref id="B16">
<label>16</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pace</surname> <given-names>JL</given-names>
</name>
<name>
<surname>Csonka</surname> <given-names>GW</given-names>
</name>
</person-group>. <article-title>Late Endemic Syphilis: Case Report of Bejel With Gummatous Laryngitis</article-title>. <source>Genitourin Med</source> (<year>1988</year>) <volume>64</volume>(<issue>3</issue>):<page-range>202&#x2013;4</page-range>. doi: <pub-id pub-id-type="doi">10.1136/sti.64.3.202</pub-id>
</citation>
</ref>
<ref id="B17">
<label>17</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pace</surname> <given-names>JL</given-names>
</name>
</person-group>. <article-title>Treponematoses in Arabia</article-title>. <source>Saudi Med J</source> (<year>1983</year>) <volume>4</volume>:<page-range>211&#x2013;20</page-range>.</citation>
</ref>
<ref id="B18">
<label>18</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Julvez</surname> <given-names>J</given-names>
</name>
<name>
<surname>Michault</surname> <given-names>A</given-names>
</name>
<name>
<surname>Kerdelhue</surname> <given-names>V</given-names>
</name>
</person-group>. <article-title>Serologic Studies of Non-Venereal Treponematoses in Infants in Niamey, Niger</article-title>. <source>Med Trop (Mars)</source> (<year>1998</year>) <volume>58</volume>(<issue>1</issue>):<fpage>38</fpage>&#x2013;<lpage>40</lpage>.</citation>
</ref>
<ref id="B19">
<label>19</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Galoo</surname> <given-names>E</given-names>
</name>
<name>
<surname>Schmoor</surname> <given-names>P</given-names>
</name>
</person-group>. <article-title>Identification of a Focus of Bejel in Mauritania</article-title>. <source>Med Trop (Mars)</source> (<year>1998</year>) <volume>58</volume>(<issue>3</issue>):<page-range>311&#x2013;2</page-range>.</citation>
</ref>
<ref id="B20">
<label>20</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lieberman</surname> <given-names>NAP</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>MJ</given-names>
</name>
<name>
<surname>Xie</surname> <given-names>H</given-names>
</name>
<name>
<surname>Shrestha</surname> <given-names>L</given-names>
</name>
<name>
<surname>Nguyen</surname> <given-names>T</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>ML</given-names>
</name>
<etal/>
</person-group>. <article-title>Treponema Pallidum Genome Sequencing From Six Continents Reveals Variability in Vaccine Candidate Genes and Dominance of Nichols Clade Strains in Madagascar</article-title>. <source>PloS Negl Trop Dis</source> (<year>2021</year>) <volume>15</volume>(<issue>12</issue>):<elocation-id>e0010063</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pntd.0010063</pub-id>
</citation>
</ref>
<ref id="B21">
<label>21</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lithgow</surname> <given-names>KV</given-names>
</name>
<name>
<surname>Cameron</surname> <given-names>CE</given-names>
</name>
</person-group>. <article-title>Vaccine Development for Syphilis</article-title>. <source>Expert Rev Vaccines</source> (<year>2017</year>) <volume>16</volume>(<issue>1</issue>):<fpage>37</fpage>&#x2013;<lpage>44</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/14760584.2016.1203262</pub-id>
</citation>
</ref>
<ref id="B22">
<label>22</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cameron</surname> <given-names>CE</given-names>
</name>
<name>
<surname>Lukehart</surname> <given-names>SA</given-names>
</name>
</person-group>. <article-title>Current Status of Syphilis Vaccine Development: Need, Challenges, Prospects</article-title>. <source>Vaccine</source> (<year>2014</year>) <volume>32</volume>(<issue>14</issue>):<page-range>1602&#x2013;9</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.vaccine.2013.09.053</pub-id>
</citation>
</ref>
<ref id="B23">
<label>23</label>
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Turner</surname> <given-names>TB</given-names>
</name>
<name>
<surname>Hollander</surname> <given-names>DH</given-names>
</name>
</person-group>. <source>Biology of the Treponematoses</source>. <publisher-loc>Geneva</publisher-loc>: <publisher-name>World Health Organization</publisher-name> (<year>1957</year>).</citation>
</ref>
<ref id="B24">
<label>24</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Miller</surname> <given-names>JN</given-names>
</name>
</person-group>. <article-title>Immunity in Experimental Syphilis. VI. Successful Vaccination of Rabbits With <italic>Treponema Pallidum</italic>, Nichols Strain, Attenuated by &#x3b3;- Irradiation</article-title>. <source>J Immunol</source> (<year>1973</year>) <volume>110</volume>(<issue>5</issue>):<page-range>1206&#x2013;15</page-range>.</citation>
</ref>
<ref id="B25">
<label>25</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Koebnik</surname> <given-names>R</given-names>
</name>
<name>
<surname>Locher</surname> <given-names>KP</given-names>
</name>
<name>
<surname>Van Gelder</surname> <given-names>P</given-names>
</name>
</person-group>. <article-title>Structure and Function of Bacterial Outer Membrane Proteins: Barrels in a Nutshell</article-title>. <source>Mol Microbiol</source> (<year>2000</year>) <volume>37</volume>(<issue>2</issue>):<page-range>239&#x2013;53</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1046/j.1365-2958.2000.01983.x</pub-id>
</citation>
</ref>
<ref id="B26">
<label>26</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Baker-Zander</surname> <given-names>SA</given-names>
</name>
<name>
<surname>Lukehart</surname> <given-names>SA</given-names>
</name>
</person-group>. <article-title>Macrophage-Mediated Killing of Opsonized <italic>Treponema Pallidum</italic>
</article-title>. <source>J Infect Dis</source> (<year>1992</year>) <volume>165</volume>(<issue>1</issue>):<fpage>69</fpage>&#x2013;<lpage>74</lpage>. doi: <pub-id pub-id-type="doi">10.1093/infdis/165.1.69</pub-id>
</citation>
</ref>
<ref id="B27">
<label>27</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lukehart</surname> <given-names>SA</given-names>
</name>
<name>
<surname>Miller</surname> <given-names>JN</given-names>
</name>
</person-group>. <article-title>Demonstration of the <italic>In Vitro</italic> Phagocytosis of <italic>Treponema Pallidum</italic> by Rabbit Peritoneal Macrophages</article-title>. <source>J Immunol</source> (<year>1978</year>) <volume>121</volume>(<issue>5</issue>):<page-range>2014&#x2013;24</page-range>.</citation>
</ref>
<ref id="B28">
<label>28</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Edmondson</surname> <given-names>DG</given-names>
</name>
<name>
<surname>Norris</surname> <given-names>SJ</given-names>
</name>
</person-group>. <article-title>
<italic>In Vitro</italic> Cultivation of the Syphilis Spirochete Treponema Pallidum</article-title>. <source>Curr Protoc</source> (<year>2021</year>) <volume>1</volume>(<issue>2</issue>):<fpage>e44</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/cpz1.44</pub-id>
</citation>
</ref>
<ref id="B29">
<label>29</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Walker</surname> <given-names>EM</given-names>
</name>
<name>
<surname>Borenstein</surname> <given-names>LA</given-names>
</name>
<name>
<surname>Blanco</surname> <given-names>DR</given-names>
</name>
<name>
<surname>Miller</surname> <given-names>JN</given-names>
</name>
<name>
<surname>Lovett</surname> <given-names>MA</given-names>
</name>
</person-group>. <article-title>Analysis of Outer Membrane Ultrastructure of Pathogenic <italic>Treponema</italic> and <italic>Borrelia</italic> Species by Freeze-Fracture Electron Microscopy</article-title>. <source>J Bacteriol</source> (<year>1991</year>) <volume>173</volume>(<issue>17</issue>):<page-range>5585&#x2013;8</page-range>. doi: <pub-id pub-id-type="doi">10.1128/jb.173.17.5585-5588.1991</pub-id>
</citation>
</ref>
<ref id="B30">
<label>30</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Radolf</surname> <given-names>JD</given-names>
</name>
<name>
<surname>Norgard</surname> <given-names>MV</given-names>
</name>
<name>
<surname>Schulz</surname> <given-names>WW</given-names>
</name>
</person-group>. <article-title>Outer Membrane Ultrastructure Explains the Limited Antigenicity of Virulent <italic>Treponema Pallidum</italic>
</article-title>. <source>Proc Natl Acad Sci USA</source> (<year>1989</year>) <volume>86</volume>(<issue>6</issue>):<page-range>2051&#x2013;5</page-range>. doi: <pub-id pub-id-type="doi">10.1073/pnas.86.6.2051</pub-id>
</citation>
</ref>
<ref id="B31">
<label>31</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Centurion-Lara</surname> <given-names>A</given-names>
</name>
<name>
<surname>Castro</surname> <given-names>C</given-names>
</name>
<name>
<surname>Barrett</surname> <given-names>L</given-names>
</name>
<name>
<surname>Cameron</surname> <given-names>C</given-names>
</name>
<name>
<surname>Mostowfi</surname> <given-names>M</given-names>
</name>
<name>
<surname>Van Voorhis</surname> <given-names>WC</given-names>
</name>
<etal/>
</person-group>. <article-title>
<italic>Treponema Pallidum</italic> Major Sheath Protein Homologue Tpr K Is a Target of Opsonic Antibody and the Protective Immune Response</article-title>. <source>J Exp Med</source> (<year>1999</year>) <volume>189</volume>(<issue>4</issue>):<page-range>647&#x2013;56</page-range>. doi: <pub-id pub-id-type="doi">10.1084/jem.189.4.647</pub-id>
</citation>
</ref>
<ref id="B32">
<label>32</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cox</surname> <given-names>DL</given-names>
</name>
<name>
<surname>Luthra</surname> <given-names>A</given-names>
</name>
<name>
<surname>Dunham-Ems</surname> <given-names>S</given-names>
</name>
<name>
<surname>Desrosiers</surname> <given-names>DC</given-names>
</name>
<name>
<surname>Salazar</surname> <given-names>JC</given-names>
</name>
<name>
<surname>Caimano</surname> <given-names>MJ</given-names>
</name>
<etal/>
</person-group>. <article-title>Surface Immunolabeling and Consensus Computational Framework to Identify Candidate Rare Outer Membrane Proteins of <italic>Treponema Pallidum</italic>
</article-title>. <source>Infect Immun</source> (<year>2010</year>) <volume>78</volume>(<issue>12</issue>):<page-range>5178&#x2013;94</page-range>. doi: <pub-id pub-id-type="doi">10.1128/IAI.00834-10</pub-id>
</citation>
</ref>
<ref id="B33">
<label>33</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fraser</surname> <given-names>CM</given-names>
</name>
<name>
<surname>Norris</surname> <given-names>SJ</given-names>
</name>
<name>
<surname>Weinstock</surname> <given-names>GM</given-names>
</name>
<name>
<surname>White</surname> <given-names>O</given-names>
</name>
<name>
<surname>Sutton</surname> <given-names>GG</given-names>
</name>
<name>
<surname>Dodson</surname> <given-names>R</given-names>
</name>
<etal/>
</person-group>. <article-title>Complete Genome Sequence of <italic>Treponema Pallidum</italic>, the Syphilis Spirochete</article-title>. <source>Science</source> (<year>1998</year>) <volume>281</volume>(<issue>5375</issue>):<page-range>375&#x2013;88</page-range>. doi: <pub-id pub-id-type="doi">10.1126/science.281.5375.375</pub-id>
</citation>
</ref>
<ref id="B34">
<label>34</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Anand</surname> <given-names>A</given-names>
</name>
<name>
<surname>Luthra</surname> <given-names>A</given-names>
</name>
<name>
<surname>Dunham-Ems</surname> <given-names>S</given-names>
</name>
<name>
<surname>Caimano</surname> <given-names>MJ</given-names>
</name>
<name>
<surname>Karanian</surname> <given-names>C</given-names>
</name>
<name>
<surname>LeDoyt</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>TprC/D (Tp0117/131), a Trimeric, Pore-Forming Rare Outer Membrane Protein of <italic>Treponema Pallidum</italic>, Has a Bipartite Domain Structure</article-title>. <source>J Bacteriol</source> (<year>2012</year>) <volume>194</volume>(<issue>9</issue>):<page-range>2321&#x2013;33</page-range>. doi: <pub-id pub-id-type="doi">10.1128/JB.00101-12</pub-id>
</citation>
</ref>
<ref id="B35">
<label>35</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Centurion-Lara</surname> <given-names>A</given-names>
</name>
<name>
<surname>Giacani</surname> <given-names>L</given-names>
</name>
<name>
<surname>Godornes</surname> <given-names>C</given-names>
</name>
<name>
<surname>Molini</surname> <given-names>BJ</given-names>
</name>
<name>
<surname>Brinck Reid</surname> <given-names>T</given-names>
</name>
<name>
<surname>Lukehart</surname> <given-names>SA</given-names>
</name>
</person-group>. <article-title>Fine Analysis of Genetic Diversity of the <italic>Tpr</italic> Gene Family Among Treponemal Species, Subspecies and Strains</article-title>. <source>PloS Negl Trop Dis</source> (<year>2013</year>) <volume>16</volume>(<issue>7</issue>):<elocation-id>e2222</elocation-id>. doi: <pub-id pub-id-type="doi">10.1371/journal.pntd.0002222</pub-id>
</citation>
</ref>
<ref id="B36">
<label>36</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sun</surname> <given-names>ES</given-names>
</name>
<name>
<surname>Molini</surname> <given-names>BJ</given-names>
</name>
<name>
<surname>Barrett</surname> <given-names>LK</given-names>
</name>
<name>
<surname>Centurion-Lara</surname> <given-names>A</given-names>
</name>
<name>
<surname>Lukehart</surname> <given-names>SA</given-names>
</name>
<name>
<surname>Van Voorhis</surname> <given-names>WC</given-names>
</name>
</person-group>. <article-title>Subfamily I <italic>Treponema Pallidum</italic> Repeat Protein Family: Sequence Variation and Immunity</article-title>. <source>Microbes Infect</source> (<year>2004</year>) <volume>6</volume>(<issue>8</issue>):<page-range>725&#x2013;37</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.micinf.2004.04.001</pub-id>
</citation>
</ref>
<ref id="B37">
<label>37</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Centurion-Lara</surname> <given-names>A</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>ES</given-names>
</name>
<name>
<surname>Barrett</surname> <given-names>LK</given-names>
</name>
<name>
<surname>Castro</surname> <given-names>C</given-names>
</name>
<name>
<surname>Lukehart</surname> <given-names>SA</given-names>
</name>
<name>
<surname>Van Voorhis</surname> <given-names>WC</given-names>
</name>
</person-group>. <article-title>Multiple Alleles of <italic>Treponema Pallidum</italic> Repeat Gene D in <italic>Treponema Pallidum</italic> Isolates</article-title>. <source>J Bacteriol</source> (<year>2000</year>) <volume>182</volume>(<issue>8</issue>):<page-range>2332&#x2013;5</page-range>. doi: <pub-id pub-id-type="doi">10.1128/JB.182.8.2332-2335.2000</pub-id>
</citation>
</ref>
<ref id="B38">
<label>38</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jumper</surname> <given-names>J</given-names>
</name>
<name>
<surname>Evans</surname> <given-names>R</given-names>
</name>
<name>
<surname>Pritzel</surname> <given-names>A</given-names>
</name>
<name>
<surname>Green</surname> <given-names>T</given-names>
</name>
<name>
<surname>Figurnov</surname> <given-names>M</given-names>
</name>
<name>
<surname>Ronneberger</surname> <given-names>O</given-names>
</name>
<etal/>
</person-group>. <article-title>Highly Accurate Protein Structure Prediction With AlphaFold</article-title>. <source>Nature</source> (<year>2021</year>) <volume>596</volume>(<issue>7873</issue>):<page-range>583&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41586-021-03819-2</pub-id>
</citation>
</ref>
<ref id="B39">
<label>39</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Holm</surname> <given-names>L</given-names>
</name>
</person-group>. <article-title>Using Dali for Protein Structure Comparison</article-title>. <source>Methods Mol Biol</source> (<year>2020</year>) <volume>2112</volume>:<fpage>29</fpage>&#x2013;<lpage>42</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/978-1-0716-0270-6_3</pub-id>
</citation>
</ref>
<ref id="B40">
<label>40</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Geysen</surname> <given-names>HM</given-names>
</name>
<name>
<surname>Meloen</surname> <given-names>RH</given-names>
</name>
<name>
<surname>Barteling</surname> <given-names>SJ</given-names>
</name>
</person-group>. <article-title>Use of Peptide Synthesis to Probe Viral Antigens for Epitopes to a Resolution of a Single Amino Acid</article-title>. <source>Proc Natl Acad Sci USA</source> (<year>1984</year>) <volume>81</volume>(<issue>13</issue>):<fpage>3998</fpage>&#x2013;<lpage>4002</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1073/pnas.81.13.3998</pub-id>
</citation>
</ref>
<ref id="B41">
<label>41</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Haynes</surname> <given-names>AM</given-names>
</name>
<name>
<surname>Godornes</surname> <given-names>C</given-names>
</name>
<name>
<surname>Ke</surname> <given-names>W</given-names>
</name>
<name>
<surname>Giacani</surname> <given-names>L</given-names>
</name>
</person-group>. <article-title>Evaluation of the Protective Ability of the Treponema Pallidum Subsp. Pallidum Tp0126 OmpW Homolog in the Rabbit Model of Syphilis</article-title>. <source>Infect Immun</source> (<year>2019</year>) <volume>87</volume>(<issue>8</issue>). doi:&#xa0;<pub-id pub-id-type="doi">10.1128/iai.00323-19</pub-id>
</citation>
</ref>
<ref id="B42">
<label>42</label>
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Giacani</surname> <given-names>L</given-names>
</name>
<name>
<surname>Lukehart</surname> <given-names>S</given-names>
</name>
<name>
<surname>Centurion Lara</surname> <given-names>A</given-names>
</name>
</person-group>. <source>Syphilis</source>. <person-group person-group-type="editor">
<name>
<surname>Barrett</surname> <given-names>A,LS</given-names>
</name>
</person-group>, editor. <publisher-loc>Cambridge, MA</publisher-loc>: <publisher-name>Academic Press</publisher-name> (<year>2009</year>).</citation>
</ref>
<ref id="B43">
<label>43</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Morgan</surname> <given-names>CA</given-names>
</name>
<name>
<surname>Lukehart</surname> <given-names>SA</given-names>
</name>
<name>
<surname>Van Voorhis</surname> <given-names>WC</given-names>
</name>
</person-group>. <article-title>Protection Against Syphilis Correlates With Specificity of Antibodies to the Variable Regions of <italic>Treponema Pallidum</italic> Repeat Protein K</article-title>. <source>Infect Immun</source> (<year>2003</year>) <volume>71</volume>(<issue>10</issue>):<page-range>5605&#x2013;12</page-range>. doi: <pub-id pub-id-type="doi">10.1128/IAI.71.10.5605-5612.2003</pub-id>
</citation>
</ref>
<ref id="B44">
<label>44</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Morgan</surname> <given-names>CA</given-names>
</name>
<name>
<surname>Molini</surname> <given-names>BJ</given-names>
</name>
<name>
<surname>Lukehart</surname> <given-names>SA</given-names>
</name>
<name>
<surname>Van Voorhis</surname> <given-names>WC</given-names>
</name>
</person-group>. <article-title>Segregation of B and T Cell Epitopes of <italic>Treponema Pallidum</italic> Repeat Protein K to Variable and Conserved Regions During Experimental Syphilis Infection</article-title>. <source>J Immunol</source> (<year>2002</year>) <volume>169</volume>(<issue>2</issue>):<page-range>952&#x2013;7</page-range>. doi: <pub-id pub-id-type="doi">10.4049/jimmunol.169.2.952</pub-id>
</citation>
</ref>
<ref id="B45">
<label>45</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Morgan</surname> <given-names>CA</given-names>
</name>
<name>
<surname>Lukehart</surname> <given-names>SA</given-names>
</name>
<name>
<surname>Van Voorhis</surname> <given-names>WC</given-names>
</name>
</person-group>. <article-title>Immunization With the N-Terminal Portion of <italic>Treponema Pallidum</italic> Repeat Protein K Attenuates Syphilitic Lesion Development in the Rabbit Model</article-title>. <source>Infect Immun</source> (<year>2002</year>) <volume>70</volume>(<issue>12</issue>):<page-range>6811&#x2013;6</page-range>. doi: <pub-id pub-id-type="doi">10.1128/IAI.70.12.6811-6816.2002</pub-id>
</citation>
</ref>
<ref id="B46">
<label>46</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cameron</surname> <given-names>CE</given-names>
</name>
<name>
<surname>Lukehart</surname> <given-names>SA</given-names>
</name>
<name>
<surname>Castro</surname> <given-names>C</given-names>
</name>
<name>
<surname>Molini</surname> <given-names>B</given-names>
</name>
<name>
<surname>Godornes</surname> <given-names>C</given-names>
</name>
<name>
<surname>Van Voorhis</surname> <given-names>WC</given-names>
</name>
</person-group>. <article-title>Opsonic Potential, Protective Capacity, and Sequence Conservation of the <italic>Treponema Pallidum</italic> Subspecies <italic>Pallidum</italic> Tp92</article-title>. <source>J Infect Dis</source> (<year>2000</year>) <volume>181</volume>(<issue>4</issue>):<page-range>1401&#x2013;13</page-range>. doi: <pub-id pub-id-type="doi">10.1086/315399</pub-id>
</citation>
</ref>
<ref id="B47">
<label>47</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Arroll</surname> <given-names>TW</given-names>
</name>
<name>
<surname>Centurion-Lara</surname> <given-names>A</given-names>
</name>
<name>
<surname>Lukehart</surname> <given-names>SA</given-names>
</name>
<name>
<surname>Van Voorhis</surname> <given-names>WC</given-names>
</name>
</person-group>. <article-title>T-Cell Responses to <italic>Treponema Pallidum</italic> Subsp. <italic>Pallidum</italic> Antigens During the Course of Experimental Syphilis Infection</article-title>. <source>Infect Immun</source> (<year>1999</year>) <volume>67</volume>(<issue>9</issue>):<page-range>4757&#x2013;63</page-range>. doi: <pub-id pub-id-type="doi">10.1128/IAI.67.9.4757-4763.1999</pub-id>
</citation>
</ref>
<ref id="B48">
<label>48</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cameron</surname> <given-names>CE</given-names>
</name>
<name>
<surname>Castro</surname> <given-names>C</given-names>
</name>
<name>
<surname>Lukehart</surname> <given-names>SA</given-names>
</name>
<name>
<surname>Van Voorhis</surname> <given-names>WC</given-names>
</name>
</person-group>. <article-title>Function and Protective Capacity of <italic>Treponema Pallidum</italic> Subsp. <italic>Pallidum</italic> Glycerophosphodiester Phosphodiesterase</article-title>. <source>Infect Immun</source> (<year>1998</year>) <volume>66</volume>(<issue>12</issue>):<page-range>5763&#x2013;70</page-range>. doi: <pub-id pub-id-type="doi">10.1128/IAI.66.12.5763-5770.1998</pub-id>
</citation>
</ref>
<ref id="B49">
<label>49</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>LaFond</surname> <given-names>RE</given-names>
</name>
<name>
<surname>Molini</surname> <given-names>BJ</given-names>
</name>
<name>
<surname>Van Voorhis</surname> <given-names>WC</given-names>
</name>
<name>
<surname>Lukehart</surname> <given-names>SA</given-names>
</name>
</person-group>. <article-title>Antigenic Variation of TprK V Regions Abrogates Specific Antibody Binding in Syphilis</article-title>. <source>Infect Immun</source> (<year>2006</year>) <volume>74</volume>(<issue>11</issue>):<page-range>6244&#x2013;51</page-range>. doi: <pub-id pub-id-type="doi">10.1128/IAI.00827-06</pub-id>
</citation>
</ref>
<ref id="B50">
<label>50</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cretich</surname> <given-names>M</given-names>
</name>
<name>
<surname>Gori</surname> <given-names>A</given-names>
</name>
<name>
<surname>D&#x2019;Annessa</surname> <given-names>I</given-names>
</name>
<name>
<surname>Chiari</surname> <given-names>M</given-names>
</name>
<name>
<surname>Colombo</surname> <given-names>G</given-names>
</name>
</person-group>. <article-title>Peptides for Infectious Diseases: From Probe Design to Diagnostic Microarrays</article-title>. <source>Antibodies</source> (<year>2019</year>) <volume>8</volume>(<issue>1</issue>):<fpage>23</fpage>. doi: <pub-id pub-id-type="doi">10.3390/antib8010023</pub-id>
</citation>
</ref>
<ref id="B51">
<label>51</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Roy</surname> <given-names>A</given-names>
</name>
<name>
<surname>Kucukural</surname> <given-names>A</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y</given-names>
</name>
</person-group>. <article-title>I-TASSER: A Unified Platform for Automated Protein Structure and Function Prediction</article-title>. <source>Nat Protoc</source> (<year>2010</year>) <volume>5</volume>(<issue>4</issue>):<page-range>725&#x2013;38</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nprot.2010.5</pub-id>
</citation>
</ref>
<ref id="B52">
<label>52</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Heged&#x171;s</surname> <given-names>T</given-names>
</name>
<name>
<surname>Geisler</surname> <given-names>M</given-names>
</name>
<name>
<surname>Luk&#xe1;cs</surname> <given-names>G</given-names>
</name>
<name>
<surname>Farkas</surname> <given-names>B</given-names>
</name>
</person-group>. <article-title>AlphaFold2 Transmembrane Protein Structure Prediction Shines</article-title>. <source>bioRxiv</source> (<year>2021</year>). doi:&#xa0;<pub-id pub-id-type="doi">10.1101/2021.08.21.457196</pub-id>
</citation>
</ref>
<ref id="B53">
<label>53</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Anand</surname> <given-names>A</given-names>
</name>
<name>
<surname>LeDoyt</surname> <given-names>M</given-names>
</name>
<name>
<surname>Karanian</surname> <given-names>C</given-names>
</name>
<name>
<surname>Luthra</surname> <given-names>A</given-names>
</name>
<name>
<surname>Koszelak-Rosenblum</surname> <given-names>M</given-names>
</name>
<name>
<surname>Malkowski</surname> <given-names>MG</given-names>
</name>
<etal/>
</person-group>. <article-title>Bipartite Topology of Treponema Pallidum Repeat Proteins C/D and I: OUTER MEMBRANE INSERTION, TRIMERIZATION, AND PORIN FUNCTION REQUIRE A C-TERMINAL &#x3b2;-BARREL DOMAIN</article-title>. <source>J Biol Chem</source> (<year>2015</year>) <volume>290</volume>(<issue>19</issue>):<page-range>12313&#x2013;31</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1074/jbc.M114.629188</pub-id>
</citation>
</ref>
<ref id="B54">
<label>54</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Leader</surname> <given-names>BT</given-names>
</name>
<name>
<surname>Hevner</surname> <given-names>K</given-names>
</name>
<name>
<surname>Molini</surname> <given-names>BJ</given-names>
</name>
<name>
<surname>Barrett</surname> <given-names>LK</given-names>
</name>
<name>
<surname>Van Voorhis</surname> <given-names>WC</given-names>
</name>
<name>
<surname>Lukehart</surname> <given-names>SA</given-names>
</name>
</person-group>. <article-title>Antibody Responses Elicited Against the <italic>Treponema Pallidum</italic> Repeat Proteins Differ During Infection With Different Isolates of <italic>Treponema Pallidum</italic> Subsp. <italic>Pallidum</italic>
</article-title>. <source>Infect Immun</source> (<year>2003</year>) <volume>71</volume>(<issue>10</issue>):<page-range>6054&#x2013;7</page-range>. doi: <pub-id pub-id-type="doi">10.1128/IAI.71.10.6054-6057.2003</pub-id>
</citation>
</ref>
<ref id="B55">
<label>55</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Giacani</surname> <given-names>L</given-names>
</name>
<name>
<surname>Molini</surname> <given-names>B</given-names>
</name>
<name>
<surname>Godornes</surname> <given-names>C</given-names>
</name>
<name>
<surname>Barrett</surname> <given-names>L</given-names>
</name>
<name>
<surname>Van Voorhis</surname> <given-names>WC</given-names>
</name>
<name>
<surname>Centurion-Lara</surname> <given-names>A</given-names>
</name>
<etal/>
</person-group>. <article-title>Quantitative Analysis of <italic>Tpr</italic> Gene Expression in <italic>Treponema Pallidum</italic> Isolates: Differences Among Isolates and Correlation With T-Cell Responsiveness in Experimental Syphilis</article-title>. <source>Infect Immun</source> (<year>2007</year>) <volume>75</volume>(<issue>1</issue>):<page-range>104&#x2013;12</page-range>. doi: <pub-id pub-id-type="doi">10.1128/IAI.01124-06</pub-id>
</citation>
</ref>
<ref id="B56">
<label>56</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Victora</surname> <given-names>GD</given-names>
</name>
<name>
<surname>Nussenzweig</surname> <given-names>MC</given-names>
</name>
</person-group>. <article-title>Germinal Centers</article-title>. <source>Annu Rev Immunol</source> (<year>2012</year>) <volume>30</volume>(<issue>1</issue>):<page-range>429&#x2013;57</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1146/annurev-immunol-020711-075032</pub-id>
</citation>
</ref>
<ref id="B57">
<label>57</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Briney</surname> <given-names>B</given-names>
</name>
<name>
<surname>Sok</surname> <given-names>D</given-names>
</name>
<name>
<surname>Jardine</surname> <given-names>JG</given-names>
</name>
<name>
<surname>Kulp</surname> <given-names>DW</given-names>
</name>
<name>
<surname>Skog</surname> <given-names>P</given-names>
</name>
<name>
<surname>Menis</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>Tailored Immunogens Direct Affinity Maturation Toward HIV Neutralizing Antibodies</article-title>. <source>Cell</source> (<year>2016</year>) <volume>166</volume>(<issue>6</issue>):<fpage>1459</fpage>&#x2013;<lpage>70.e11</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.cell.2016.08.005</pub-id>
</citation>
</ref>
<ref id="B58">
<label>58</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jardine</surname> <given-names>JG</given-names>
</name>
<name>
<surname>Ota</surname> <given-names>T</given-names>
</name>
<name>
<surname>Sok</surname> <given-names>D</given-names>
</name>
<name>
<surname>Pauthner</surname> <given-names>M</given-names>
</name>
<name>
<surname>Kulp</surname> <given-names>DW</given-names>
</name>
<name>
<surname>Kalyuzhniy</surname> <given-names>O</given-names>
</name>
<etal/>
</person-group>. <article-title>Priming a Broadly Neutralizing Antibody Response to HIV-1 Using a Germline-Targeting Immunogen</article-title>. <source>Science</source> (<year>2015</year>) <volume>349</volume>(<issue>6244</issue>):<page-range>156&#x2013;61</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1126/science.aac5894</pub-id>
</citation>
</ref>
<ref id="B59">
<label>59</label>
<citation citation-type="book">
<source>National Research Council (US) Committee for the Update of the Guide for the Care and Use of Laboratory Animals</source>. <publisher-loc>Washington DC</publisher-loc>: <publisher-name>The National Academic Press</publisher-name> (<year>2011</year>).</citation>
</ref>
<ref id="B60">
<label>60</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lukehart</surname> <given-names>SA</given-names>
</name>
<name>
<surname>Marra</surname> <given-names>CM</given-names>
</name>
</person-group>. <article-title>Isolation and Laboratory Maintenance of Treponema Pallidum</article-title>. <source>Curr Protoc Microbiol</source> (<year>2007</year>) <volume>7</volume>:<page-range>12A.1.1&#x2013;A.1.8</page-range>. doi: <pub-id pub-id-type="doi">10.1002/9780471729259.mc12a01s7</pub-id>
</citation>
</ref>
<ref id="B61">
<label>61</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Studier</surname> <given-names>FW</given-names>
</name>
</person-group>. <article-title>Protein Production by Auto-Induction in High Density Shaking Cultures</article-title>. <source>Protein Expr Purif</source> (<year>2005</year>) <volume>41</volume>(<issue>1</issue>):<page-range>207&#x2013;34</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.pep.2005.01.016</pub-id>
</citation>
</ref>
<ref id="B62">
<label>62</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Miles</surname> <given-names>AJ</given-names>
</name>
<name>
<surname>Ramalli</surname> <given-names>SG</given-names>
</name>
<name>
<surname>Wallace</surname> <given-names>BA</given-names>
</name>
</person-group>. <article-title>DichroWeb, a Website for Calculating Protein Secondary Structure From Circular Dichroism Spectroscopic Data</article-title>. <source>Protein Sci</source> (<year>2021</year>) <volume>31</volume>(<issue>1</issue>):<fpage>37</fpage>&#x2013;<lpage>46</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/pro.4153</pub-id>
</citation>
</ref>
<ref id="B63">
<label>63</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mirdita</surname> <given-names>M</given-names>
</name>
<name>
<surname>Sch&#xfc;tze</surname> <given-names>K</given-names>
</name>
<name>
<surname>Moriwaki</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Heo</surname> <given-names>L</given-names>
</name>
<name>
<surname>Ovchinnikov</surname> <given-names>S</given-names>
</name>
<name>
<surname>Steinegger</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>ColabFold - Making Protein Folding Accessible to All</article-title>. <source>bioRxiv</source> (<year>2021</year>). doi:&#xa0;<pub-id pub-id-type="doi">10.1101/2021.08.15.456425</pub-id>
</citation>
</ref>
<ref id="B64">
<label>64</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Suzek</surname> <given-names>BE</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>H</given-names>
</name>
<name>
<surname>McGarvey</surname> <given-names>PB</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>CH</given-names>
</name>
</person-group>. <article-title>UniRef Clusters: A Comprehensive and Scalable Alternative for Improving Sequence Similarity Searches</article-title>. <source>Bioinformatics</source> (<year>2015</year>) <volume>31</volume>(<issue>6</issue>):<page-range>926&#x2013;32</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/bioinformatics/btu739</pub-id>
</citation>
</ref>
<ref id="B65">
<label>65</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mitchell</surname> <given-names>AL</given-names>
</name>
<name>
<surname>Almeida</surname> <given-names>A</given-names>
</name>
<name>
<surname>Beracochea</surname> <given-names>M</given-names>
</name>
<name>
<surname>Boland</surname> <given-names>M</given-names>
</name>
<name>
<surname>Burgin</surname> <given-names>J</given-names>
</name>
<name>
<surname>Cochrane</surname> <given-names>G</given-names>
</name>
<etal/>
</person-group>. <article-title>MGnify: The Microbiome Analysis Resource in 2020</article-title>. <source>Nucleic Acids Res</source> (<year>2020</year>) <volume>48</volume>(<issue>D1</issue>):<page-range>D570&#x2013;d8</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/gkz1035</pub-id>
</citation>
</ref>
<ref id="B66">
<label>66</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Steinegger</surname> <given-names>M</given-names>
</name>
<name>
<surname>S&#xf6;ding</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>MMseqs2 Enables Sensitive Protein Sequence Searching for the Analysis of Massive Data Sets</article-title>. <source>Nat Biotechnol</source> (<year>2017</year>) <volume>35</volume>(<issue>11</issue>):<page-range>1026&#x2013;8</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nbt.3988</pub-id>
</citation>
</ref>
<ref id="B67">
<label>67</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Janson</surname> <given-names>G</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>C</given-names>
</name>
<name>
<surname>Prado</surname> <given-names>MG</given-names>
</name>
<name>
<surname>Paiardini</surname> <given-names>A</given-names>
</name>
</person-group>. <article-title>PyMod 2.0: Improvements in Protein Sequence-Structure Analysis and Homology Modeling Within PyMOL</article-title>. <source>Bioinformatics</source> (<year>2017</year>) <volume>33</volume>(<issue>3</issue>):<page-range>444&#x2013;6</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/bioinformatics/btw638</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>