Male C57BL/6 mice were purchased from Jackson Laboratories (Bar Harbor, ME, USA). Animals obtained from our outside vendor were acclimated no less than 7 days, and often longer [maximum ~5 weeks], prior to utilizing these animals in the studies described here. During this period, they were housed in the Rhode Island Hospital (RIH) rodent facility (12-h: 12-h light/dark cycle, 23°C–25°C, 30%–70% humidity) where they received standard care and diet (standard rodent chow)/water ad libitum. All protocols were carried out in the morning (8–11 a.m.) and were performed in accordance with the National Institutes of Health guidelines and as approved by the Animal Use Committee of Rhode Island Hospital (AWC# 5064-18 & 5054-21). VISTA^-/- mice were produced at the Brown University Transgenic Facility using CRISPR/Cas9 technology. Guide RNA sequences for the 5′ deletion site:

395_Vsir_ex2upsgRNA1: CTTAGTAACAAGACCCACAT

396_Vsir_ex2upsgRNA2: GCTTAGTAACAAGACCCACA

Guide RNA sequences for the 3′ deletion site:

398_Vsir_ex7sgRNA1: ATGTGCACTTGATCTATGGC (18-mer)

399_Vsir_ex7sgRNA2: GTGCCTAAAAGACTGTCCAA

The initial genotyping strategy and PCR results for G1 and F0 generations are described in Supplemental Figure 1 . A routine genotyping of VISTA^-/- mice was performed on tail biopsy samples collected after weaning. Tail samples were processed for PCR and treated with custom 25-nmol DNA oligos from Integrated DNA Technologies (Coralville, IA, USA). Following PCR amplification, samples were run on an SDS-Page gel and imaged for gene deletion analysis and validation. Male mice with appropriate base-pair deletion were used for downstream studies. All mice were housed, bred, and maintained at the Rhode Island Hospital Central Research Facilities.

Septic/critically ill patients who were admitted to trauma and surgical intensive care units, between July of 2018 and February of 2020, were enrolled in this study per institutional review board approval at Rhode Island Hospital (IRB study # 413013). Inclusion criteria for the study were trauma or sepsis-related critical illness requiring ICU admission. Patients were excluded from the study if they were pregnant or had previous lymphoma or leukemia diagnosis. Patient demographics from the day of blood draw were used to calculate the Acute Physiology of Chronic Health Evaluation II (APACHE II) score ( Table 1 ). Healthy volunteers (age- and sex-matched) were enrolled in this study to serve as the control group.

Cecal ligation and puncture (CLP) as described previously (35–37) was performed on wild-type C57BL/6 and VISTA^-/- male mice aged 8–10 weeks. Following midline laparotomy, the cecum was ligated ~1 cm above the cecal tip and punctured twice with a 22-G needle. Cecal contents were extruded into the intraperitoneal cavity. The abdomen was closed using a sterile PDO suture. Mice were treated with lidocaine on the muscle layer and a subcutaneous injection of 1 ml Lactated Ringer’s solution. The choice of male animals was made to maximize our ability to initially see an experimental difference septic response based on previous reports that male mice did poorer in response to these experimental stressors of septic (CLP) challenge than pro-estrus stratified female mice (38, 39). Mice were euthanized 24 h post procedure (based on the experiment as described in Figure 1 ), and tissues were harvested for downstream studies.

To assess indices of tissue injury, blood was collected from mice 24 h following sham or CLP procedure via cardiac puncture using a heparin-coated syringe. Blood sample was centrifuged at 10,000 rpm, and supernatant (plasma) was collected and stored at -80°C. For tissue injury assays, plasma was analyzed using the following kits according to the manufacturer’s protocol: Urea Nitrogen (BUN) Colorimetric Detection Kit (Invitrogen, Carlsbad, CA, USA, cat# EIABUN), Creatine Kinase Activity Assay Kit (Sigma-Aldrich, St. Louis, MO, USA: cat# MAK116), Alanine Aminotransferase (ALT) Activity Assay Kit (Sigma-Aldrich: cat# MAK052), Aspartate Aminotransferase (AST) Activity Assay Kit (Sigma-Aldrich: cat# MAK055), Amylase Assay Kit (Colorimetric) (Abcam, Cambridge, MA, USA: cat# ab102523), and Bilirubin Assay Kit (Direct Colorimetric) (Abcam: cat# ab235627).

Plasma samples were collected and stored as described in the previous section. To assess the cytokine concentration in plasma samples, the following multiplex kits were used according to the manufacturer’s instruction: LEGENDplex Mouse Inflammation Panel (13-plex) with a V-bottom plate (BioLegend, cat# 740446) and LEGENDplex MU Th Cytokine Panel (12-plex) with VbP VO3 (BioLegend, cat# 741044). Multiplex experiments were carried out using MACSQuant Analyzer 10 (Miltenyi Biotec). Data were analyzed using the LEGENDplex software suite (BioLegend).

Jurkat T_regs were cultured in RPMI complete medium with 13F3 (Bio X Cell, Lebanon, NH, USA, Cat# BE0310, RRID : AB_2736990) or Ig control (Bio X Cell Cat# BE0091, RRID : AB_1107773) for 30 min at 37°C, 5% CO₂ then stained with alamarBlue (Bio-Rad, Hercules, CA, USA: product code BUF012A) according to the manufacturer’s protocol. Sample absorbance was measured every 24 h for 7 days using the Bio-Rad spectrophotometer. Viability was calculated according to the manufacturer’s protocol.

Jurkat T_regs were cultured in RPMI complete medium with 13F3 (Bio X Cell Cat# BE0310, RRID : AB_2736990) or Ig control (Bio X Cell Cat# BE0091, RRID : AB_1107773) overnight at 37°C, 5% CO₂. Treated cells were then stimulated with 5 µl of plasma from CLP mouse for 2 h prior to harvest from culture. Cells were centrifuged, and supernatant was collected for multiplex analysis using LEGENDplex MU Th Cytokine Panel (12-plex) with VbP VO3 (BioLegend: cat# 741044) according to the manufacturer’s protocol. Multiplex experiments were carried out using MACSQuant Analyzer 10 (Miltenyi Biotec). Data were analyzed using LEGENDplex software suite (BioLegend).

Statistical significance between two groups was determined using either a two-tailed Student’s unpaired t test for parametric data or the Mann–Whitney U test for the non-parametric test. Statistical significance between multiple groups was determined using either an ordinary one-way ANOVA for parametric data or the Kruskal–Wallis test for non-parametric data. Alpha was set to 0.05 as the cutoff for statistical significance using Prism 9.3.0 (GraphPad Software) statistical software.

Several research groups have shown that during acute sepsis progression there is a significant loss in T cell abundance in the spleen and thymus in both the murine CLP model (29, 40–42) and septic patients (43–46). In this study, we found that C57BL/6 wild-type (WT) mice exhibited a higher VISTA expression on CD4⁺ T cells ( Figure 2A ) and reduced CD4⁺ T cell population abundance ( Figure 2B ) in the spleen following septic challenge.

We enrolled a total of 8 critically ill patients from the trauma and surgical ICUs at a single level-1 trauma center. There was no significant difference between patients and healthy controls regarding gender or age. 87.5% of patients had an active ongoing source of infection at the time of draw, 62.5% required mechanical ventilation, and 37.5% were actively on vasopressor at the time of draw. 25% required dialysis due to critical illness. The average APACHE II score for the population was 19.9 ( Table 1 ). Sources of infection included necrotizing soft tissue infections of the lower extremities, intra-abdominal abscesses after perforated hollow viscus injuries, and bacteremia. 75% of enrolled patients met systemic inflammatory response syndrome (SIRS) criteria, 63% met sepsis criteria, and 38% met septic shock criteria (47).

We found that critically ill patients experience a higher VISTA expression on circulating CD3⁺ T cells ( Figure 2C ) despite reduced CD3⁺ T cell population abundance ( Figure 2D ) in circulation. These results suggest that the relationship between VISTA expression and T-cell abundance observed in our murine model of sepsis appear to have a potential correlate in the critically ill septic patient. To further explore the role of VISTA in the sepsis-induced T-cell response and better understand its potential contribution to septic morbidity, we created a global VISTA gene-deficient (VISTA^-/-) mouse strain using CRISPR/Cas9 technology that could be examined to address this question ( Figures 2E, F ).

Le Tulzo et al. found that T cells become polarized into functionally distinct helper T-cell subsets in sepsis (44), and it is well documented that the regulatory T-cell (T_reg) subset increases during the acute septic response (46, 48, 49). In light of this, we chose to initially determine how VISTA impacted sepsis-induced T_reg polarization by comparing the CD4⁺Foxp3⁺ T_reg populations in WT as opposed to VISTA^-/- mice via flow cytometry ( Supplementary Figure 2 ).

We found that in the WT spleen, there is a significant increase in total proportion of CD4⁺ T_regs and VISTA⁺CD4⁺ T_regs following CLP ( Figures 3A–C ). VISTA^-/- mice exhibit decreased abundance of total CD4⁺ T_regs in the spleen ( Figures 3B, C ). In the thymus, we observe no change in VISTA expression on the T_reg populations between sham and CLP WT mice ( Supplementary Figures 3A, D ); however, VISTA^-/- mice have higher total abundance of CD4⁺ T_regs and CD4⁺CD8⁺ T_regs compared to WT mice ( Supplementary Figures 3B, E ). In the intraepithelial compartment of the small intestine, the frequency of VISTA⁺CD4⁺ T_regs increases significantly following CLP ( Figure 4A ) and VISTA^-/- mice have less CD4⁺ T_regs under steady-state (sham) and inflammatory (CLP) conditions compared to WT mice ( Figures 4B, C ). We did not observe any trends in the lamina propria compartment of the small intestine ( Supplementary Figure 4 ).

The loss in CD4⁺ T_regs in VISTA^-/- mice lead us to ask if the cell-surface expression signature, as it related to suppressive function of these cells, was altered by CLP. In the spleen, Foxp3, CTLA4, and CD25, but not CD69, are significantly upregulated on CD4⁺ T_regs in VISTA^-/- mice compared to WT mice under steady-state and inflammatory conditions ( Figures 5A–D ). In the thymus ( Figures 6A–G ), CD25 is significantly upregulated on CD4⁺ T_regs in VISTA^-/- mice compared to WT mice under steady state and inflammatory conditions ( Figure 6C ). CD4⁺ T_regs upregulate CD69 following CLP in WT and VISTA^-/- mice ( Figure 6D ). We also found that Foxp3, CTLA4, and CD25 are significantly upregulated on CD4⁺CD8⁺ T_regs in WT mice compared to VISTA^-/- mice under steady-state and inflammatory conditions ( Figures 6E–G ). In the lamina propria compartment, we observe a significant upregulation of CTLA4 on CD4⁺ T_regs in VISTA^-/- mice ( Supplementary Figure 5B ). However, this trend is not observed in the small intestinal intraepithelial compartment ( Supplementary Figure 6 ).

To expand from the T_reg phenotyping described above, we sought to measure the abundance of several cytokines in circulation implicated in the helper T cell response ( Figures 7A–J ). We found that VISTA^-/- mice have significantly higher circulating IL-17F and IL-23 compared to WT mice post CLP ( Figures 7G, I ).

Based on the apparent compensatory upregulation of suppressive T_reg mediators, we decided to compare the mortality and morbidity of VISTA^-/- as opposed to WT mice when subjected to CLP ( Figures 8A–J ). We found that VISTA^-/- mice had significantly decreased survival, which coincided with increased blood bilirubin, ALT, and AST 24 h following CLP ( Figures 8A, D–G ). VISTA^-/- mice also present a more proinflammatory systemic cytokine profile ( Figures 9A–J ). These mice exhibit higher circulating IL-6, IL-10, TNF-α, and MCP-1 compared to WT mice post CLP ( Figures 9C, D, G, I ).

To establish the contribution of VISTA⁺ T_regs to survival in murine sepsis, we chose to adoptively transfer pMSCV-mouse Foxp3-EF1α-GFP-T2A-puro stable Jurkat cells, hereby referred to as Jurkat T_regs, into VISTA^-/- mice prior to CLP. 48 h post adoptive transfer, Jurkat T_regs accumulate in the spleen, thymus, and small intestine ( Supplementary Figures 7A–D ) and express high levels of VISTA ( Supplementary Figures 7E–H ). Based on these results, we performed the adoptive transfer 48 h before CLP and then subsequently assessed overall survival. We found that, following Jurkat T_reg adoptive transfer, VISTA^-/- mice had comparable survival to WT mice post CLP ( Figure 10A ).

In addition to establishing the relevance of VISTA-expressing T_regs in septic mouse morbidity/mortality, we wanted to uncover how VISTA expression/ligation might be directly impacting T_reg function. To do this, we again utilized the Jurkat T_reg cell line for mechanistic in vitro studies. Jurkat T_regs were pretreated with a commercially available VISTA-neutralizing antibody, 13F3, or antibody control then stained with alamarBlue. alamarBlue is a redox indicator used to measure metabolic activity as a readout for viability. The concentration of alamarBlue was assessed via a spectrophotometer every 24 h for 7 days. We found that there was a significant reduction in viability following treatment and this reduction was maintained for 7 days without additional 13F3 treatment ( Figure 10B ). Upon in vitro acute stimulation of Jurkat T_regs with plasma from septic mice, these cells produce several helper T cell-related cytokines ( Figures 10C–I ) but failed to produce IFN-γ, IL-4, or IL-17A ( Supplementary Figure 8 ). Interestingly, 13F3-treated Jurkat T_regs produce lower levels of IL-9, IL-10, and IL-17F following acute stimulation ( Figures 10E, F, H ).

The T_reg classification as a distinct T cell lineage has been a point of contention due to the inherent plasticity of T_regs and the lack of a definitive “T_reg” marker as effector T cells can transiently express T_reg markers upon activation. Forkhead/winged-helix transcription factor box P3 (Foxp3) is arguably the most reliable T_reg marker in mice and was used to delineate effector T cells and T_regs in this study (55, 58, 59). CD4⁺Foxp3⁺ T cells are potent suppressors of effector CD4⁺ T cells, CD8⁺ T cells, natural killer (NK) cells, dendritic cells (DCs), and B cells under inflammatory conditions (55).

In this study, we found that VISTA expression and total CD4⁺ T_reg abundance increase significantly during the acute septic response. Further, this increase in peripheral T_reg abundance is dependent on VISTA expression. We also found that VISTA expression plays a role in orchestrating the cytokine response to septic challenge. Cytokines provide contextual immunologic cues that shape cell lineage determination and plasticity. Higher levels of IL-17F, IL-6, and IL-23 promote CD4⁺ T cell polarization toward a Th17 phenotype, and higher concentrations of these cytokines may explain the reduced T_reg abundance observed in VISTA^-/- mice (60, 61). Previous studies found that VISTA regulated the T_reg–Th17 polarization axis in mice (25), further supporting our results in the context of sepsis.

Interestingly, CTLA4 expression regulates the turnover and maintenance of T_regs at steady state while Foxp3 regulates T_reg function and lineage commitment (62–64). A steady-state T_reg pool is requisite for preventing autoimmune lymphoproliferative pathology (65). Several groups have shown that VISTA^-/- mice do not exhibit overt autoimmune pathologies under tolerogenic conditions (26, 53, 66). Therefore, we posit that the higher baseline expression of CTLA4, Foxp3, and CD25 in VISTA-deficient CD4⁺ T_regs represents an inherent compensatory mechanism to sustain peripheral tolerance under tolerogenic conditions.

An explanation may lie in the efficacy of CTLA4, Foxp3, and/or CD25-mediated suppression in our model. CD4⁺ T_regs utilize diverse contact-dependent and independent mechanisms to exert immune suppression (35–37, 67, 68). For example, CTLA4-expressing T_regs bind to B7-1/2 on antigen-presenting DCs, promoting trans-endocytosis of B7-1/2 and preventing DC-mediated activation of effector T cells. CD25 scavenges IL-2 from the environment, reduces IL-2 activation of effector T cells via competitive inhibition, and regulates the function of mature DCs (69).

Another mechanism by which T_regs exert immune suppression is by directly polarizing the monocyte lineage commitment from M1 to M2 macrophages (69, 70). M1 macrophages produce proinflammatory cytokines and exacerbate inflammation-derived tissue injury in sepsis (71). Two potent M1 cytokines, IL-6 and MCP-1, are highly upregulated in VISTA^-/- mice following septic challenge. M1-mediated pathology is particularly profound in the liver during infection (72), which may explain the increased acute liver injury observed in septic VISTA^-/- mice.

To determine if VISTA^-/- T_regs contribute to the survival deficit observed in VISTA^-/- mice, we adoptively transferred VISTA-overexpressing Jurkat T_regs into VISTA^-/- mice prior to septic challenge. We found that addition of Jurkat T_regs into VISTA^-/- mice rescues survival to wild-type levels. Upon VISTA blockade in vitro, the Jurkat T_regs exhibited reduced proliferative capacity and production of IL-9 and IL-10. T_reg-derived IL-9 plays a significant role in recruiting other suppressive immune cells, such as mast cells, to suppress bystander tissue damage as observed in a murine nephrotoxic serum nephritis model (73). T_reg-derived IL-10 is required to regulate effector T cells during acute inflammation (74, 75).

A recent study was published demonstrating a survival benefit upon VISTA antibody blockade prior to CLP (76). Importantly, in the Tao et al. study they utilized WT mice. However, it has also been shown that VISTA-gene-deficient mice have a predisposition to proinflammatory immune activation in several disease contexts (17, 20, 26, 66). Based on prior studies and our results, we believe that the VISTA-gene-deficient mice develop a predisposition to proinflammatory tissue injury that is exacerbated by CLP, thus resulting in a survival deficit. Consequently, acute VISTA blockade with an exogenous antibody in a developmentally normal WT mouse, as used in the Tao et al. study, might yield different results than observed in VISTA^-/- mice in our study.

In conclusion, we found that WT mice have increased VISTA⁺CD4⁺ T_regs and increased total CD4⁺ T_regs in the spleen and small intestine post CLP. This increase in total CD4⁺ T_reg abundance is lost in VISTA^-/- mice; however, VISTA^-/- CD4⁺ T_regs have a higher expression of Foxp3, CTLA4, and CD25 relative to WT mice. VISTA^-/- mice also have an altered cytokine profile including higher IL-6, IL-10, TNF-a, IL-17F, IL-23, and MCP-1 relative to WT mice. VISTA^-/- mice have higher indices of acute liver injury (i.e., bilirubin, ALT, and AST) and reduced survival post CLP compared to WT mice. Interestingly, we were able to rescue VISTA^-/- survival to WT levels by adoptively transferring VISTA-expressing Jurkat T_regs into VISTA^-/- mice prior to CLP. In addition, treating Jurkat T_regs with a VISTA-neutralizing antibody in vitro, reduced viability and cytokine production. We can conclude from these experiments that VISTA expression plays a pivotal role in promoting acute CD4⁺ T_reg survival/stability and regulating the cytokine milieu in acute sepsis to confer a survival benefit.

This study has raised questions as to the mechanism by which VISTA promotes T_reg survival. Interestingly, Foxp3 and VISTA are both under the transcriptional regulation of p53 and HIF-1α. In fact, p53-Foxp3 and HIF1α-Foxp3 induction are indispensable for protective T_reg suppression under inflammatory conditions (24, 77–79). The tentative relationship between VISTA and Foxp3 expression provide an additional line of query regarding T_reg plasticity.

Another area for further investigation concerns the effector immune cells that are non-redundantly regulated by VISTA⁺ T_regs. Based on results from this study, VISTA may act as a non-redundant marker for the T_reg subset responsible for regulating M1/M2 polarization and limiting acute liver injury in sepsis. More work must be done to fully elucidate these mechanisms; however, we think this study contributes a novel perspective on checkpoint regulator, VISTA, in the acute sepsis response.