C2GAP2 (gene ID: DDB0205121 and gene name c2gapB) is a Ras GAP protein, which contains one C2 and one GAP domain (15, 22). c2gapB was highly expressed in the vegetative stage and displayed a decreasing expression pattern during the early development of D. discoideum ( Figure S1 ). It possessed GAP activity toward the main Ras isoforms that play major roles in diverse cellular processes in the vegetative stage of D. discoideum ( Figure 1A ). It localized in active Ras-enriched protrusion sites of resting cells ( Figure 1B ). Folic acid stimulation triggered robust translocation of C2GAP2 to the plasma membrane (PM), where it colocalized with an active Ras probe (RBD-RFP, active Ras-binding domain of Raf1 tagged with RFP). The PM-translocating dynamics of these two proteins were similar ( Figure 1C ). Consistent with the above, folic acid stimulation also promoted the association between C2GAP2 and Ras ( Figure 1D ). To understand the role of C2GAP2 in Ras activation, we generated stable cell lines deficient in C2GAP2 (c2gapB−) ( Figure S2 ). We then measured the Ras activation profile in wild-type (WT) and c2gapB− cells in response to folic acid. Folic acid stimulation triggered Ras activation in the vegetative D. discoideum WT cells, while it induced an elevated Ras activation in c2gapB− ( Figures 1E, F ). The above results indicate that C2GAP2 functions as a Ras GAP protein that deactivates active Ras in the vegetative stage of D. discoideum.

Adaptation is a fundamental strategy by which eukaryotic cells to chemotax through chemoattractant gradients with a large concentration range (15, 16, 23). The above data show that in response to folic stimulation, c2gapB− cells displayed failure in Ras adaptation ( Figures 1D, E ). In addition, we found that C2GAP2 localized in the leading edge of chemotaxing cells in a folic acid gradient ( Figure 2A ), indicating its potential role in gradient sensing and maintaining the polarization during chemotaxis. Hence, we examined the chemotaxis behaviors of WT, c2gapB− cells and c2gapB− cells epigenetically expressing C2GAP2-YFP (c2gapB−/OE) in the gradients of folic acid ( Figure 2B ). We found that, comparing to WT cells, c2gapB− displayed impaired chemotaxis while c2gapB−/OE showed a normal chemotaxis, indicating that C2GAP2 expression restores the chemotaxis capability in c2gapB− cells. c2gapB− cells that migrated in a folate acid gradient for a longer time and experienced gradient at a higher concentration showed a more severe defect in chemotaxis ( Figure 2C ). Taken together, C2GAP2 plays an important role in the folic-acid mediated chemotaxis.

C2GAP2 possessed RasGAP activity toward Ras isoforms that play essential role in phagocytosis. Thus, we monitored the cellular localization of C2GAP2 during phagocytosis ( Figure 3A ). Cells expressing C2GAP2-YFP (green) were incubated with yeast fluorescently labeled with Alexa 594 (red). C2GAP2-YFP localized to the phagocytic cup and phagosome, and then gradually left the phagosome ( Figure 3A , top panel). To understand the domain requirement for phagosome localization, we monitored the cellular localization of full- length C2GAP2 (FL) or deletion mutants, which lacks either the C2 domain (ΔC2) or the GAP domain (ΔGAP), during the phagocytosis of yeast ( Figure S3 ). We found that the ΔGAP mutant maintained while the ΔC2 mutant lost localization on the phagocytic cup and phagosome ( Figure 3A , middle and low panels), indicating that the C2 domain is required and sufficient for localization during phagocytosis. Next, we simultaneously monitored the temporospatial localization of C2GAP2-YFP and active Ras using RBD-RFP during phagocytosis ( Figure 3B ). We found that both active Ras and C2GAP2 colocalized on the initiation site of the phagocytic cup (0 s), on the phagocytic cup (10 – 30 s), and then on the phagosome (40 s). Interestingly, active Ras in the phagosome decreased and disappeared from the phagosomes (around 40 s), and C2GAP2 stayed and then gradually disappeared (40 to 90 s). Quantitative measurement of the temporospatial intensities of C2GAP2-YFP and RBD-RFP during phagocytosis confirms the above observation ( Figure 3C ). We further monitored the temporospatial localization of C2GAP2-YFP and phosphatidylinositol (3,4,5)-trisphosphate (PIP₃) using a PIP₃ biosensor, PH_Crac-RFP (25). PIP₃ is generated by PI3K, a direct effector of active Ras, and plays a critical role in phagocytosis (3, 26). We found that both C2GAP2 and PH-RFP colocalized on the initiation site of the phagocytic cup (0 s), on the phagocytic cup (10 – 30 s), and then on the phagosome (60 s) ( Figure 3D ). C2GAP2 in phagosome decreased and disappeared (around 40 s), and PH-RFP stayed and then gradually disappeared (60 to 100 s). C2GAP2 was enriched at closing sites during the closure of the phagocytic cup to the phagosome, indicating its role in this process. Quantitative measurement of C2GAP2-YFP and PH_Crac-RFP during phagocytosis is shown in Figure 3E . Cellular localization of C2GAP2 at the initiation sites of phagocytic cup and phagosome indicates its potential role in regulating Ras activity during phagocytosis.

To understand the role of C2GAP2 in phagocytosis, we compared bacterial phagocytosis in WT, c2gapB−, and c2gapB− ^/OE cells ( Figure 4 ). Cells were mixed with pHrodo-labelled live Klebsiella aerogenes at a rate of 1:50 and sampled at the indicated time points. The phagocytosed K. aerogenes was measured by flow cytometry as red fluorescent signal in the cells ( Figure 4A ). We also visualized the phagocytosed bacteria in the cells at 60’ using confocal microscopy and detected a notable higher bacterial phagocytosis (red) in c2gapB− cells and a reduced phagocytosis in c2gapB− ^/OE cells, in comparison to WT cells ( Figure 4B ). Quantitative measurement of three independent experiments confirms the above observation ( Figure 4C ). The above result indicates a negative role of C2GAP2 in phagocytosis.

D. discoideum cells engulf fluidic nutrients through macropinocytosis, a cellular process regulated by Ras activation (1, 2). Ras activation at membrane patches is essential to induce macropinosomes and the loss of the RasGAPs at these membrane ruffles potentiates Ras activation and subsequent macropinocytosis, while their overexpression repress macropinocytosis (1, 5, 13). We found that C2GAP2 localized in the macropinosome in the cells with culture medium ( Figure 5A ). The ΔGAP mutant maintained while the ΔC2 mutant lost localization on the macropinosome, indicating that the C2 domain is required and sufficient for the localization. Next, we monitored the temporospatial localization of C2GAP2 (green) and RBD-RFP (red) during macropinocytosis ( Figure 5B ). We found that C2GAP2 colocalized with active Ras on the membrane ruffles (0 s), which often further close to form macropinosomes (10 s). The amount of active Ras decreased (20 s), while C2GAP2 maintained its localization on the macropinosome (30 s), then gradually decreased (50 s) and completely disappeared around 60 s. Quantitative measurement of temporospatial intensities of C2GAP2-YFP and RBD-RFP during macropinocytosis is shown in Figure 5C . We further monitored the temporospatial localization of C2GAP2-YFP and PIP₃ using PH_Crac-RFP ( Figure 5D ). Both C2GAP2 and PH_Crac-RFP colocalized on the initiation site of the macropinocytic cup (0 s) and the macropinosome (10-40 s). Then, the localization of C2GAP2 in phagosome decreased and disappeared (40 to 60 s), while PH_Crac-RFP still localized and then gradually disappeared (after 60 s). Quantitative measurement of temporospatial intensities of C2GAP2-YFP and RBD-RFP during macropinocytosis is shown in Figure 5E . The localization of C2GAP2 at the initiation sites of the macropinocytic cup and the macropinosome indicates its potential role in regulating Ras activity during macropinocytosis.

To understand the role of C2GAP2 in macropinocytosis, we compared the uptake of fluorescent FITC-dextran in vegetative WT and c2gapB− cells in shaken suspension and found an increased macropinocytosis in c2gapB− cells as previously described ( Figure 6A ). We further quantitatively measured the intensity and size of membrane ruffles in both WT and c2gapB− cells as previously described (27). We found no significant differences in the size or the intensity of macropinosomes in WT and c2gapB− cells ( Figures 6B, D ), indicating that C2GAP2 plays no essential role in controlling the size and the maturation of macropinosome, instead, plays a role in the speed of macropinocytosis. To determine the consequence of the increased macropinocytosis, we next measured axenic cell growth of WT and c2gapB^- cells in suspension culture ( Figure 6E ). We found an increased cell growth in c2gapB− cells. Taken together, the above results indicate a negative role of C2GAP2 in macropinocytosis and consequent cell growth.

Proteins and phospholipids on the plasma membrane play critical roles in membrane targeting of C2 domain-containing RasGAPs (15, 28). Thus, we investigated the requirement of the C2 domain for C2GAP2’s interaction with Ras by immunoprecipitation analysis ( Figure 7A ). Cells expressing either YFP-tagged FL, ΔGAP, ΔC2, or inactive mutant R199A were stimulated with 100 μM folic acid for 30 s and lysed. YFP-tagged proteins in the cell lysates were subjected to immunoprecipitation using anti-GFP (also anti-YFP) antibodies, which were pre-conjugated with agarose beads. Ras was detected from the cells expressing either FL or R919A mutant, but not from ΔGAP or ΔC2, indicating that the interaction between C2GAP2 and Ras requires both the GAP and C2 domains, but not GAP activity. The C2 domain often requires calcium for membrane targeting (28–30). Thus, the membrane fraction of cells expressing C2GAP2-YFP in the present or absence of GTPγS or [Ca²⁺] at the indicated concentrations was obtained through 5-μm filter units ( Figure 7B ). Ras was detected as the control for membrane protein. We found increased membrane localization of C2GAP2 in the presence of calcium, indicating that calcium binding plays a role in its membrane targeting ( Figure 7C ). It has been previously reported that several C2 domains bind to multiple phospholipids on the plasma membrane and this binding plays a role in the membrane targeting of C2 domain-containing protein (28). We therefore determined phospholipids on the plasma membrane using PIP Strips as previously reported ( Figure 7D ) (17). We found that C2GAP2 displayed strong binding with two phospholipids (PI(3,4)P₂ and PI(3,4,5)P₃) and relatively low binding with PI(3)P, PI(4)P and PI(5)P on the plasma membrane. Thus, calcium binding and the presence of Ras and appropriate phospholipids on the plasma membrane play a role in the membrane targeting of C2GAP2.

Cells expressing the protein of interest were selected by growth in the presence of 20 μg/ml geneticin (Sigma, Steinheim, Germany) or 10 µg/ml blasticidin S, and/or hygromycin (Sigma, Steinheim, Germany) with the requirement of double selection. For differentiation, log-phase vegetative cells were harvested from shaking culture (5×10⁶ cells/ml) and washed twice with developmental buffer (DB: 5 mM Na₂HPO₄, 5 mM KH₂PO₄, 2 mM MgSO₄, and 0.2 mM CaCl₂) before the experiments.

The c2gapB gene of wild-type (WT) cells was disrupted by inserting the blasticidin-resistant (BSR) cassette at nucleotide position 1644 bp~1828 bp including the sequence for the GAP domain. A 5’ fragment of c2gapB was amplified from AX2 genomic DNA by PCR using primers 5’- CGGGGTACCAGTAAAGATGATTTTATGGGATTAG -3’ and 5’- CCCAAGCTTGATACAATCACTTTAGTTGATAATG -3’ and the product was digested with KpnI and HindIII. A 3’ fragment was amplified using primers 5’- GGAATTCCATATG CATTATGTCCATTAATTATGTC-3’ and 5’- AAGGAAAAAAGCGGCCGCGAAATATTTTGAAGTATTTTACTC-3’ and was digested with NdeI and NotI. The PCR products were cloned on opposite sides of the BSR cassette into pLPBLP. The construct was linearized by digestion with KpnI and NotI, purified, and transfected into AX2 cells by electroporation. Transformants were selected in D3-T medium (KD Medical) containing 10 µg/ml blasticidin S. Individual colonies were picked from independent transformations.

The coding sequences of C2GAPB, the C2 domain (1-107a.a.), and the GAP domain (108-464a.a.) were cloned into pCV5 plasmid that contains a C-terminal YFP. The C2GAPB coding sequence was also cloned into an pDM353 plasmid that contains a C terminal GFP tag via Gateway cloning. Point mutation, to generate the C2GAP2 R199A mutant, were introduced by the method of Quick change.

Anti-pan Ras mouse monoclonal antibody from EMD Millipore (Billerica, MA) was used to detect D. discoideum Ras proteins. Anti-GFP monoclonal antibody was from BD Biosciences (San Jose, CA). Anti-GST monoclonal antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA). HRP-conjugated anti-mouse or anti-rabbit IgG was obtained from Jackson ImmunoResearch (West Grove, PA). Alexa 594 was from Invitrogen (Carlsbad, CA). pHrodo was from Thermo Fisher Scientific (Waltham, MA).

For GAP activity measurements, the indicated Ras proteins were produced and purified as previously described (37). The MBP-C2GAP2-FL and MBP-GAP domain (AA 108-464) were produced, isolated from E. coli Rosetta cells and purified by Maltose Binding Protein Trap (MBPTrap)-affinity column (GE Healthcare). The proteins were eluted in 20 mM Tris, 200 mM NaCl, 5% Glycerol 1 mM β-Mercaptoethanol and 10 mM Maltose, pH7.5 and further purified by size exclusion chromatography (Sephacryl 16/60, GE Healthcare) stored in 50 mM Tris, 50 mM NaCl, 5 mM DTT, and 5 mM MgCl2, pH7,5. The GAP activity was measured as previously reported (13). Briefly, one µM of Ras protein with and without an equal amount of full-length (FL) or GAP domain of C2GAP was incubated with 50 µM of GTP at 20°C in 50 mM Tris pH 7.5, 50 mM NaCl and 5 mM MgCl2. After different lengths of time the GDP content of the samples was analyzed by HPLC (Thermo Ultimate 3000): a reversed phase C18 column was employed to detect GDP and GTP content (in %) as previously described by Eberth and Ahmadian (38). Linear rates of GDP production were plotted (first 4-8 timepoints) using GraFit 5.0 (Erithacus Software).

Cells were plated and allowed to adhere to the cover glass of a 4-well or a 1-well chamber (Nalge Nunc International, Naperville, IL) for 10 min, and then covered with DB buffer for the live cell imaging experiment. Cells were imaged using a Carl Zeiss LSM780 (Carl Zeiss, Thornwood, NY) with a 60x/NA 1.4 Oil DIC Plan-Apochromatic objective. Images were processed and analyzed by Zen 780 software. Images were further processed in Adobe Photoshop (Adobe Systems, San Jose, CA), and the intensity of the ROI (region of interest) was explored and analyzed with Microsoft Office Excel (Redmond, WA).

Cells expressing full length (FL) or mutants of C2GAP2 tagged with YFP or GFP were washed twice, resuspended to 8 × 107 in PM buffer (5 μM Na2PO4, 5 μM KH2PO4, and 2 μM MgSO4), and kept on ice before assay. Cells were stimulated with 100 μM folic acid. Aliquots of 0.5 ml cells were lysed at indicated time points with 10 ml immunoprecipitation buffer (IB, 20 mM Tris, pH8.0, 20 mM MgCl2, 10% glycerol, 2 μM Na3VO4, 0.25% NP40, and complete 1× EDTA-free proteinase inhibitor) for 30 min on ice. Cell extracts were centrifuged at 16,000 × g for 10 min at 4°C. Supernatant fractions were collected and incubated with 25 μl anti-GFP agarose beads at 4°C for 2 hours. Beads were washed four times with immunoprecipitation buffer and proteins were eluted by boiling the beads in 50 μl SDS sample buffer.

WT and c2gapB− cells were transfected with a plasmid encoding for the active Ras marker Raf1(RBD)-GFP. Single images of vegetative cells were taken using a Zeiss LSM780 confocal microscope. Logarithmically growing wild type and mutant cells from shaken suspension were counted and resuspended in 10 ml fresh HL5 medium at a density of 1×106 cells/ml. After 1 hour of incubation, FITC-dextran (Mw=70,000) was added to the cells at a concentration of 2 mg/ml. Aliquots of 0.5 ml were taken at t=0, 15, 30, 45, 60, 120, and 180 minutes. Cells were spun down and washed once in 1 ml PB and the washed cell pellet was lysed in 40 μl lysis buffer (10 mM Tris pH 8.3, 50 mM KCl, 2.5 mM MgCl2, 0.45% NP40, 0.45% Tween 20). The amount of FITC dextran in the lysate was measured using a fluorometer (470 nm excitation, 520 nm emission). Images were quantified using ImageJ (NIH). Patches of Raf1(RBD)-GFP are essentially discrete and easily identified. The figure shows the mean ± SD of 3 experiments. WT and c2gapB^- cells were transfected with a plasmid encoding for the active Ras marker Raf1(RBD)-GFP. Single images of vegetative cells were taken using a Zeiss LSM800 confocal microscope. Images were quantified using ImageJ (NIH). Patches of Raf1(RBD)-GFP are essentially discrete and easily identified. The fluorescence intensity of each patch was defined as the maximum signal along a line drawn perpendicular to the center of the patch. To correct for differences in expression level, the mean fluorescence intensity of the cytosol of each cell was also determined and the intensity of the patch was divided by the intensity of the cytosol. The size of each Raf1(RBD)-GFP patch was determined using the segmented line tool.

D. discoideum cells were harvested, washed with DB, and resuspended. Cell migration was recorded at 30 s intervals at 22°C for 60 min in the EZ-TAXIScan chamber. A stable gradient of 100 μM folic acid was established for the assay. Cell migration analysis was performed with DIAS software (24). The extracted data were further analyzed with Excel software.

K. aerogenes labeled with pHrodo Red were incubated with D. discoideum cells at a 50:1 ratio at 22°C. After incubation, the cells were washed and resuspended in basic buffer (50 mM Tris [pH 8.8] and 150 mM NaCl). The phagocytes and K. aerogenes were distinguished by forward and side scatter (FSC). The appearance of pHrodo in the phagocyte population was monitored as an indicator of K. aerogenes engulfment. The phagocyte cell population characterized by high fluorescence of pHrodo was considered to be the cells that engulfed K. aerogenes. Data acquisition and analysis were done using a FACSort flow cytometer with Cell Quest software (version 3.3) and analyzed using FlowJo (version 10.0.8).

Cells in log-phase growth were harvested from shaking culture (5×10⁶ cells/ml) and washed twice with DB buffer. Next, the cells were resuspended at 2×10⁷ cells/ml with DB buffer and shaken in a shaking flask at 200 rpm for 90 minutes at room temperature. The cells were centrifuged and washed with phosphate buffer (PB: 5 mM Na₂HPO₄, 5 mM KH₂PO₄). The cells were resuspended with PB at 2×10⁸ cells/ml and sat on ice for 10 min. The cells were transferred to a medical cup and shaken at 200 rpm for 3 min and then stimulated with a final concentration of 10 μM folic acid. Before or after folic acid stimulation at the indicated time points, 0.5 ml aliquots of the cells were lysed in 10 ml immunoprecipitation buffer (IB, 20 mM Tris, pH8.0, 20 mM MgCl₂, 10% glycerol, 2 mM Na₃VO₄, 0.25% NP40, and complete 1X EDTA-free proteinase inhibitor) for 30 min on ice. Cell extracts were centrifuged at 16,000 × g for 10 min at 4°C. Aliquots of the supernatants were mixed with same volume of 2X SDS loading buffer for the detection of total Ras protein in the samples. Supernatants were incubated with 25 μl agarose beads conjugated with Arf1-RBD (active Ras biding domain from Arf1) from Cytoskeleton Inc. (Denver, CO) at 4°C for 2 hours. Beads were washed four times with IB. Proteins were eluted by boiling the beads in 25 μl SDS loading buffer. The eluted protein samples and the protein aliquots for total Ras protein were subjected to immunoblotting with Ras antibodies to detect either active or total Ras proteins.

The fractions of the membrane portion of the cells were obtained by a filter fractionation assay (5). Cells were collected and washed twice with DB buffer. Cells were suspended with PM buffer and mechanically lysed through a filter system with 5 μm pores into PM buffer with or without the indicated concentration of CaCl₂. The mixtures were centrifuged at 16,000 rpm for1 min. The supernatants were immediately removed. SDS loading buffer was added to the pellets and mixed well. The samples were then subjected to Western blot detection of C2GAP2 with anti-GFP monoclonal antibody.

Cells were lysed using IB buffer on ice for 30 min and were subjected to centrifugation min at maximum speed for 10 min. The supernatants were moved to a new tube and incubated with PIP Stripd overnight at 4 °C. The PIP Strips were subjected to Western blot detection using anti-GFP monoclonal antibody.