Wild-type (WT) and Il10^-/- mice on the C57BL/6J background maintained under specific pathogen free (SPF) conditions were used to generate BMDMs. Germ free Il10^-/- mice (C57BL/6J background) were bred and maintained by the National Gnotobiotic Rodent Resource Center (NGRRC) and used to evaluate the clinical efficacy of (+)-JQ1.

8-12-week-old Il10^-/- mice (C57BL/6J background; 22 male mice and 10 female mice) were removed from germ free housing and placed in isolation in a BSL2 facility for the duration of these experiments. Treatment group assignments were balanced for gender. Mice were injected with 50 mg/kg (+)-JQ1 (MedChemExpress, #HY-13030) resuspended in 20% sulfobutylether-β-cyclodextrin (SBE-β-CD) (MedChemExpress, #HY-17031) or 10% DMSO diluted in 20% SBE-β-CD. Mice were subsequently colonized with slurries made from feces of C57BL/6J mice raised under SPF conditions resuspended in pre-reduced anaerobic 1x PBS by oral and rectal swabbing. Additional injections were given on Days 3, 6, 9, and 12. Weight was measured daily through to harvest on Day 14.

BMDMs from 12-week-old male (3 Il10^-/- and 4 WT) mice were harvested and cultured as previously described in biological triplicate (9). BMDMs were counted and re-plated in duplicate for RNA- and ATAC-seq experiments. Macrophages were treated with 500nM (+)-JQ1 (MedChemExpress #HY-13030), 10 ng/mL recombinant IL-10 (PeproTech, #210-10), or vehicle control for 12 hours followed by the addition of 50 ng/mL LPS (InvivoGen, #tlrl-peklps) for 4 hours. Untreated, unstimulated WT or Il10^-/- BMDMs served as an additional control and remained in culture for 16 hours. Samples were collected in TRIzol or freezing media for RNA- and ATAC-seq experiments, respectively. Cell culture supernatants were collected and stored for cytokine secretion analyses using Luminex.

RNA was isolated from murine BMDMs using the Norgen Biotek Corp. Total RNA Purification Kit (Cat. 17200) according to the manufacturer’s protocols. These kits use column-based DNase treatment to eliminate DNA contamination.

RNA-seq libraries were prepared using the Illumina KAPA Stranded RNA-seq Kit with RiboErase (HMR). Paired-end (50bp) sequencing was performed on the Illumina HiSeq 4000 platform (Gene Expression Omnibus [GEO] accession no. 184563). Reads were extracted using TagDust v1.13 and aligned to the mm9 genome assemblies using STAR with default parameters (9, 38, 39). Reads were quantified using RSEM v1.2.31 with default parameters (9, 40). PCA was performed using the prcomp function in R on DESeq2 normalized variance stabilizing transformation (VST) transformed counts for the top 1,000 most variably expressed genes (41).

Pairwise differential gene expression was determined using the DESeq2 Wald test (41). Pairwise DEGs between LPS stimulated and unstimulated controls, between LPS stimulated + (+)-JQ1 treated and unstimulated controls, and LPS stimulated and LPS stimulated + (+)-JQ1 treated were determined, the latter used to indicate whether (+)-JQ1 treatment promoted increased or decreased relative gene expression. To focus on genes significantly affected by (+)-JQ1 treatment during LPS stimulation, gene expression for individual biological replicates for LPS stimulated and LPS + (+)-JQ1 conditions were normalized to the average expression across unstimulated ll10^-/- BMDMs and DEGs (base mean expression ≥ 10 and FDR < 0.05) were identified using the likelihood ratio test (LRT) in DESeq2 (41). Distinct gene expression classes (I – X) were identified based on varying combinations of levels of statistical significance and log₂ fold-change of individual Wald tests ( Supplementary Table 1 ). Z-scores were calculated based on the log₂ fold-change of individual biological replicates for LPS stimulated and LPS stimulated + (+)-JQ1 treated samples normalized to the average of the unstimulated and untreated Il10^-/- BMDMs. These z-scores were used to generate heatmaps of the ten classes. Enriched KEGG pathways (FDR < 0.05) were identified using Enrichr (42).

ATAC-seq was performed as previously described (43). To prepare nuclei, cells were pelleted and washed with cold PBS followed by lysis using cold lysis buffer (10mM Tris-HCl, 10mM NaCl, 3 mM MgCl2, and 0.1% NP-40). Pelleted nuclei underwent transposition using the Nextera DNA Library Prep Kit (Illumina #FC-121-1030). Samples were resuspended in the transposition reaction (12.5µL 2x TD buffer, 2 µL transposase, and 10.5 µL nuclease-free water) and incubated at 37C for 1 hour at 1000 RPM. Transposed DNA samples were purified using the Qiagen MinElute Kit (#28204) followed by amplification using 1x PCR master mix (NEB #M0541S) and 25µM Ad1_noMX and Ad2.* indexing primer for 10-14 cycles. Libraries were purified and size selected by magnetic separation using Agencourt AMPure XP magnetic beads (Beckman Coulter #A63880). Paired-end (50bp) sequencing was performed on the Illumina HiSeq 4000 platform (GEO accession no. 183564). Data was processed using PEPATAC v0.9.0 with default parameters (44). Uniquely mapped reads were aligned to the mm9 genome using bowtie2 (45). Peaks were called on individual samples using MACS2 (46, 47). ChIPSeeker was used to classify peaks as promoter or distal, where any peak that that did not fall in the -1000bp/+100bp from the TSS of mm9 reference genes was classified as distal (48). BEDTools was used to determine distal peaks +/-25kb from the TSS (50kb window) of each gene (49).

PCA was performed using the prcomp function in R on DESeq2 normalized, variance stabilizing transformation (VST) transformed counts for the top 10,000 most variably accessible peaks (41). Promoter and distal peaks were calculated and scaled with the computeMatrix tool from DeepTools v 3.5.0 and plotted using either plotHeatmap or plotProfile (50). Differentially accessible regions (DARs) across the union set of peaks was determined using DESeq2 (41). DARs with a |log₂ fold-change| > 1 were identified using VennDiagram v1.6.20 (51). VST transformed counts were used for Spearman-ranked correlation analyses.

For each gene, DARs +/-25kb of the TSS were associated with the gene. Enrichments of DARs around genes in expression-defined categories (I – X) were calculated using a hypergeometric test. Known transcription factor motif analysis was performed with findMotifsGenome from HOMER using the middle 500bp window of DARs (FDR < 0.05). The annotatePeaks command was used to identify the location of enriched transcription factor motifs (FDR < 0.10) (52, 53). Motif matrices were clustered using Regulatory Sequence Analysis Tools (RSAT) using the Ncor metric for motif-to-motif similarity matrix with the lower thresholds set to 5 for width, 0.7 for Pearson correlation, and 0.4 for relative width-normalized Pearson correlation (54).

Cytokine levels for BAFF, CRP, IL-12p70, IL-6, IL-27, LDLR, MCP-1, MCP-2, MIP-1α, and TNF-α found in cell culture medium following WT and Il10^-/- BMDM stimulation were measured by Luminex (R&D) and analyzed on a Bio-plex 200 (Bio-Rad Laboratories). Cytokine levels were calculated based on the standard curve for each analyte. Samples were plated in technical duplicate and biological triplicate. Data-points are representative of the average of technical duplicates for each sample.

Slides containing sections of proximal and distal colon were prepared for H & E staining. Two independent scorers blinded to the experimental and control groups performed histological analysis using an established scoring system for evaluating goblet cell loss and submucosal infiltrate in animal models (55). Histological sub-scores were added together to generate a composite histology score.

Total RNA was isolated from WT and Il10^-/- BMDMs for all experimental conditions and caecal tissue taken from GF (Day 0) and colonized (Day 14) Il10^-/- mice using the Norgen Biotek Corp. Total RNA Purification Kit (Cat. 17200). cDNA was derived from 500ng RNA by reverse transcriptase using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, 4368814) according to the manufacturer’s specifications. Quantitative real-time PCR was performed using 10ng cDNA with the PowerUp SYBR Green Master Mix (Applied Biosystems, A25741) and 10 µM of forward and reverse primers for Il12β (F: 5’ CGCAAGAAAGAAAAGATGAAGGAG 3’ R: 5’ TTGCATTGGACTTCGGTAGATG 3’), Tnf (F: 5’ ACCCTCACACTCAGATCATCTTCTC 3’ R: 5’ TGAGATCCATGCCGTTGG 3’) and β-actin (F: 5’ AGCCATGTACGTAGCCATCCAG 3’ R: 5’ TGGCGTGAGGGAGAGCATAG 3’). Reactions were performed in triplicate for each biological sample. Fold-change was calculated by determining ΔΔCt for all reactions followed by normalization to the average ΔΔCt value for unstimulated BMDMs and GF animals.

Il10^-/- BMDMs were cultured for 16 hours with 500nM (+)-JQ1. Cells were washed with cold 1x PBS followed by staining with LIVE/DEAD Fixable Blue Dead Cell Stain Kit (1:1000; Invitrogen L23105). Cell cycle changes in (+)-JQ1 treated Il10^-/- BMDMs were assessed using the BD Pharmigen BrdU Flow kit according to the manufacturer (559619). Briefly, Il10^-/- BMDMs were co-cultured with BrdU and treated with (+)-JQ1 for 16 hours followed by fixation and permeabilization. Cells were treated with DNase followed by staining with FITC-conjugated anti-BrdU.

Bulk LPMCs from Il10^-/- mice were washed with cold 1x PBS and stained for viability followed by cell-surface marker staining for CD45 (1:100; Clone 30-F11, BioLegend), CD3ε (1:300; Clone 145-2C11, BioLegend), CD19 (1:200; Clone 6D5, BioLegend), CD11b (1:200; M1/70, BD Biosciences), CD11c (1:200; Clone N418, BioLegend), and F4/80 (1:200; Clone BM8, BioLegend) diluted in staining buffer (5% FBS/PBS). All samples were fixed with 4% PFA. Data was acquired with the FACSDIVA software using the BD LSR II and analyzed using FlowJo version 10.7.1.

Differential analyses of ATAC-seq and RNA-seq data were performed using DESeq2 with FDR adjusted P values used to measure statistical significance (41). Spearman rank correlations of VST transformed counts were calculated using RStudio Version 1.2.5033. Known motif enrichment was determined using HOMER, which generates P values by screening a library of reliable motifs against target and background sequences. GraphPad Prism 8 for Mac (Graphpad Software Inc.) was used for all other statistical analyses. Statistical significance of change in the number of DARs with a |log₂ fold-change| > 0.5 for each condition was determined using a 2x2 chi-square test. Statistical significance comparing the absolute log₂ fold-change values for LPS stimulated and LPS stimulated + (+)-JQ1 treated samples were determined by Wilcoxon match-paired signed rank tests. Statistical differences in relative gene expression and cytokine secretion for the LPS and LPS + (+)-JQ1 conditions were determined using paired, parametric t-tests. Statistical differences in relative gene expression and cytokine secretion for the LPS, LPS + (+)-JQ1 and LPS + IL-10 conditions were determined using one-way ANOVA followed by post hoc analyses using Tukey’s multiple comparisons test. Paired parametric t-tests were used to determine statistical significance for (+)-JQ1 and DMSO treated BMDMs for the evaluation of the number of cells in S-phase and percentage of viable cells. All other statistics were determined using a 2-tailed unpaired, nonparametric, student’s t test. For all tests, except for motif analysis, P _adj < 0.05, empirical P < 0.05, or P < 0.05 were considered statistically significant. For motif analysis, P _adj < 0.1 was considered statistically significant.

All animal experiments were performed in accordance with protocols approved by the Institutional Animal Care and Use Committee of the University of North Carolina at Chapel Hill (19-108.0).

Genome-wide epigenetic changes, including post-translational histone modifications and chromatin accessibility, have been heavily annotated in macrophages upon LPS stimulation (8–10, 56). Increased BET protein binding has been associated with expression of LPS-induced inflammatory genes (30–33, 37). To comprehensively determine the role of BET proteins in LPS-induced chromatin remodeling, we treated Il10^-/- BMDMs with (+)-JQ1 for 12 hours prior to challenge with LPS for 4 hours and evaluated changes in chromatin accessibility by ATAC-seq ( Figure 1A ). Treatment with (+)-JQ1 did not affect cell viability ( Supplementary Figure 1A ) or cell cycle progression ( Supplementary Figure 1B ).

Principle component analysis (PCA) of chromatin accessibility profiles in Il10^-/- BMDMs ( Figure 1B ) showed the first principle component (PC1) stratified samples based on the presence or absence of LPS stimulation, demonstrating that LPS is a primary driver of chromatin accessibility changes. Samples were further segregated along the second PC based on treatment with (+)-JQ1. We note that samples treated with (+)-JQ1 prior to LPS stimulation clustered more closely to unstimulated samples along PC1 than untreated LPS stimulated samples ( Figure 1B ), suggesting (+)-JQ1 mitigates some LPS-induced chromatin accessibility changes in Il10^-/- BMDMs.

Both LPS stimulation and the loss of IL-10 expression were previously shown to affect genome-wide chromatin accessibility in Il10^-/- BMDMs (9). To determine how (+)-JQ1 modifies chromatin accessibility during LPS stimulation at both promoter (n = 36,670) and distal (n=157,614) sites genome-wide, we plotted average chromatin accessibility ( Figures 1C, D ) and quantified the overall number and magnitude of differentially accessible regions (DARs; FDR < 0.05) for both LPS and LPS + (+)-JQ1 conditions as compared with unstimulated Il10^-/- BMDMs ( Figure 1E ). Average chromatin accessibility at both promoter and distal sites decreased with (+)-JQ1 treatment as compared with LPS stimulation alone ( Figures 1C, D ). However, the relative decrease in accessibility was greater at distal sites ( Figure 1D ) as compared with promoter sites ( Figure 1C ). The number of promoter DARS that had increased accessibility upon LPS stimulation was roughly equivalent under each condition with no statistically significant differences ( Figure 1E ). In contrast, (+)-JQ1 treatment prior to LPS stimulation resulted in fewer promoter DARs with decreased accessibility as compared with LPS stimulation alone ( Figure 1E ; p=8.54x10^-8). In contrast at distal sites, both the overall number of DARs as well as the percentage of high magnitude DARs were decreased substantially with (+)-JQ1 treatment ( Figure 1E ; p<2.2x10^-16 for both increased and decreased). Focusing on DARs with high magnitude changes at both promoter and distal sites, we found greater concordance across the two conditions when accessibility was increased by LPS stimulation than when decreased ( Figures 1F–I ). Even amongst these DARs, though, (+)-JQ1 treatment significantly decreased the average magnitude (|log₂FC|) for all four categories ( Figures 1F–I , right; Wilcoxon sum rank test, p < 0.005). Based on these data, we conclude that (+)-JQ1 treatment overall attenuates the effect of LPS on changes to genome-wide chromatin accessibility and has a greater impact on DARs at distal sites.

We previously showed that supplementation with exogenous IL-10 had minimal effects on genome-wide chromatin remodeling in Il10^-/- BMDMs (9). To determine how IL-10 treatment compared to (+)-JQ1 in limiting LPS-induced chromatin remodeling, we treated Il10^-/- BMDMs with IL-10 for 12 hours followed by LPS challenge for 4 hours. PCA revealed that samples treated with IL-10 clustered separately from samples treated with (+)-JQ1 and from untreated samples, regardless of LPS stimulation ( Supplementary Figure 2A ). IL-10 treated samples had decreased promoter accessibility compared with (+)-JQ1 treated samples, on average ( Supplementary Figure 2B ). In contrast, (+)-JQ1 treated samples had decreased accessibility at distal regions compared to IL-10 samples ( Supplementary Figure 2C ). When comparing with unstimulated and untreated Il10^-/- BMDMs, IL-10 treatment prior to LPS stimulation resulted less promoter DARs as compared with LPS stimulation alone or with (+)-JQ1 treatment ( Supplementary Figure 2D ; p=2.003x10^-15 for increased, p<2.2x10^-16 for decreased). In contrast, the overall number of DARs (increased and decreased together) detected at distal sites with IL-10 treatment prior to LPS stimulation were similar to what was observed with LPS stimulation alone. When separately testing DARs with increased or decreased accessibility, differences in each were statistically different by chi-square analysis ( Supplementary Figure 2D ; 1.811x10^-15 for increased, 2.2x10^-16 for decreased). To better quantify effects of treatments on chromatin accessibility changes with LPS stimulation, we correlated normalized signals across all accessible regions between each of LPS stimulated alone, LPS + (+)-JQ1, and LPS + IL-10 with unstimulated Il10^-/- BMDMs ( Supplementary Figures 2E–G ). We found (+)-JQ1 treated samples were the most correlated with unstimulated samples suggesting a greater impact than IL-10 on limiting chromatin remodeling. Together, these data show (+)-JQ1 better preserves a non-inflammatory chromatin state and that IL-10 signaling affects chromatin remodeling in a distinct manner.

LPS stimulation of Il10^-/- BMDMs results in robust expression of key inflammatory genes, such as Il12β, that is greater than expression observed in WT BMDMs (20, 22). To better understand how BET protein inhibition affects gene expression in response to LPS stimulation, we performed RNA-seq using matched BMDM samples ( Figure 1A ). Similar to our initial ATAC-seq analyses, PCA on these data revealed the primary source of variation is due to LPS stimulation (PC1; Figure 2A ) while (+)-JQ1 treatment orthogonally contributes to variation (PC2). Again, samples treated with (+)-JQ1 prior to LPS stimulation clustered closer to unstimulated samples along PC1 than untreated LPS stimulated samples.

To determine which genes were affected by LPS stimulation both with and without (+)-JQ1 treatment, we performed pairwise comparisons with unstimulated samples separately for each. We identified a total of 10,656 differentially expressed genes (DEGs) present in at least one of these comparisons. We then used a likelihood ratio test (LRT) to determine more specifically which genes were significantly affected by (+)-JQ1 during LPS-stimulation, resulting in 4,257 genes.

DEGs were clustered based on the direction of effect of (+)-JQ1 treatment compared with no treatment. Cluster 1 (n = 1,536 genes) contained genes that had higher expression after LPS stimulation when treated with (+)-JQ1 compared with LPS stimulation alone, while Cluster 2 (n = 2,721 genes) contained those with lower relative expression ( Figure 2B ). Next, within each cluster we identified five distinct classes based on statistical significance and log₂FC magnitude associated with the pair-wise differential expression analyses with unstimulated samples ( Supplementary Table 1 ). In Cluster 1, three small classes contained genes that were significantly up-regulated by LPS with (+)-JQ1 treatment (log₂FC > 1) but were either weakly induced by (Class I; n = 203 genes), down-regulated by (Class II; n = 50 genes), or showed minimal response to (Class V; n = 108 genes) LPS stimulation alone. In the other two larger classes (Class III, n = 415 genes; Class IV, n = 760 genes), (+)-JQ1 treatment also resulted in relatively higher expression compared to no treatment, but overall expression levels of these genes regardless of treatment were below baseline expression in unstimulated, untreated macrophages ( Figure 2 ). Pathway enrichment analysis of all genes in Cluster 1 revealed a slight enrichment for Longevity Regulating, Mismatch Repair, and Systemic Lupus Erythematosus pathways, but no additional pathways ( Supplementary Figure 3A ).

In Cluster 2, which consists of genes whose relative expression is lower when treated with (+)-JQ1 during LPS stimulation ( Figure 2B ), we find nearly all (~90%) genes significantly induced during LPS stimulation alone (log₂FC > 1). The most robustly up-regulated of these genes were grouped into the largest Class VI (n = 1,422 genes), which contained genes upregulated by LPS stimulation regardless of (+)-JQ1 treatment, but where pre-treating with (+)-JQ1 resulted in a 2-fold decrease in expression compared with LPS stimulation alone on average. Pathway analysis using these genes showed enrichment for more than 20 pathways associated with inflammatory and viral response ( Figure 2C ) and included many pro-inflammatory genes such as Il12β, Il6, and Tnf ( Figure 2D ). Luminex analyses were used to determine if (+)-JQ1-mediated attenuation could also be observed at the protein level. Quantification of seven cytokines found in Class VI (IL-12p70, IL-27, IL-6, MCP-1, MCP-2, MIP-1α, and TNF- α) confirmed that (+)-JQ1 pre-treatment resulted decreased secretion relative to LPS stimulated cells alone ( Figure 2E ). Statistical analyses confirmed that expression of Il12β/IL-12p70 ( Figure 2F ) and Tnf/TNF-α ( Figure 2G ) at the mRNA (qRT-PCR, left) and protein levels (Luminex, right) was statistically significantly reduced with (+)-JQ1 pre-treatment as compared with LPS stimulation alone.

Class VII (n = 116 genes) and Class IX (n = 235 genes) consisted of genes induced by LPS stimulation alone, albeit less robustly than those in Class VI, but whose expression levels when treated with (+)-JQ1 treatment were lower than or similar to expression in unstimulated Il10^-/- BMDMs, respectively ( Figure 2B ). Class VII genes were enriched for macrophage functions, such as antigen presentation and phagocytosis, while Class IX genes were involved in bacterial and viral response pathways as well as TNF signaling ( Figure 2C ). The remaining two classes (Class VIII, n = 385 genes; Class X, n = 563 genes) were down-regulated upon LPS stimulation regardless of (+)-JQ1 treatment, but whose expression was reduced to a greater extent when treated with (+)-JQ1 ( Figure 2B ). Neither class showed enrichment for immune pathways ( Figure 2C ).

IL-10 negatively regulates expression of Il12β and other inflammatory genes (20, 22). We wanted to better understand how exogenous IL-10 affects the Il10^-/- BMDM response to LPS and to compare this with (+)-JQ1 treatment. PCA revealed that IL-10 treatment prior to LPS stimulation resulted in transcriptional profiles markedly similar to untreated LPS stimulated Il10^-/- BMDMs ( Supplementary Figure 3B ), including across genes in our ten previously defined LPS response classes ( Supplementary Figure 3C ). Expression fold-changes upon LPS stimulation of IL-10 treated samples varied across key inflammatory genes found in Class VI. Some genes, such as Il12β, did have attenuated responses comparable to (+)-JQ1 treated samples, but most other genes, such as Nod2, showed increased expression compared with (+)-JQ1 treatment ( Supplementary Figure 3D ). Similar changes associated with IL-10 were also observed at the protein level by Luminex ( Supplementary Figure 3E ). Quantitative analyses using qRT-PCR (left) and Luminex (right) for Il12β/IL-12p70 ( Supplementary Figure 3F ) and Tnf/TNF-α ( Supplementary Figure 3G ) confirmed that IL-10 pre-treatment significantly reduced LPS-induced expression, although (+)-JQ1 was slightly more effective in attenuating Il12β/IL-12p70. In contrast, IL-10 treatment had little effect on responses of Class VII and IX genes to LPS ( Supplementary Figure 3D ). Collectively, these results demonstrate that (+)-JQ1 treatment has a strong effect on genes induced by LPS stimulation, which were more extensive than with IL-10 treatment and resulted in down-regulation of genes implicated in the inflammatory response.

To determine the effects of (+)-JQ1 pre-treatment on WT LPS-stimulated BMDMs, WT cells were cultured and stimulated in the exact same manner as Il10^-/- BMDMs ( Figure 1A ) followed by qRT-PCR and luminex analyses to determine changes for select inflammatory genes. Like Il10^-/- BMDMs, treatment of WT BMDMs with (+)-JQ1 did not affect cell viability ( Supplementary Figure 4A ) or cell cycle progression ( Supplementary Figure 4B ). Overall, WT BMDMs responded less robustly to LPS stimulation as demonstrated by the variation in the individual datapoints for Il12β/IL-12p70 ( Supplementary Figure 4C ) and Tnf/TNF-α ( Supplementary Figure 4D ). While (+)-JQ1 pre-treatment decreased expression at the gene expression and cytokine secretion level for both genes, these findings were not statistically significant ( Supplementary Figures 4C, D ). While IL-10 pre-treatment had a stronger effect at the transcriptional level as compared with cytokine secretion, none of these findings were statistically significant ( Supplementary Figures 4C, D ). Together, these data suggest that (+)-JQ1 and IL-10 exert anti-inflammatory effects on WT BMDMs, but the overall effects are less pronounced as compared with our findings in Il10^-/- BMDMs.

Distal regulatory elements, such as enhancers, largely contribute to cell-specific gene expression programs defining cell identity (4, 5). Recent studies have suggested that BET protein inhibition alters use of cell-specific super-enhancers (56–58). Therefore, we sought determine the relationship between effects of (+)-JQ1 on chromatin accessibility and altered expression at LPS-responsive genes. Across our ten gene expression classes, we found a similar number of distal accessible regions near member genes on average (+/- 25kb from the TSS; Supplementary Figures 5A, B ). LPS stimulation overall increased distal chromatin accessibility in all classes, but the magnitude of this increase varied ( Supplementary Figure 5C ). Consistent with our genome-wide analyses, (+)-JQ1 treatment decreased the effect of LPS stimulation on chromatin accessibility changes for all 10 classes, most notably for Classes VI, VII, and IX that contain genes with attenuated expression ( Figures 3A, B ; Supplementary Figure 4C ). In contrast, a similar analysis of IL-10 treated samples on Class VI, VII, and IX genes showed accessibility at promoter regions were even less altered on average than with (+)-JQ1 treatment ( Supplementary Figure 5D ). However, accessibility at distal regions associated with these classes more closely resembled those of untreated LPS stimulated samples, especially for Class VII, as compared with (+)-JQ1 treatment ( Supplementary Figure 5E ).

Focusing more specifically on regions that significantly changed upon LPS stimulation, we found an enrichment for DARs near genes from Classes VI (n=504) and VII (n=47), but not Class IX (n=66) (hypergeometric test; p = 9.22x10^-16, p = 7.56x10^-4, p = 0.24, respectively). As Class VI was the largest and contains key inflammatory genes, we further investigated chromatin accessibility separately in promoter and distal regions. Both sets of regions showed increased chromatin accessibility upon LPS stimulation compared with unstimulated Il10^-/- BMDMs ( Figures 3A, B ). Consistent with our genome-wide observations, (+)-JQ1 treatment showed little effect on promoter regions ( Figure 3A ), but distally we found an overall attenuation of accessibility changes and a reduced number of DARs in response to LPS stimulation ( Figure 3B ). Motif analysis of distal DARs associated with Class VI genes with increased accessibility in untreated LPS stimulated samples (n = 5,323 regions) showed enrichment for motifs of bZIP transcription factors, including many AP-1 family sub-units, ETS transcription factors, including PU.1, and IRF family members ( Figure 3C ). DARs with attenuated accessibility changes in (+)-JQ1 treated samples during LPS stimulation compared with LPS stimulation alone (n = 920 regions) revealed motifs for a subset of AP-1 family members as well as several IRF and RHD (NF-kB p65/p50) factors ( Figure 3D ). This included a putative AP-1 motif located downstream of the of the Il12β TSS ( Figure 3E ). DARs that decreased in accessibility during LPS stimulation alone or increased with (+)-JQ1 treatment with LPS were enriched for motifs from ETS family members ( Supplementary Figures 5F, G ).

Overall, these data suggest that (+)-JQ1 treatment restricts LPS-induced chromatin accessibility changes at distal regulatory elements near inflammatory genes. Interestingly, though, our data also suggests that exogenous IL-10 may also attenuate some LPS-induced chromatin changes, but primarily at promoters of LPS-inducible genes.

To determine whether (+)-JQ1 may mitigate colitis onset in vivo, we treated adult Il10^-/- mice previously housed under germ free (GF) conditions with (+)-JQ1 (I.P. injections) followed by colonization with slurries made using fecal matter from WT C57BL/6J mice raised in specific pathogen free conditions ( Figure 4A ). Additional (+)-JQ1 treatments were administered on Days 3, 6, 9, and 12 and animals were sacrificed on Day 14 ( Figure 4A ). Treatment with (+)-JQ1 did not result in any significant changes in weight as compared with vehicle treated mice ( Supplementary Figure 6A ).

We isolated lamina propria mononuclear cells (LPMCs) and splenocytes from (+)-JQ1- and vehicle treated animals to identify changes in immune cell population sizes associated with treatment ( Supplementary Figure 6B ). Total CD45⁺ leukocytes constituted ~60% of singlets in LPMC populations and 75% of singlets in splenocyte populations in vehicle treated mice and did significantly change with (+)-JQ1 treatment ( Supplementary Figure 6C ). No significant differences in the population size of CD11b⁺CD11c^-F4/80⁺ macrophages or total CD3⁺ T cells and CD19⁺ B cells isolated from the intestine or spleen were observed with (+)-JQ1 treatment ( Supplementary Figures 6D, E ). However, a reduction in the CD11b^intCD11c^- population was observed with (+)-JQ1 treatment ( Supplementary Figure 6B ). Based on these observations, we conclude that the dose and frequency of (+)-JQ1 given to these mice does not have any significant effect on bulk immune cell population size within the intestine or other peripheral organs.

Finally, we investigated the effect of (+)-JQ1 treatment on intestinal inflammation in these mice. Overall colon length and morphology remained unchanged with (+)-JQ1 treatment when compared with vehicle treated mice ( Figures 4B, C ). However, histologically, scored using a modified method from Berg et al. that compared colons with uninflamed uncolonized germ-free Il10^-/- mice harvested on Day 0 ( Figure 4D ), (+)-JQ1 treated mice had statistically significantly lower scores compared with vehicle treated mice ( Figure 4E ). Additionally, we quantified caecal Il12β mRNA expression levels and found that (+)-JQ1 treatment also significantly decreased relative expression as compared with vehicle treated mice ( Figure 4F ), which correlates with our histological observations. Taken together, these data demonstrate that treatment with (+)-JQ1 attenuates severity of colitis onset in Il10^-/- mice two weeks post colonization.