C57Bl/6 mice from the Jackson Laboratory and C57Bl/6 IFNARko were kindly donated by Dan Campell and were bred and maintained in the animal facility at the University of British Columbia. All animal work was performed in accordance with the regulation of the Canadian Council for Animal Care. The protocol was approved by the Animal Care Committee (ACC) of the University of British Columbia (Protocols A17- 0105, A17-018)

Female and male mice between 8-10 weeks of age were infected intranasally (i.n.) with 100 pfu of γHV-68 WUMS strain (purchased from ATCC, propagated on BHK cells) or 15 μl of PBS as a control. EAE was induced at 5- 6 weeks post infection by injecting 100μl of emulsified Complete Freund’s Adjuvant (DIFCO) with 200μg of MOG _35-55 (GenScript) and 400μg of desiccated Mycobacterium tuberculosis H37ra (DIFCO) subcutaneously. Mice also received two doses of 200ng of pertussis toxin (List Biologicals) via i.p. at the time of immunization and then again 48 hours later. EAE was assessed on a score from 0 to 5 as follows: 0, no clinical symptoms, 0.5 partially limp tail; 1, paralyzed tail; 2, loss of coordination; 2.5, one hind limb paralyzed; 3, both hind limbs paralyzed; 3.5, both hind limbs paralyzed accompanied by weakness in the forelimbs; 4, forelimbs paralyzed (humane endpoint); 5, moribund or dead.

qPCR analysis of DNA samples was performed using 2x Quantitect Probe Mastermix (Qiagen, USA) on the Bio-Rad CFX96 Touch™ Real Time PCR Detection system. Primers, probes and gBlocks^® were obtained from Integrated DNA Technologies. Quantification of copies of mouse genome was done on 10ng of DNA by using primers and probe for a region of the mouse PTGER2 gene (Forward Primer: 5’ – TACCTTCAGCTGTACGCCAC – 3’; Reverse Primer: 5’ – GCCAGGAGAATGAGGTGGTC – 3’; Probe: 5’ –/56-FAM/CCTGCTGCT/ZEN/TATCGTGGCTG/3IABkFQ/– 3’) and absolutely quantified by use of a standard curve using concentrations from 5x10⁷ copies/ul to 5x10¹ copies/ul. Quantification of copies of the γ-HV68 genome was done on 100ng of DNA by using primers and probe for a region of ORF50 (Forward Primer: 5’ –TGGACTTTGACAGCCCAGTA – 3’; Reverse Primer: 5’ – TCCCTTGAGGCAAATGATTC – 3’; Probe: 5’ –/56-FAM/TGACAGTGC/ZEN/CTATGGCCAAGTCTTG/3IABkFQ/– 3’) and absolutely quantified by use of a separate standard curve using concentrations from 2x10⁴ copies/ul to 2 copies/ul. Samples were run using a minimum of two technical replicates and all standard curves had an R² greater than 0.95. The protocol was as follows: 95°C for 15 minutes, 95°C for 15s, 60°C for 1 min, repeated 50 times. Quantification of copy number was done using the CFX manager software. The ratio of virus genome copy number to mouse genome copy number was obtained using the following equation: # copies of ORF 50 # copies of  P T G E R × 2   c o p i e s   P T G E R 2 / g e n o m e 1 c o p y O R F 50 / g e n o m e   ( s i m p l i f i e d   t o   # copies of ORF 50 # copies of  P T G E R × 2 )

Mice were euthanized two weeks post EAE induction. They were perfused with 30cc of PBS, and brains, spinal cords, and spleens were isolated. A single cell suspension was generated from each organ. Immune cells from the CNS were isolated using a 30% Percoll gradient. For intracellular staining, CNS mononuclear cells, were stimulated for 4 hours in DMEM (Gibco) containing 10% FBS (Gibco), GolgiPlug (BD Biosciences), 10ng/ml PMA, and 500ng/ml ionomycin. Antibodies for the cell surface markers were added to the cells in PBS with 2% FBS for 30 min on ice. After washing, cells were resuspended in Fix/Perm buffer (eBiosciences) for 30-45 minutes on ice, washed twice, and incubated with Abs for intracellular antigens (cytokines and transcription factors) in Perm buffer (30 min, on ice). Fluorescently conjugated antibodies directed against CD4 (clone RM4-5), CD8 (clone 53-6.7), CD3 (clone eBio500A2), IFN-γ (clone XMG1.2), Foxp3 (clone FJK-16s), and IL-17 (eBio17B7) were all purchased from eBiosciences. Samples were acquired using a FACS LSR II (BD Biosciences) and analyzed with FlowJo software (Tree Star, Inc.).

Spleens from IFNARko mice were isolated and a single cell suspension was obtained. Memory B cell enrichment was performed using a custom kit from STEMCELL that contained a combination of monoclonal antibodies, including IgD, as negative selection antibodies. After enrichment, cells were washed in blank DMEM and were adjusted to a concentration of 1-1.5 x10⁶ cells/200μl. Cells were injected IP into WT mice and, the following day, EAE was induced.

Results are reported as mean + standard error of the mean (SEM). Two-way ANOVA followed by Bonferroni’s correction for multiple comparisons was employed to compare EAE scores. Unpaired Student’s t-test was used for all other analyses (GraphPad Prism). A p Value of <0.05 was considered statistically significant ns > 0.05, * ≤ 0.05, ** ≤ 0.01, *** ≤ 0.001, **** ≤ 0.0001.

Both INFα and β signal through the receptor for IFNα/β (8). To study the effect of type I IFNs in the enhancement of EAE in mice latently infected with γHV-68, IFNARko mice, which lack the IFNα β receptor, are a useful tool. It has previously been described that IFNARko mice are able to control γHV-68 infection and successfully establish a latent infection in a similar proportion as WT mice (9). However, due to the lack of type I IFN response, the virus quickly overwhelms the mouse’s immune response and, at high doses, has a higher mortality rate during acute infection, not allowing the establishment of latency (9). Prior work by Barton et al. demonstrated that a 100pfu dose of γHV-68 given intranasally reduced mortality in IFNARko mice. We found that this regimen resulted in a survival rate of 75% ( Figure 1A ) and allowed the immune system to control the acute infection while still letting the virus establish latent infection. Quantification of latency with this low dose shows a slightly lower number of copies in IFNARko mice compared to WT, however this difference was not statistically significant ( Figure 1B ). These results are similar to what has been previously described by Barton (9).

The presence of Type I IFNs has been associated with a protective effect in MS patients. One of the first lines of treatment for MS is IFN-beta. However, as many as 30-50% of patients do not respond to the treatment (13). The mechanism for why this happens has not been described yet. Here, we explored whether the absence of type I IFN receptor had any effect on the ability of γHV-68 to drive the infiltration of immune cells into the CNS when IFNARko mice were latently infected with γHV-68.

Previously, we reported that latent γHV-68 leads to a strong infiltration of CD4⁺ and CD8⁺ T cells in the CNS during EAE, and this T cell response is heavily skewed towards a Th1 phenotype (6). We infected IFNARko mice with γHV-68 and waited 5 weeks to allow for the establishment of latency. After this time, EAE was induced. As expected from previous reports (14), IFNARko mice demonstrated a slightly clinically enhanced EAE compared to WT uninfected mice although the difference is not significant. However, IFNARko mice showed a higher clinical score when they are infected with γHV-68 and there is a significant difference in score compared to WT uninfected mice ( Figure 2 and Supplementary Figure 1 ). Uninfected IFNARko mice show limited infiltration of T cells to the brain, and most of these cells are CD4⁺. On the contrary, IFNARko mice latently infected with γHV-68 show high levels of T cells infiltrating the brain ( Figures 3A, B ) and spinal cord (not shown), in particular CD8⁺ T lymphocytes. Remarkably, the amount of T cell infiltration in the CNS of γHV-68 IFNARko mice equals the one from γHV-68 WT mice. This is accompanied by a strong production of IFNγ and a downregulation of IL-17 ( Figures 3C, D ). This T cell infiltration and cytokine profile is comparable to what we had previously observed in WT mice latently infected with γHV-68, which suggests that T cell infiltration and/or cellular enhanced infiltration into the CNS does not depend on the presence of Type I IFNs.

Both our lab and others (Gasper-Smith 2006, Casiraghi 2015) have described that latent infection of γHV-68 leads to the downregulation of Tregs in the CNS and in the periphery. This downregulation is sustained after EAE induction. It has also been shown that depletion of Tregs during EAE exacerbates symptoms by facilitating an upregulation of cytokine production by T cells (15). We observed a marked downregulation in the number of Tregs in the periphery of IFNARko during γHV-68 latency ( Figure 4 and Supplementary Figure 2 ); interestingly, although downregulation of Tregs is sustained after EAE induction in latently infected mice, Tregs are also downregulated in uninfected IFNARko mice ( Figure 4 ).

Finally, we tested whether type I IFN signaling was necessary to transfer disease into WT mice. Previously we showed that enriched CD19⁺ IgD^- B cells from γHV-68 mice, which are the main reservoir of γHV-68 during latency, are able to transfer EAE enhancement into naïve mice (12). When we transfer the CD19⁺IgD^- B cells from infected IFNARko mice into WT mice, we find that B cells from IFNARko mice infected with γHV-68 do not drive a strong infiltration of CD8⁺ T cells into the CNS ( Figures 5B, C ). Interestingly, B cells from γHV68 mice have a slight effect in the production of IFNγ and downregulation of IL-17 ( Figure 5D, E ). This suggests that while type I IFNs are directly responsible of skewing a strong Th1 response they might have a role in the infiltration of CD8 T cells into the CNS.