<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Immunol.</journal-id>
<journal-title>Frontiers in Immunology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Immunol.</abbrev-journal-title>
<issn pub-type="epub">1664-3224</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fimmu.2022.1061800</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Immunology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>NR4A2 may be a potential diagnostic biomarker for myocardial infarction: A comprehensive bioinformatics analysis and experimental validation</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Wei</surname>
<given-names>Dongsheng</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1985937"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Qi</surname>
<given-names>Jiajie</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Yuxuan</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2031390"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Li</surname>
<given-names>Luzhen</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Yang</surname>
<given-names>Guanlin</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1272226"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>He</surname>
<given-names>Xinyong</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Zhang</surname>
<given-names>Zhe</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Graduate Academy, Liaoning University of Traditional Chinese Medicine</institution>, <addr-line>Shenyang, Liaoning</addr-line>, <country>China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Key Laboratory of Ministry of Education for Traditional Chinese Medicine Viscera-State Theory and Applications, Liaoning University of Traditional Chinese Medicine</institution>, <addr-line>Shenyang, Liaoning</addr-line>, <country>China</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>College of Medical Laboratory, Liaoning University of Traditional Chinese Medicine</institution>, <addr-line>Shenyang, Liaoning</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Christophe Chevillard, TAGC Theories and Approaches of Genomic Complexity, France</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Rixin Zhang, Institute of Chinese Materia Medica, China Academy of Chinese Medical Sciences, China; Longxiang Xie, Henan University, China</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Zhe Zhang, <email xlink:href="mailto:pedtrainzhzh7676@163.com">pedtrainzhzh7676@163.com</email>
</p>
</fn>
<fn fn-type="equal" id="fn003">
<p>&#x2020; These authors have contributed equally to this work</p>
</fn>
<fn fn-type="other" id="fn002">
<p>This article was submitted to Inflammation, a section of the journal Frontiers in Immunology</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>22</day>
<month>12</month>
<year>2022</year>
</pub-date>
<pub-date pub-type="collection">
<year>2022</year>
</pub-date>
<volume>13</volume>
<elocation-id>1061800</elocation-id>
<history>
<date date-type="received">
<day>05</day>
<month>10</month>
<year>2022</year>
</date>
<date date-type="accepted">
<day>02</day>
<month>12</month>
<year>2022</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2022 Wei, Qi, Wang, Li, Yang, He and Zhang</copyright-statement>
<copyright-year>2022</copyright-year>
<copyright-holder>Wei, Qi, Wang, Li, Yang, He and Zhang</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<sec>
<title>Background</title>
<p>Myocardial infarction is a well-established severe consequence of coronary artery disease. However, the lack of effective early biomarkers accounts for the lag time before clinical diagnosis of myocardial infarction. The present study aimed to predict critical genes for the diagnosis of MI by immune infiltration analysis and establish a nomogram.</p>
</sec>
<sec>
<title>Methods</title>
<p>Gene microarray data were downloaded from Gene Expression Omnibus (GEO). Differential expression analysis, single-cell sequencing, and disease ontology (DO) enrichment analysis were performed to determine the distribution of Differentially Expressed Genes (DEGs) in cell subpopulations and their correlation with MI. Next, the level of infiltration of 16 immune cells and immune functions and their hub genes were analyzed using a Single-sample Gene Set Enrichment Analysis (ssGSEA). In addition, the accuracy of critical markers for the diagnosis of MI was subsequently assessed using receiver operating characteristic curves (ROC). One datasets were used to test the accuracy of the model. Finally, the genes with the most diagnostic value for MI were screened and experimentally validated.</p>
</sec>
<sec>
<title>Results</title>
<p>335 DEGs were identified in GSE66360, including 280 upregulated and 55 downregulated genes. Single-cell sequencing results demonstrated that DEGs were mainly distributed in endothelial cells. DO enrichment analysis suggested that DEGs were highly correlated with MI. In the MI population, macrophages, neutrophils, CCR, and Parainflammation were significantly upregulated compared to the average population. NR4A2 was identified as the gene with the most significant diagnostic value in the immune scoring and diagnostic model. 191 possible drugs for the treatment of myocardial infarction were identified by drug prediction analysis. Finally, our results were validated by Real-time Quantitativepolymerase chain reaction and Western Blot of animal samples.</p>
</sec>
<sec>
<title>Conclusion</title>
<p>Our comprehensive in silico analysis revealed that NR4A2 has huge prospects for application in diagnosing patients with MI.</p>
</sec>
</abstract>
<kwd-group>
<kwd>myocardial infarction</kwd>
<kwd>nomogram</kwd>
<kwd>single-cell sequencing (scRNA-seq)</kwd>
<kwd>immune infiltration</kwd>
<kwd>diagnostic model</kwd>
<kwd>bioinformatics</kwd>
</kwd-group>
<contract-sponsor id="cn001">National Natural Science Foundation of China<named-content content-type="fundref-id">10.13039/501100001809</named-content>
</contract-sponsor>
<contract-sponsor id="cn002">State Administration of Traditional Chinese Medicine of the People's Republic of China<named-content content-type="fundref-id">10.13039/501100005891</named-content>
</contract-sponsor>
<contract-sponsor id="cn003">China Postdoctoral Science Foundation<named-content content-type="fundref-id">10.13039/501100002858</named-content>
</contract-sponsor>
<counts>
<fig-count count="10"/>
<table-count count="2"/>
<equation-count count="0"/>
<ref-count count="52"/>
<page-count count="15"/>
<word-count count="4964"/>
</counts>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<title>Introduction</title>
<p>Myocardial infarction (MI) results from severe coronary artery disease, with high morbidity and mortality rates worldwide, according to the World Health Organization (WHO) (<xref ref-type="bibr" rid="B1">1</xref>). Myocardial infarction, ischemic cardiomyopathy, and arrhythmia are regarded as an aggravation of coronary artery disease (CAD), a pathological evolution characterized by atherosclerotic plaque accumulation, inflammation, and endothelial dysfunction in the epicardial arteries (<xref ref-type="bibr" rid="B2">2</xref>). Acute coronary syndrome causes thrombosis and acute ischemia due to unstable atherosclerotic plaque rupture in the coronary artery. Although the past decade has witnessed significant progress achieved in understanding the pathogenesis of myocardial infarction, the exact mechanisms remain unclear (<xref ref-type="bibr" rid="B3">3</xref>). The development of single-cell sequencing technology has allowed us to further understand the pathogenesis of myocardial infarction (<xref ref-type="bibr" rid="B4">4</xref>). In the present study, we used single-cell sequencing technology to identify the cell subpopulations associated with the pathogenesis of myocardial infarction, providing the foothold for future studies. The prognosis of myocardial infarction is closely related to the diagnosis, and improving the diagnostic accuracy of patients with myocardial infarction is essential to improve clinical outcomes and prognosis. Cardiovascular troponin, routinely used in clinical practice to diagnose MI and initiate personalized treatment, is an essential biomarker from a clinical perspective (<xref ref-type="bibr" rid="B5">5</xref>). However, cardiac troponin, the biomarker of choice, is associated with a significant lag time before increasing after MI. With the advancement of modern research, genetic tests can nowadays be performed in less than 15 minutes (<xref ref-type="bibr" rid="B6">6</xref>), reducing the time to clinical diagnosis of MI, but this first requires us to identify the most specific gene. Accordingly, this study sought to identify a diagnostic gene with high specificity. A rat study found that organismal immune genes were first detected within 30 minutes of myocardial infarction compared to other types of genes (<xref ref-type="bibr" rid="B7">7</xref>), highlighting the early diagnostic value of immune-related gene expression. Although some diagnostic markers of myocardial infarction have previously been documented by transcriptome analysis of immune cells and their function, their mechanism in myocardial infarction remains to be elucidated.</p>
<p>An increasing body of evidence highlights the importance of the immunological milieu in the development, progression, and instability of atherosclerotic plaques. Immunological infiltration has been utilized to examine the tumor immune milieu, identify diagnostic genes for distinct cancers, and predict suitable therapy and prognosis for patients (<xref ref-type="bibr" rid="B8">8</xref>). Other non-tumor inflammatory diseases, such as lupus nephritis, have also been widely applied for analyzing immune cell filtration (<xref ref-type="bibr" rid="B9">9</xref>). Considering the significance of immune infiltration in the pathophysiology of MI, establishing a model based on immune-related genes is critical for optimizing the diagnosis of MI.</p>
<p>Nomograms were first reported in clinical application in 1928. They are statistical tools for the graphic illustration of a posh mathematical formula (<xref ref-type="bibr" rid="B10">10</xref>, <xref ref-type="bibr" rid="B11">11</xref>). Medical nomograms combine biological and clinical data, measuring the score for factors on a scale to visually display a statistical model that predicts the likelihood of clinical events for individual (<xref ref-type="bibr" rid="B12">12</xref>, <xref ref-type="bibr" rid="B13">13</xref>). Compared to conventional staging, the convenient and concise operation of a nomogram, with increased accuracy, aids in precise clinical decision-making, accounting for their increased use by researchers and doctors.</p>
<p>To our knowledge, few studies have explored diagnostic genes, cell subpopulation distribution, and immune infiltration in patients with MI. We applied single-sample genomic enrichment analysis (ssGSEA), differential expression analysis, immune infiltration, and diagnostic modeling by constructing immune-related genes to reveal new diagnostic genes for MI. In addition, drug response prediction can help us identify potential drugs for MI treatment.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<title>Materials and methods</title>
<sec id="s2_1">
<title>Microarray data extracted from gene expression omnibus and data processing</title>
<p>A flowchart of the current study is illustrated in <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>. Dataset GSE66360 based on the Affymetrix platform (<xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>) was downloaded from the Gene Expression Omnibus database (<xref ref-type="bibr" rid="B14">14</xref>), consisting of 99 samples, including 49 MI samples and 50 normal samples. The test dataset GSE62646 contains 84 MI samples and 14 patients with coronary artery disease (CAD). The single-cell dataset GSE180678 was obtained from the GEO database, which contained one patient with ischemic cardiomyopathy (<xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>).</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Flowchart of the current study.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-1061800-g001.tif"/>
</fig>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Descriptive statistics.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Data number</th>
<th valign="top" align="center">Platform information</th>
<th valign="top" align="center">MI group</th>
<th valign="top" align="center">Control group</th>
<th valign="top" align="center">Species</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">GSE66360</td>
<td valign="top" align="left">GPL570</td>
<td valign="top" align="center">49</td>
<td valign="top" align="center">50</td>
<td valign="top" align="left">Homo sapien</td>
</tr>
<tr>
<td valign="top" align="left">GSE180678</td>
<td valign="top" align="left">GPL20301</td>
<td valign="top" align="center">1</td>
<td valign="top" align="center">0</td>
<td valign="top" align="left">Homo sapien</td>
</tr>
<tr>
<td valign="top" align="left">GSE62646</td>
<td valign="top" align="left">GPL6244</td>
<td valign="top" align="center">84</td>
<td valign="top" align="center">14</td>
<td valign="top" align="left">Homo sapien</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_2">
<title>Characteristics of differentially expressed genes from dataset GSE66360</title>
<p>Data were preprocessed before performing the DEG analysis. The Affymetrix in R was utilized to improve the database <italic>via</italic> background calibration, normalization, and log2 transformation (<xref ref-type="bibr" rid="B15">15</xref>). We averaged the probe site values if a gene had more than one. According to the annotation files from the platform, the probe IDs were converted to gene symbols, and probes that did not correspond to the symbol of the gene were removed. Finally, the eligible DEGs were screening and electing by the linear models for microarray (LIMMA) data package; P-value &lt; 0.05, and |log2 FC| &gt; 1 (<xref ref-type="bibr" rid="B16">16</xref>).</p>
</sec>
<sec id="s2_3">
<title>Single-cell sequencing of DEGs</title>
<p>First, we used Seurat (<xref ref-type="bibr" rid="B17">17</xref>) for data processing to screen reliable cell subpopulations from single-cell data. The expression of each gene must occur in at least three cells, with at least 200 genes expressed per cell. The percentages of mitochondria and rRNA were calculated by the PercentageFeatureSet function, ensuring that each cell expressed more than 500 genes and &lt;4,000 genes with &lt;30% mitochondrial content and at least 100 unique molecular identifiers (UMIs) per cell. The data were then normalized by log normalization and used to identify highly variable genes using the FindVariableFeature function. Principal Component Analysis (PCA) was used to scale down all genes using the ScaleData function. Next, subgroups of cells were determined using the FindNeighbors and FindCluster functions (set resolution = 0.1), and annotations were applied. The R package FindAllMarkers was used to identify markers for each cell subpopulation and the gene expression profile dataset was re-evaluated using the CiberSort (<xref ref-type="bibr" rid="B18">18</xref>) algorithm in the context of the expression of marker genes for each cell subpopulation to determine the composition of individual cell subpopulations in different samples in the expression profile. Finally, DEGs were combined with cell subpopulations to analyze the distribution and abundance of DEGs in cell subpopulations.</p>
</sec>
<sec id="s2_4">
<title>Disease ontology enrichment analysis of DEGs</title>
<p>Differential genes are the basis of our subsequent analysis study, and whether DEGs are associated with MI determines the accuracy of our following study. Therefore, we performed DO enrichment analysis on differential genes to observe the degree of enrichment of DEGs in MI. We used the &#x201c;cluster Profiler&#x201d; package (<xref ref-type="bibr" rid="B19">19</xref>) and &#x201c;DOSE&#x201d; package (<xref ref-type="bibr" rid="B20">20</xref>) for DO enrichment analysis to analyze the enrichment degree of differential genes in MI and visualize the results on a bar chart (barplot) and a bubble plot (dotplot).</p>
</sec>
<sec id="s2_5">
<title>Immune infiltration analysis</title>
<p>It has been established that ssGSEA can be used to quantify the correlative scale of immunological cells and functions from DEGs. Thus, ssGSEA was adopted to evaluate the correlation between a single sample gene of immune cells and functions based on the converged biological data (<xref ref-type="bibr" rid="B21">21</xref>). Then, the results of immune cells and immune function were visualized in a heat map using the &#x201c;pheatmap&#x201d; package (<xref ref-type="bibr" rid="B22">22</xref>). Finally, the R package &#x201c;GGally&#x201d; was utilized to visualize the correlation between 16 immune cells and 12 immune functions. A P-value &lt; 0.05 was statistically significant.</p>
</sec>
<sec id="s2_6">
<title>Analysis of immune score for DEGs between control and MI groups</title>
<p>The divergence in immune scores between normal and MI groups and the difference in immune cells and functions between the cohorts were assessed by data conversion and visualization using ggplot2 and reshape2 statistical packages by R. We further conducted a correlation analysis of significantly expressed genes between immune cells and function</p>
<p>Next, we selected the top five upregulated and downregulated genes among the most significant DEGs to clarify the correlation between MI-significant differential genes and immune cells and function. The top six genes mostly associated with immunity were screened as hub genes. Subsequently, the data were visualized using ggplot2 packages.</p>
</sec>
<sec id="s2_7">
<title>Construction of immune-related gene model</title>
<p>The identified hub genes were used to establish a gene-disease diagnostic model to determine the accuracy of the genes mostly associated with immune cells and function for MI diagnosis. The goodness-of-fit between the actual and predictive values and the degree of the fitting was evaluated using a calibration plot and Spiegelhalter&#x2019;s Z-test. In addition, the receiver operating characteristic curve (ROC), the area under the ROC curve (AUC), and Harrell&#x2019;s concordance index (C-index) were utilized to appraise the nomogram&#x2019;s discrimination ability. Finally, we compared the levels of hub gene expression between control participants and MI cases in GSE62646 to validate the accuracy of the model by the same analysis methods as above.</p>
</sec>
<sec id="s2_8">
<title>Drug prediction</title>
<p>To expand the clinical value of the immune-related gene model, the Enrichr platform (<uri xlink:href="https://maayanlab.cloud/Enrichr/">https://maayanlab.cloud/Enrichr/</uri>) and the coremine platform (<uri xlink:href="https://www.coremine.com">https://www.coremine.com</uri>) were used to predict the drug delivery of NR4A2 in the model. Drug predictions are identified through the Drug Signature Database (DSigDB) in Enrichr, a large portal with a large number of different genomic libraries that identify targeted drugs associated with NR4A2. A P-value &lt; 0.05 was used to select drugs with potential clinical application.</p>
</sec>
<sec id="s2_9">
<title>Experimental animal preparation</title>
<p>Twenty SD rats were divided into an experimental group (n=17) and a control group (n=3). After 7 days of adaptation, the rats underwent ligation of the anterior descending branch of the coronary artery after anesthesia on day 8. An electrocardiogram was performed after ligation to observe whether the ST segment of the rats showed evident elevation, and the ST-segment elevation indicated successful modeling. After the operation, the rats were fed for seven days. The rat&#x2019;s abdominal aorta was severed on postoperative day 8 to induce massive hemorrhage and death, and the heart tissue was harvested after death. We divided 6 rats into two groups for quantitative real-time PCR (qPCR) and WB (MI=3, control=3). This study was approved by the Ethics Committee of the Affiliated Hospital of Liaoning University of Traditional Chinese Medicine (2022CS(DW)-006-01).</p>
</sec>
<sec id="s2_10">
<title>Western blot</title>
<p>50 mg of tissue from the ischemic portion of the left ventricle of the experimental group and the control group were harvested for qPCR and WB experiments, cut in pre-chilled PBS, and centrifuged for 5&#xa0;min. After the supernatant was removed, the tissue was homogenized by adding the corresponding lysate volume. Then the tissues were fully lysed at 4&#xb0;C for 20&#xa0;min and then centrifuged at 12 000 r/min for 20&#xa0;min. BCA detected the protein concentration in the supernatant, and the remaining supernatant was mixed with protein loading buffer (5&#xd7;Loading Buffer) at a ratio of 1:4 and boiled to denature the protein. After separation by protein gel electrophoresis, the proteins were transferred to PVDF membranes and blocked with 5% skim milk. The membranes were incubated with the primary antibody at 4&#xb0;C at a dilution ratio of 1:5000 for NR4A2 and 1:5000 for GAPDH, incubated overnight, eluted three times with TBST for 10&#xa0;min each, and 1:5000 HRP-labeled secondary antibodies (goat anti-mouse and goat anti-rabbit) were added, respectively The proteins were incubated for 2&#xa0;h at room temperature, eluted three times with TBST for 10&#xa0;min each time, developed by exposure with ECL chemiluminescent solution, photographed by Bio-RAD camera system and analyzed by Image Lab software for relative expression of proteins.</p>
</sec>
<sec id="s2_11">
<title>Quantitative real-time PCR</title>
<p>50mg of experimental and control tissues were taken, added to 1mL Trizol, and homogenized on ice. Total RNA was extracted and cDNA synthesized. All primers were designed with Primer5.0 by referring to the sequences provided by Genbank (RNA fragment sequences are shown in <xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>). The procedure was conducted as follows: 1st cycle 95&#xb0;C for 2&#xa0;min, followed by denaturation at 95&#xb0;C for 5 s, annealing at 60&#xb0;C for 10 s, extension at 72&#xb0;C for 30 s, 40 cycles, and finally terminated at 72&#xb0;C for 5&#xa0;min. The Ct value was the number of cycles the fluorescence signal in each reaction tube undergoes when it reaches a set threshold value. The specificity of the reaction products was determined based on the solubility curve and the results of product electrophoresis. The relative ratio of the target gene to GAPDH was used as its expression, and the relative ratio was calculated using the 2-&#x25b3;&#x25b3;Ct method.</p>
<table-wrap id="T2" position="float">
<label>Table&#xa0;2</label>
<caption>
<p>PCR primers.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Gene</th>
<th valign="top" align="center">Forward primer sequence</th>
<th valign="top" align="center">Reverse primer sequence</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">NR4A2</td>
<td valign="top" align="left">TTACGCTACCACCGGAGTTC</td>
<td valign="top" align="left">AGAAGTGAGTAGAAGCGGCG</td>
</tr>
<tr>
<td valign="top" align="left">GAPDH</td>
<td valign="top" align="left">GACATGCCGCCTGGAAAAC</td>
<td valign="top" align="left">AGCCCAGGATGCCCTTTAGT</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_12">
<title>Statistical analysis</title>
<p>R (version 4.1.3) was utilized for statistical analysis. A p-value &lt; 0.05 was set as a significance threshold for screening DEGs, immune infiltration analysis, immune-related gene model, QPCR, WB experimental results data analysis, and drug prediction.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<title>Results</title>
<sec id="s3_1">
<title>Identification of DEGs</title>
<p>Dataset GSE66360 was selected and underwent differential expression analysis using the &#x201c;Limma&#x201d; package in R 4.1.3 software. Three hundred thirty-five DEGs were identified, including 280 up- and 55 downregulated genes (log2FC &gt; 1 and P-value &lt;0.05). These DEGs were visualized in a volcano plot (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>) with downregulated genes in green, upregulated genes in red, and the rest in black. The top 50 upregulated and downregulated genes were selected to create a heatmap (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2B</bold>
</xref>).</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>
<bold>(A)</bold> Volcano plot for DEGs. Red dots indicate upregulated DEGs, and green dots express downregulated DEGs. <bold>(B)</bold> Heatmap for DEGs. Each line symbolizes one DEG, and each row represents one specimen. The red and blue swatches represent upregulated and downregulated DEGs, respectively.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-1061800-g002.tif"/>
</fig>
</sec>
<sec id="s3_2">
<title>Single-cell RNA sequencing analysis</title>
<p>Cluster analysis categorized scRNA-seq cells into 12 clusters using the &#x201c;FindNeighbors&#x201d; and &#x201c;FindCluster&#x201d; functions (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref>). Marker genes were used to categorize the 12 clusters into 5 types of cells (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3B</bold>
</xref>). Next, the &#x201c;FindAllMarkers&#x201d; function was used to screen the DEGs and 144 genes intersected with the sequencing results. We found that the DEGs were predominantly distributed in endothelial cells. This implies that endothelial cells may have an important role in MI (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3C</bold>
</xref>).</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Overview of single cells from GSE180678. <bold>(A)</bold> Clusters of 12 cells embedded in a T-distributed Stochastic Neighbor Embedding (tSNE). <bold>(B)</bold> Marker genes were used to identify the cell types. <bold>(C)</bold> Heat map of the distribution and enrichment of DEGs in cell subpopulations.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-1061800-g003.tif"/>
</fig>
</sec>
<sec id="s3_3">
<title>DO enrichment analysis</title>
<p>We conducted an enrichment analysis of significant genes and diseases to observe the enrichment degree of DEGs and MI. As shown in <xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref>, DEGs were significantly enriched in diseases such as arteriosclerosis, bacterial infectious disease, arteriosclerotic cardiovascular disease, atherosclerosis, primary bacterial infectious disease, periodontal disease, lung disease, periodontitis, and myocardial infarction. 29 genes were significantly enriched in MI, suggesting a correlation between these DEGs and MI, highlighting the robust correlation between DEGs and MI. (For more information, please see <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Chart 1</bold>
</xref>).</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>DO enrichment analysis shows the correlation between MI and the DEGs; <bold>(A)</bold> The x-axis of the bar chart displays the number of genes, and the y-axis displays the correlative diseases. <bold>(B)</bold> The x-axis of the bubble plot shows the ratio of the genes, and the y-axis shows the correlative diseases.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-1061800-g004.tif"/>
</fig>
</sec>
<sec id="s3_4">
<title>Immune infiltration analysis</title>
<p>Subsequently, we conducted ssGSEA to appraise immune cell content and function in DEGs. The results showed that the top three immune cells with the highest content of DEGs were CD8+T cells, B cells, and Neutrophils, while the highest immune score was found in cytolytic activity (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5A</bold>
</xref>).Then, we analyzed the immune infiltration of immunological cells and functions. The corrplot of immune infiltration divergence illustrated that the levels of 16 immune cells and 12 types of immune functions were high in MI patients.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Differential expression of immune score between normal and MI groups, * indicates the significance of the correlation and the number indicates the degree of correlation. <bold>(A)</bold> Heatmap for DEGs. Each line represents one immune cell or function, and each column represents one dataset. Genes with high correlation and no correlation were represented in red and green swatches, respectively.The redder the color of each row, the higher the correlation. Imc indicates immune cells and imf indicates immune function <bold>(B)</bold> Correlation matrix of 16 significant immune cell subtypes. <bold>(C)</bold> Correlation matrix of 12 immune function subtypes. * indicates the significance of the correlation and the number indicates the degree of correlation (*P&lt;0.05, **P&lt;0.01, ***P&lt;0.001).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-1061800-g005.tif"/>
</fig>
<p>Analysis of 16 immune cell types revealed that B cells were positively linked to TILs (r=0.738), regulatory T cells (Tregs) (r=0.631), and Natural killer (NK) cells (r=0.557). TILs were positively correlated to B cells, CD8+T cells (r=0.696), and Tregs (r=0.784), while Tregs were positively correlated with TILs, B cells, and Th2 cells (r=0.582). On the other hand, mast cells were negatively correlated with Tregs (r =-0.599), B cells (r=-0.441), TIL (r =-0.624), and CD8+T cells (r=-0.518). Moreover, Dendritic cells (DCs) were negatively correlated to B cells (r =-0.516), Tregs (r=-0.678), and TILs (r =-0.565) (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5B</bold>
</xref>). The corrplot of the immune function divergence indicated that parainflammation was positively linked to C-C chemokine receptor (CCR) (r=0.687), inflammation-promotion (r=0.57), and type I interferon (IFN) response (r=0.635), while T cell co-inhibition was positively associated with APC co-inhibition (r=0.507), checkpoints (r=0.68), inflammation-promotion(r=0.747) and T cell co-stimulation (r=0.547), type I IFN response (r=0.581), and type II IFN response (r=0.594) (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5C</bold>
</xref>).</p>
</sec>
<sec id="s3_5">
<title>Differential analysis of immune scores between MI and control groups</title>
<p>After integrating the data of the MI and normal groups from the two datasets, we analyzed the difference in immune cells and immune function. We found that the Cell types that show the most difference in immune cell infiltration between MI and control are macrophages and neutrophils (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6A</bold>
</xref>). We also found a significant difference among the seven immune functions, with the most significant difference observed in CCR, Cytolytic activity, Parainflammation, followed by APC co-inhibition, and T cell co-stimulation. This phenomenon suggests that these immune functions may be involved at critical times in the pathophysiology of MI (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6B</bold>
</xref>).</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Comparison of expression of immune cells <bold>(A)</bold> and functions <bold>(B)</bold> between the MI patients and controls. *** indicates that the P-value is &lt; 0.001, ** indicates that the P-value is &lt; 0.01 * indicates P &lt; 0.05, and &#x201c;ns&#x201d; indicates P &lt; 1.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-1061800-g006.tif"/>
</fig>
</sec>
<sec id="s3_6">
<title>Relevance analysis for immune cells and functions from DEGs</title>
<p>The top 5 upregulated and downregulated genes from DEGs were used to analyze the association between immune cells and functions (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7</bold>
</xref>). We found the highest positive correlation between S100A12 vs. CCR, followed by S100A12 vs. Parainflammation and S100A12 vs. Neutrophils. Conversely, the highest negative correlation was found between CCR2 vs. Tfh, followed by GIMAP4 vs. Tfh. The highest correlation between immune cells and function was observed in 6 genes: GIMAP7, GIMAP4, CCR2, NR4A2, CSTA, and S100A12.</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>Expression of significant genes associated with immune functions. The upregulated and downregulated correlations are displayed in red and purple, respectively. We labeled these 6 genes as hub genes.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-1061800-g007.tif"/>
</fig>
</sec>
<sec id="s3_7">
<title>Immune-gene model for diagnosis of MI</title>
<p>We used hub genes to build gene-disease diagnostic models and generated a line chart, calibration map, and AUC curve. The nomogram was utilized to visualize the model, including the 6 hub genes. The fraction of each gene was consistent with the proportion in the nomogram. As shown in the nomogram (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8A</bold>
</xref>), GIMAP7, GIMAP4, CCR2, NR4A2, CSTA, and S100A12 were predicting factors of MI. High levels of NR4A2 and S100A12 were positively associated with the diagnosis of MI. Hence, the accuracy of MI diagnosis was predicted based on the total score of the three characteristics. The model&#x2019;s performance was appraised by C-index, AUC, and calibration plots. The ROC curve of the model yielded an AUC value of 0.978, indicating that the model had good discrimination ability (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8B</bold>
</xref>). The calibration plot also indicated the better correction of the model (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8C</bold>
</xref>). To validate the accuracy of the prediction model, we performed a validation using a test dataset. The accuracy was evaluated by AUC plots. Interestingly, the AUC value (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8D</bold>
</xref>) and calibration plot (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8E</bold>
</xref>) was set at 0.9, indicating that the accuracy of the HUB gene is more reliable for the diagnosis of MI. Finally, we further explored the correlation between NR4A2 expression and immune cells (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8F</bold>
</xref>). As displayed in <xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8F</bold>
</xref>, NR4A2 was positively correlated with Tfh, pDCs, Parainflammation, Neutrophils, Macrophages, iDCs, and CCR. and negatively correlated with Tumor Infiltrating Lymphocytes, Th2 cells, T cell co&#x2212;stimulation, Cytolytic activity, and B cells.</p>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>
<bold>(A)</bold> Six genes (CCR2, P=0.07;CSTA, P=0.18; GIMAP4, P=0.69; GIMAP7, P=0.71; NR4A2, P=0.0004; S100A12, P=0.04) were utilized to establish a nomogram for the diagnosis MI. <bold>(B)</bold> ROC curves of the nomogram. <bold>(C)</bold> Calibration chart of the diagnostic model. <bold>(D)</bold> ROC curves of the nomogram in the validation set. <bold>(E)</bold> Calibration plots for validation sets. <bold>(F)</bold> Correlation of NR4A2 with infiltrating immune cells in MI and normal samples.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-1061800-g008.tif"/>
</fig>
</sec>
<sec id="s3_8">
<title>Drug prediction analysis</title>
<p>We identified a strong correlation between 180 drugs and MI. Finally, the top five drugs Aldosterone, liothyronine, cholecalciferol, etilefrine, and liothyronine, were selected (adjusted P-value &lt; 0.05) (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9A</bold>
</xref>), (For more information, please see <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Chart 2</bold>
</xref>). Meanwhile, we found that 11 herbal medicines were associated with NR4A2 (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9B</bold>
</xref>); the top 6 herbal medicines were danggui, baizhi, zicao, mudanpi, heshouwu, and youhua.</p>
<fig id="f9" position="float">
<label>Figure&#xa0;9</label>
<caption>
<p>
<bold>(A)</bold> The top 10 medicines for MI. <bold>(B)</bold> The 11 Chinese herbal medicines for MI.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-1061800-g009.tif"/>
</fig>
</sec>
<sec id="s3_9">
<title>Quantitative real-time PCR and Western blot analysis</title>
<p>The transcriptional changes of NR4A2 in the heart tissues of MI rats and controls were detected by qRT-PCR and WB. The results showed that the expression of NR4A2 was increased in both MI groups compared with the control group (<xref ref-type="fig" rid="f10">
<bold>Figures&#xa0;10A, B</bold>
</xref>), which was consistent with the in silico analysis results and indicated the potential diagnostic value of NR4A2 for MI.</p>
<fig id="f10" position="float">
<label>Figure&#xa0;10</label>
<caption>
<p>qPCR and Western blotting analysis of controls vs. MI rats. <bold>(A)</bold> Western blot analysis. There were significant differences in NR4A2 protein levels between controls and MI rats (p&#x2009;&lt;&#x2009;0.0001). <bold>(B)</bold> mRNA level of NR4A2 in controls vs. MI (p&lt;0.001). *** indicates P &lt; 0.001, **** indicates P &lt; 0.0001.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-13-1061800-g010.tif"/>
</fig>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<title>Discussion</title>
<p>MI is the most severe cardiovascular disease worldwide, but there is a clinical lag in diagnosing MI, accounting for the high mortality risk from MI in developing and developed countries. Immunological represents a landmark in the history of medicine. As modern research progresses, there is increasing evidence that immune activation and suppression play important and influential roles in many diseases. However, while inflammation and oxidative stress have been predominantly investigated in the cardiovascular field, immune pathways have been largely underexplored, with few studies assessing whether immune-related genes are of value in diagnosing MI. Therefore, our research used ssGSEA to assess the average expression levels of 16 immune cell types and 12 immune functions in the MI population. Finally, the DEGs were integrated with immune scores to screen the top six genes with the most significant correlation with MI for gene-disease diagnosis. In this study, we constructed a nomogram for the diagnosis of MI based on immune cells and function. As a result, we identified NR4A2 as an independent predictor of MI.</p>
<p>Interestingly, immunity can directly or indirectly regulate the inflammatory response in the body. Inflammation is the initial response of cardiomyocytes after infarction (<xref ref-type="bibr" rid="B23">23</xref>), and inflammatory factors activate adaptive immune pathways <italic>in vivo</italic>, which in turn promote the reaction of immune cells in cardiomyocytes in the infarct area (<xref ref-type="bibr" rid="B24">24</xref>). At the same time, immune infiltration of cardiomyocytes has a bidirectional regulatory role. Overwhelming evidence suggests that immune infiltration of cardiomyocytes exacerbates the inflammatory response (<xref ref-type="bibr" rid="B25">25</xref>). It should be borne in mind that immune activation can also repair damaged cardiomyocytes. Herein, we substantiated that macrophages and neutrophils are most abundant in the MI population than in the general population. Based on extensive fundamental research, we found that activation of immune cells, especially macrophages and neutrophils, participate in critical regulatory mechanisms for sterile inflammation <italic>in vivo (</italic>
<xref ref-type="bibr" rid="B26">26</xref>).</p>
<p>During the inflammatory phase of infarction, inflammatory factors activate macrophages and neutrophils (<xref ref-type="bibr" rid="B27">27</xref>). Activated macrophages secrete anti-inflammatory cytokines (<xref ref-type="bibr" rid="B28">28</xref>&#x2013;<xref ref-type="bibr" rid="B30">30</xref>), which reduce thrombosis and thus protect the heart (<xref ref-type="bibr" rid="B31">31</xref>). After infarction, activated macrophages gradually fill the infarct site by downregulating inflammatory cytokines and upregulating inflammatory factors such as IL-10, VEGF, and TGF-&#x3b2; (<xref ref-type="bibr" rid="B32">32</xref>&#x2013;<xref ref-type="bibr" rid="B35">35</xref>), establishing an anti-inflammatory environment that protects cardiomyocytes in the infarct area from apoptosis and maintains cell survival function. In addition, glucocorticoid receptors in macrophages play a crucial role in post-infarct myocardial repair by regulating the differentiation of myofibroblasts in the infarct microenvironment (<xref ref-type="bibr" rid="B36">36</xref>, <xref ref-type="bibr" rid="B37">37</xref>). Conversely, activated neutrophils lead to the release of neutrophil myeloperoxidase (<xref ref-type="bibr" rid="B38">38</xref>), which can accelerate protease-mediated degradation of basement membrane components and endothelial damage (<xref ref-type="bibr" rid="B39">39</xref>), promoting atherosclerotic plaque damage (<xref ref-type="bibr" rid="B40">40</xref>) as well as plaque instability. Importantly, atherosclerotic plaques become more vulnerable in the proteolytic environment of the basement membrane and core (<xref ref-type="bibr" rid="B41">41</xref>), leading to plaque fragility and rupture (<xref ref-type="bibr" rid="B42">42</xref>) and increasing the risk of myocardial infarction.</p>
<p>In the present study, we found that the expression of these three immune functions differed significantly between healthy and MI populations. CCR and Parainflammation were significantly upregulated, while Cytolytic activity was downregulated in the MI population. The mechanism may be related to the activation of immune function due to massive inflammatory infiltration in cardiomyocytes. There is a rich literature available suggesting that the recruitment of monocytes and monocyte-derived macrophages is the hallmark response to cardiomyocyte death and tissue-resident cardiac CCR2+ macrophages are important upstream mediators of the inflammatory response to myocardial injury (<xref ref-type="bibr" rid="B43">43</xref>). Activation of CCR2+ macrophages leads to the upregulation of inflammatory chemokines and cytoplasmic inflammatory factors (<xref ref-type="bibr" rid="B44">44</xref>), exacerbating the apoptosis of cardiomyocytes after myocardial infarction (<xref ref-type="bibr" rid="B45">45</xref>).</p>
<p>Parainflammation in cardiovascular disease (CVD) is associated with low and persistent circulating levels of pro-inflammatory proteins (<xref ref-type="bibr" rid="B46">46</xref>). In CVD, vascular integrity may be disrupted by pro-inflammatory cytokines that promote macrophage infiltration through the vessel wall to form atherosclerotic plaques and increase susceptibility to plaque instability in later stages (<xref ref-type="bibr" rid="B47">47</xref>). On the contrary, Cytolytic cells usually induce apoptosis of abnormal cells. In states of infection or inflammation, lysis induces apoptosis of activated macrophages and T cells to control the inflammatory response (<xref ref-type="bibr" rid="B48">48</xref>) to ensure plaque stability and delay the onset of MI. Thus, the immunoassay results in this study are consistent with the literature, emphasizing these cells&#x2019; importance in the pathogenesis of MI and providing the basis for our subsequent analysis.</p>
<p>Undeniably, immune pathways play critical regulatory mechanisms in the pathogenesis of MI. However, the study of immune processes remains the domain of fundamental theoretical research. Whether immune-related genes can be applied in the clinic warrants further investigation. After immune analysis of MI-related genes, we found that NR4A2 has potential clinical diagnostic value for MI. Our study found that the amount of NR4A2 was positively correlated with MI. The mechanism may be related to the release of pro-inflammatory factors <italic>in vivo</italic> under immune regulation after myocardial infarction (<xref ref-type="bibr" rid="B49">49</xref>). However, further studies are warranted to corroborate the relationship between NR4A2 and immune activation. Previous studies found that activation of NR4A2 was an adaptive response to ischemia-induced apoptosis in cardiomyocytes (<xref ref-type="bibr" rid="B50">50</xref>). Interestingly, cardiomyocytes after myocardial infarction undergo significant apoptosis due to ischemia (<xref ref-type="bibr" rid="B51">51</xref>). When ischemia persists, cells within the infarcted region initiate autophagic mechanisms to slow the progression of cardiomyocyte death (<xref ref-type="bibr" rid="B52">52</xref>). A cellular study (<xref ref-type="bibr" rid="B50">50</xref>) showed a significant increase in NR4A2 expression in H9C2 cardiomyocytes after ischemia, especially when the ischemic time exceeded 4&#xa0;h. Consistently, we demonstrated that NR4A2 significantly reduced cardiomyocyte apoptosis, thereby protecting the survival of cardiomyocytes after infarction. Knockdown of NR4A2 blocked the autophagic flow of cardiomyocytes and promoted apoptosis, possibly through a significant increase in P53 expression after NR4A2 low presentation, thereby inhibiting the autophagic response of cardiomyocytes in the infarct region (<xref ref-type="bibr" rid="B50">50</xref>). In summary, we conclude that NR4A2 has diagnostic value for MI for the bioinformatics and experimental validation of MI.</p>
<p>Nevertheless, there are some limitations in this study. First, the accuracy of the diagnostic model may be biased due to the limited database resources and sample size. Besides, our drug prediction results have no experimental basis. Accordingly, the results of this study should be interpreted with caution and validated in future studies <italic>via in vivo</italic> and <italic>in vitro</italic> experiments. Finally, our experiments are based on <italic>in vivo</italic> experiments in animals, and this study can only tentatively explain that NR4A2 has potential diagnostic value. However, as clinical studies in humans were not performed in this study, it cannot be asserted that NR4A2 has a definite diagnostic accuracy for MI. The conclusions drawn from this study should be interpreted with caution.</p>
</sec>
<sec id="s5" sec-type="conclusions">
<title>Conclusion</title>
<p>In summary, we evaluated the immune infiltration patterns in MI based on GEO data from ssGSEA and constructed a nomogram containing 6 HUB(GIMAP7, GIMAP4, CCR2, NR4A2, CSTA, and S100A12) genes for the diagnosis of MI. Applying single-cell sequencing, DO enrichment analysis, and drug prediction analysis may provide a new direction for studying the relationship between myocardial infarction, immune response, and efficacy.</p>
</sec>
<sec id="s6" sec-type="data-availability">
<title>Data availability statement</title>
<p>Publicly available datasets were analyzed in this study. This data can be found here: <uri xlink:href="https://www.ncbi.nlm.nih.gov/geo/">https://www.ncbi.nlm.nih.gov/geo/</uri>. The accession number(s) can be found in the article.</p>
</sec>
<sec id="s7" sec-type="ethics-statement">
<title>Ethics statement</title>
<p>The animal study was reviewed and approved by Ethics Committee of the Affiliated Hospital of Liaoning University of Traditional Chinese Medicine.</p>
</sec>
<sec id="s8" sec-type="author-contributions">
<title>Author contributions</title>
<p>DW analyzed and wrote the manuscript. JQ designed the experiments and analyzed the data. LL, YW and XH participated in the qPCR and WB experiments, ZZ and GY designed and supervised the study, and did the final review and revision of the article before submission.</p>
</sec>
</body>
<back>
<sec id="s9" sec-type="funding-information">
<title>Funding</title>
<p>This work was supported by grant from National Natural Science Foundation of China(81974548), Young QI Huang Scholars Support Program, State Administration of Traditional Chinese Medicine of China(20201A2180) and China Postdoctoral Science Foundation(2021MD703841).</p>
</sec>
<ack>
<title>Acknowledgments</title>
<p>We are very grateful to the GEO database for providing meaningful datasets.</p>
</ack>
<sec id="s10" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s11" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s12" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fimmu.2022.1061800/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fimmu.2022.1061800/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="Image_1.tif" id="SF1" mimetype="image/tiff"/>
<supplementary-material xlink:href="Image_2.tif" id="SF2" mimetype="image/tiff"/>
<supplementary-material xlink:href="Image_3.tif" id="SF3" mimetype="image/tiff"/>
<supplementary-material xlink:href="Image_4.tif" id="SF4" mimetype="image/tiff"/>
<supplementary-material xlink:href="Image_5.tif" id="SF5" mimetype="image/tiff"/>
<supplementary-material xlink:href="Image_6.tif" id="SF6" mimetype="image/tiff"/>
<supplementary-material xlink:href="Image_7.tif" id="SF7" mimetype="image/tiff"/>
<supplementary-material xlink:href="Image_8.tif" id="SF8" mimetype="image/tiff"/>
<supplementary-material xlink:href="Table_1.docx" id="SM1" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Levine</surname> <given-names>GN</given-names>
</name>
<name>
<surname>Bates</surname> <given-names>ER</given-names>
</name>
<name>
<surname>Blankenship</surname> <given-names>JC</given-names>
</name>
<name>
<surname>Bailey</surname> <given-names>SR</given-names>
</name>
<name>
<surname>Bittl</surname> <given-names>JA</given-names>
</name>
<name>
<surname>Cercek</surname> <given-names>B</given-names>
</name>
<etal/>
</person-group>. <article-title>2011 ACCF/AHA/SCAI guideline for percutaneous coronary intervention: executive summary: a report of the American college of cardiology Foundation/American heart association task force on practice guidelines and the society for cardiovascular angiography and interventions</article-title>. <source>Circulation</source> (<year>2011</year>) <volume>124</volume>(<issue>23</issue>):<page-range>2574&#x2013;609</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1161/CIR.0b013e31823a5596</pub-id>
</citation>
</ref>
<ref id="B2">
<label>2</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huang</surname> <given-names>P</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>D</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>L</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>Y</given-names>
</name>
</person-group>. <article-title>Downregulation of lncRNA ZFAS1 protects H9c2 cardiomyocytes from ischemia/reperfusioninduced apoptosis <italic>via</italic> the miR5903p/NFkappaB signaling pathway</article-title>. <source>Mol Med Rep</source> (<year>2020</year>) <volume>22</volume>(<issue>3</issue>):<page-range>2300&#x2013;6</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.3892/mmr.2020.11340</pub-id>
</citation>
</ref>
<ref id="B3">
<label>3</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kinoshita</surname> <given-names>M</given-names>
</name>
<name>
<surname>Nakashima</surname> <given-names>H</given-names>
</name>
<name>
<surname>Nakashima</surname> <given-names>M</given-names>
</name>
<name>
<surname>Koga</surname> <given-names>M</given-names>
</name>
<name>
<surname>Toda</surname> <given-names>H</given-names>
</name>
<name>
<surname>Koiwai</surname> <given-names>K</given-names>
</name>
<etal/>
</person-group>. <article-title>The reduced bactericidal activity of neutrophils as an incisive indicator of water-immersion restraint stress and impaired exercise performance in mice</article-title>. <source>Sci Rep</source> (<year>2019</year>) <volume>9</volume>(<issue>1</issue>):<fpage>4562</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41598-019-41077-5</pub-id>
</citation>
</ref>
<ref id="B4">
<label>4</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Solomonidis</surname> <given-names>EG</given-names>
</name>
<name>
<surname>Meloni</surname> <given-names>M</given-names>
</name>
<name>
<surname>Taylor</surname> <given-names>RS</given-names>
</name>
<name>
<surname>Duffin</surname> <given-names>R</given-names>
</name>
<name>
<surname>Dobie</surname> <given-names>R</given-names>
</name>
<etal/>
</person-group>. <article-title>Single-cell transcriptome analyses reveal novel targets modulating cardiac neovascularization by resident endothelial cells following myocardial infarction</article-title>. <source>Eur Heart J</source> (<year>2019</year>) <volume>40</volume>(<issue>30</issue>):<page-range>2507&#x2013;20</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/eurheartj/ehz305</pub-id>
</citation>
</ref>
<ref id="B5">
<label>5</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Khunjan</surname> <given-names>U</given-names>
</name>
<name>
<surname>Ekchaweng</surname> <given-names>K</given-names>
</name>
<name>
<surname>Panrat</surname> <given-names>T</given-names>
</name>
<name>
<surname>Tian</surname> <given-names>M</given-names>
</name>
<name>
<surname>Churngchow</surname> <given-names>N</given-names>
</name>
</person-group>. <article-title>Molecular cloning of HbPR-1 gene from rubber tree, expression of HbPR-1 gene in nicotiana benthamiana and its inhibition of phytophthora palmivora</article-title>. <source>PLoS One</source> (<year>2016</year>) <volume>11</volume>(<issue>6</issue>):<elocation-id>e0157591</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pone.0157591</pub-id>
</citation>
</ref>
<ref id="B6">
<label>6</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Thiriet</surname> <given-names>PE</given-names>
</name>
<name>
<surname>Medagoda</surname> <given-names>D</given-names>
</name>
<name>
<surname>Porro</surname> <given-names>G</given-names>
</name>
<name>
<surname>Guiducci</surname> <given-names>C</given-names>
</name>
</person-group>. <article-title>Rapid multianalyte microfluidic homogeneous immunoassay on electrokinetically driven beads</article-title>. <source>Biosensors (Basel)</source> (<year>2020</year>) <volume>10</volume>(<issue>12</issue>):<fpage>212</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/bios10120212</pub-id>
</citation>
</ref>
<ref id="B7">
<label>7</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fan</surname> <given-names>L</given-names>
</name>
<name>
<surname>Meng</surname> <given-names>H</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>X</given-names>
</name>
<name>
<surname>Li</surname> <given-names>X</given-names>
</name>
<name>
<surname>Meng</surname> <given-names>F</given-names>
</name>
</person-group>. <article-title>Differential gene expression profiles in peripheral blood in northeast Chinese han people with acute myocardial infarction</article-title>. <source>Genet Mol Biol</source> (<year>2018</year>) <volume>41</volume>(<issue>1</issue>):<fpage>59</fpage>&#x2013;<lpage>66</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1590/1678-4685-GMB-2017-0075</pub-id>
</citation>
</ref>
<ref id="B8">
<label>8</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>H</given-names>
</name>
<name>
<surname>Song</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Deng</surname> <given-names>C</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>H</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>X</given-names>
</name>
<etal/>
</person-group>. <article-title>Comprehensive analysis of immune infiltration and gene expression for predicting survival in patients with sarcomas</article-title>. <source>Aging (Albany NY)</source> (<year>2020</year>) <volume>13</volume>(<issue>2</issue>):<page-range>2168&#x2013;83</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.18632/aging.202229</pub-id>
</citation>
</ref>
<ref id="B9">
<label>9</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>L</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>M</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>X</given-names>
</name>
<name>
<surname>He</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>R</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>J</given-names>
</name>
<etal/>
</person-group>. <article-title>Identification of the tubulointerstitial infiltrating immune cell landscape and immune marker related molecular patterns in lupus nephritis using bioinformatics analysis</article-title>. <source>Ann Transl Med</source> (<year>2020</year>) <volume>8</volume>(<issue>23</issue>):<fpage>1596</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.21037/atm-20-7507</pub-id>
</citation>
</ref>
<ref id="B10">
<label>10</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Balachandran</surname> <given-names>VP</given-names>
</name>
<name>
<surname>Gonen</surname> <given-names>M</given-names>
</name>
<name>
<surname>Smith</surname> <given-names>JJ</given-names>
</name>
<name>
<surname>DeMatteo</surname> <given-names>RP</given-names>
</name>
</person-group>. <article-title>Nomograms in oncology: More than meets the eye</article-title>. <source>Lancet Oncol</source> (<year>2015</year>) <volume>16</volume>(<issue>4</issue>):<page-range>e173&#x2013;80</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S1470-2045(14)71116-7</pub-id>
</citation>
</ref>
<ref id="B11">
<label>11</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Grimes</surname> <given-names>DA</given-names>
</name>
</person-group>. <article-title>The nomogram epidemic: Resurgence of a medical relic</article-title>. <source>Ann Intern Med</source> (<year>2008</year>) <volume>149</volume>(<issue>4</issue>):<page-range>273&#x2013;5</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.7326/0003-4819-149-4-200808190-00010</pub-id>
</citation>
</ref>
<ref id="B12">
<label>12</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Iasonos</surname> <given-names>A</given-names>
</name>
<name>
<surname>Schrag</surname> <given-names>D</given-names>
</name>
<name>
<surname>Raj</surname> <given-names>GV</given-names>
</name>
<name>
<surname>Panageas</surname> <given-names>KS</given-names>
</name>
</person-group>. <article-title>How to build and interpret a nomogram for cancer prognosis</article-title>. <source>J Clin Oncol</source> (<year>2008</year>) <volume>26</volume>(<issue>8</issue>):<page-range>1364&#x2013;70</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1200/JCO.2007.12.9791</pub-id>
</citation>
</ref>
<ref id="B13">
<label>13</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>X</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>S</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>G</given-names>
</name>
<name>
<surname>Xie</surname> <given-names>W</given-names>
</name>
<name>
<surname>Franco</surname> <given-names>JPC</given-names>
</name>
<etal/>
</person-group>. <article-title>Nomogram based on clinical characteristics for preoperative prediction of perineural invasion in gastric cancer</article-title>. <source>J Int Med Res</source> (<year>2020</year>) <volume>48</volume>(<issue>1</issue>):<elocation-id>300060519895131</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1177/0300060519895131</pub-id>
</citation>
</ref>
<ref id="B14">
<label>14</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Omidi</surname> <given-names>F</given-names>
</name>
<name>
<surname>Hosseini</surname> <given-names>SA</given-names>
</name>
<name>
<surname>Ahmadi</surname> <given-names>A</given-names>
</name>
<name>
<surname>Hassanzadeh</surname> <given-names>K</given-names>
</name>
<name>
<surname>Rajaei</surname> <given-names>S</given-names>
</name>
<name>
<surname>Cesaire</surname> <given-names>HM</given-names>
</name>
<etal/>
</person-group>. <article-title>Discovering the signature of a lupus-related microRNA profile in the gene expression omnibus repository</article-title>. <source>Lupus</source> (<year>2020</year>) <volume>29</volume>(<issue>11</issue>):<page-range>1321&#x2013;35</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1177/0961203320944473</pub-id>
</citation>
</ref>
<ref id="B15">
<label>15</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Irizarry</surname> <given-names>RA</given-names>
</name>
<name>
<surname>Hobbs</surname> <given-names>B</given-names>
</name>
<name>
<surname>Collin</surname> <given-names>F</given-names>
</name>
<name>
<surname>Beazer-Barclay</surname> <given-names>YD</given-names>
</name>
<name>
<surname>Antonellis</surname> <given-names>KJ</given-names>
</name>
<name>
<surname>Scherf</surname> <given-names>U</given-names>
</name>
<etal/>
</person-group>. <article-title>Exploration, normalization, and summaries of high density oligonucleotide array probe level data</article-title>. <source>Biostatistics</source> (<year>2003</year>) <volume>4</volume>(<issue>2</issue>):<page-range>249&#x2013;64</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/biostatistics/4.2.249</pub-id>
</citation>
</ref>
<ref id="B16">
<label>16</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ritchie</surname> <given-names>ME</given-names>
</name>
<name>
<surname>Phipson</surname> <given-names>B</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>D</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Law</surname> <given-names>CW</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>W</given-names>
</name>
<etal/>
</person-group>. <article-title>Limma powers differential expression analyses for RNA-sequencing and microarray studies</article-title>. <source>Nucleic Acids Res</source> (<year>2015</year>) <volume>43</volume>(<issue>7</issue>):<elocation-id>e47</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/gkv007</pub-id>
</citation>
</ref>
<ref id="B17">
<label>17</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xia</surname> <given-names>J</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Han</surname> <given-names>H</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>S</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>H</given-names>
</name>
<etal/>
</person-group>. <article-title>Whitefly hijacks a plant detoxification gene that neutralizes plant toxins</article-title>. <source>(Cell)</source> (<year>2021</year>) <volume>184</volume>(<issue>7</issue>):<fpage>1693</fpage>&#x2013;<lpage>705.e17</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.cell.2021.02.014</pub-id>
</citation>
</ref>
<ref id="B18">
<label>18</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>B</given-names>
</name>
<name>
<surname>Khodadoust</surname> <given-names>MS</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>CL</given-names>
</name>
<name>
<surname>Newman</surname> <given-names>AM</given-names>
</name>
<name>
<surname>Alizadeh</surname> <given-names>AA</given-names>
</name>
</person-group>. <article-title>Profiling tumor infiltrating immune cells with CIBERSORT</article-title>. <source>Methods Mol Biol</source> (<year>2018</year>) <volume>1711</volume>:<page-range>243&#x2013;59</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/978-1-4939-7493-1_12</pub-id>
</citation>
</ref>
<ref id="B19">
<label>19</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname> <given-names>T</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>E</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>S</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>M</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>P</given-names>
</name>
<name>
<surname>Dai</surname> <given-names>Z</given-names>
</name>
<etal/>
</person-group>. <article-title>clusterProfiler 4.0: A universal enrichment tool for interpreting omics data</article-title>. <source>Innovation (Camb)</source> (<year>2021</year>) <volume>2</volume>(<issue>3</issue>):<elocation-id>100141</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.xinn.2021.100141</pub-id>
</citation>
</ref>
<ref id="B20">
<label>20</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yu</surname> <given-names>G</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>LG</given-names>
</name>
<name>
<surname>Yan</surname> <given-names>GR</given-names>
</name>
<name>
<surname>He</surname> <given-names>QY</given-names>
</name>
</person-group>. <article-title>DOSE: An R/Bioconductor package for disease ontology semantic and enrichment analysis</article-title>. <source>Bioinformatics</source> (<year>2015</year>) <volume>31</volume>(<issue>4</issue>):<page-range>608&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/bioinformatics/btu684</pub-id>
</citation>
</ref>
<ref id="B21">
<label>21</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Newman</surname> <given-names>AM</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>CL</given-names>
</name>
<name>
<surname>Green</surname> <given-names>MR</given-names>
</name>
<name>
<surname>Gentles</surname> <given-names>AJ</given-names>
</name>
<name>
<surname>Feng</surname> <given-names>W</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>Y</given-names>
</name>
<etal/>
</person-group>. <article-title>Robust enumeration of cell subsets from tissue expression profiles</article-title>. <source>Nat Methods</source> (<year>2015</year>) <volume>12</volume>(<issue>5</issue>):<page-range>453&#x2013;7</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nmeth.3337</pub-id>
</citation>
</ref>
<ref id="B22">
<label>22</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jang</surname> <given-names>C</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>L</given-names>
</name>
<name>
<surname>Rabinowitz</surname> <given-names>JD</given-names>
</name>
</person-group>. <article-title>Metabolomics and isotope tracing</article-title>. <source>Cell</source> (<year>2018</year>) <volume>173</volume>(<issue>4</issue>):<page-range>822&#x2013;37</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.cell.2018.03.055</pub-id>
</citation>
</ref>
<ref id="B23">
<label>23</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Biemmi</surname> <given-names>V</given-names>
</name>
<name>
<surname>Milano</surname> <given-names>G</given-names>
</name>
<name>
<surname>Ciullo</surname> <given-names>A</given-names>
</name>
<name>
<surname>Cervio</surname> <given-names>E</given-names>
</name>
<name>
<surname>Burrello</surname> <given-names>J</given-names>
</name>
<name>
<surname>Dei Cas</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Inflammatory extracellular vesicles prompt heart dysfunction <italic>via</italic> TRL4-dependent NF-kappaB activation</article-title>. <source>Theranostics</source> (<year>2020</year>) <volume>10</volume>(<issue>6</issue>):<page-range>2773&#x2013;90</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.7150/thno.39072</pub-id>
</citation>
</ref>
<ref id="B24">
<label>24</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Villarreal-Calderon</surname> <given-names>JR</given-names>
</name>
<name>
<surname>Cuellar</surname> <given-names>RX</given-names>
</name>
<name>
<surname>Ramos-Gonzalez</surname> <given-names>MR</given-names>
</name>
<name>
<surname>Rubio-Infante</surname> <given-names>N</given-names>
</name>
<name>
<surname>Castillo</surname> <given-names>EC</given-names>
</name>
<name>
<surname>Elizondo-Montemayor</surname> <given-names>L</given-names>
</name>
<etal/>
</person-group>. <article-title>Interplay between the adaptive immune system and insulin resistance in weight loss induced by bariatric surgery</article-title>. <source>Oxid Med Cell Longev</source> (<year>2019</year>) <volume>2019</volume>:<elocation-id>3940739</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1155/2019/3940739</pub-id>
</citation>
</ref>
<ref id="B25">
<label>25</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname> <given-names>L</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>B</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>X</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Z</given-names>
</name>
<etal/>
</person-group>. <article-title>MicroRNA-21 prevents excessive inflammation and cardiac dysfunction after myocardial infarction through targeting KBTBD7</article-title>. <source>Cell Death Dis</source> (<year>2018</year>) <volume>9</volume>(<issue>7</issue>):<fpage>769</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41419-018-0805-5</pub-id>
</citation>
</ref>
<ref id="B26">
<label>26</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lewis</surname> <given-names>S</given-names>
</name>
<name>
<surname>Little</surname> <given-names>R</given-names>
</name>
<name>
<surname>Baudoin</surname> <given-names>F</given-names>
</name>
<name>
<surname>Prehar</surname> <given-names>S</given-names>
</name>
<name>
<surname>Neyses</surname> <given-names>L</given-names>
</name>
<name>
<surname>Cartwright</surname> <given-names>EJ</given-names>
</name>
<etal/>
</person-group>. <article-title>Acute inhibition of PMCA4, but not global ablation, reduces blood pressure and arterial contractility via a nNOS-dependent mechanism</article-title>. <source>J Cell Mol Med</source> (<year>2018</year>) <volume>22</volume>(<issue>2</issue>):<page-range>861&#x2013;72</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/jcmm.13371</pub-id>
</citation>
</ref>
<ref id="B27">
<label>27</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zeng</surname> <given-names>MY</given-names>
</name>
<name>
<surname>Pham</surname> <given-names>D</given-names>
</name>
<name>
<surname>Bagaitkar</surname> <given-names>J</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Otero</surname> <given-names>K</given-names>
</name>
<name>
<surname>Shan</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>An efferocytosis-induced, IL-4-dependent macrophage-iNKT cell circuit suppresses sterile inflammation and is defective in murine CGD</article-title>. <source>Blood</source> (<year>2013</year>) <volume>121</volume>(<issue>17</issue>):<page-range>3473&#x2013;83</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1182/blood-2012-10-461913</pub-id>
</citation>
</ref>
<ref id="B28">
<label>28</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>X</given-names>
</name>
<name>
<surname>Lai</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Song</surname> <given-names>X</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>L</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>H</given-names>
</name>
<etal/>
</person-group>. <article-title>Polysaccharides from citrus grandis associate with luteolin relieves chronic pharyngitis by anti-inflammatory via suppressing NF-kappaB pathway and the polarization of M1 macrophages</article-title>. <source>Int J Immunopathol Pharmacol</source> (<year>2018</year>) <volume>32</volume>:<elocation-id>2058738418780593</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1177/2058738418780593</pub-id>
</citation>
</ref>
<ref id="B29">
<label>29</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tsuboi</surname> <given-names>I</given-names>
</name>
<name>
<surname>Harada</surname> <given-names>T</given-names>
</name>
<name>
<surname>Hirabayashi</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Aizawa</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>Senescence-accelerated mice (SAMP1/TA-1) treated repeatedly with lipopolysaccharide develop a condition that resembles hemophagocytic lymphohistiocytosis</article-title>. <source>Haematologica</source> (<year>2019</year>) <volume>104</volume>(<issue>10</issue>):<fpage>1995</fpage>&#x2013;<lpage>2005</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3324/haematol.2018.209551</pub-id>
</citation>
</ref>
<ref id="B30">
<label>30</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rudloff</surname> <given-names>S</given-names>
</name>
<name>
<surname>Janot</surname> <given-names>M</given-names>
</name>
<name>
<surname>Rodriguez</surname> <given-names>S</given-names>
</name>
<name>
<surname>Dessalle</surname> <given-names>K</given-names>
</name>
<name>
<surname>Jahnen-Dechent</surname> <given-names>W</given-names>
</name>
<name>
<surname>Huynh-Do</surname> <given-names>U</given-names>
</name>
</person-group>. <article-title>Fetuin-a is a HIF target that safeguards tissue integrity during hypoxic stress</article-title>. <source>Nat Commun</source> (<year>2021</year>) <volume>12</volume>(<issue>1</issue>):<fpage>549</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41467-020-20832-7</pub-id>
</citation>
</ref>
<ref id="B31">
<label>31</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Tang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Cui</surname> <given-names>X</given-names>
</name>
<name>
<surname>Qin</surname> <given-names>B</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>L</given-names>
</name>
<etal/>
</person-group>. <article-title>New insights and novel therapeutic potentials for macrophages in myocardial infarction</article-title>. <source>Inflammation</source> (<year>2021</year>) <volume>44</volume>(<issue>5</issue>):<page-range>1696&#x2013;712</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s10753-021-01467-2</pub-id>
</citation>
</ref>
<ref id="B32">
<label>32</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fadok</surname> <given-names>VA</given-names>
</name>
<name>
<surname>Bratton</surname> <given-names>DL</given-names>
</name>
<name>
<surname>Konowal</surname> <given-names>A</given-names>
</name>
<name>
<surname>Freed</surname> <given-names>PW</given-names>
</name>
<name>
<surname>Westcott</surname> <given-names>JY</given-names>
</name>
<name>
<surname>Henson</surname> <given-names>PM</given-names>
</name>
</person-group>. <article-title>Macrophages that have ingested apoptotic cells <italic>in vitro</italic> inhibit proinflammatory cytokine production through autocrine/paracrine mechanisms involving TGF-beta, PGE2, and PAF</article-title>. <source>J Clin Invest</source> (<year>1998</year>) <volume>101</volume>(<issue>4</issue>):<page-range>890&#x2013;8</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1172/JCI1112</pub-id>
</citation>
</ref>
<ref id="B33">
<label>33</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Song</surname> <given-names>JY</given-names>
</name>
<name>
<surname>Kang</surname> <given-names>HJ</given-names>
</name>
<name>
<surname>Hong</surname> <given-names>JS</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>CJ</given-names>
</name>
<name>
<surname>Shim</surname> <given-names>JY</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>CW</given-names>
</name>
<etal/>
</person-group>. <article-title>Umbilical cord-derived mesenchymal stem cell extracts reduce colitis in mice by re-polarizing intestinal macrophages</article-title>. <source>Sci Rep</source> (<year>2017</year>) <volume>7</volume>(<issue>1</issue>):<fpage>9412</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41598-017-09827-5</pub-id>
</citation>
</ref>
<ref id="B34">
<label>34</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>W</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>L</given-names>
</name>
<name>
<surname>Du</surname> <given-names>S</given-names>
</name>
<name>
<surname>Mao</surname> <given-names>J</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y</given-names>
</name>
<etal/>
</person-group>. <article-title>The P300/XBP1s/Herpud1 axis promotes macrophage M2 polarization and the development of choroidal neovascularization</article-title>. <source>J Cell Mol Med</source> (<year>2021</year>) <volume>25</volume>(<issue>14</issue>):<page-range>6709&#x2013;20</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/jcmm.16673</pub-id>
</citation>
</ref>
<ref id="B35">
<label>35</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Leung</surname> <given-names>G</given-names>
</name>
<name>
<surname>Baggott</surname> <given-names>C</given-names>
</name>
<name>
<surname>West</surname> <given-names>C</given-names>
</name>
<name>
<surname>Elboim</surname> <given-names>C</given-names>
</name>
<name>
<surname>Paul</surname> <given-names>SM</given-names>
</name>
<name>
<surname>Cooper</surname> <given-names>BA</given-names>
</name>
<etal/>
</person-group>. <article-title>Cytokine candidate genes predict the development of secondary lymphedema following breast cancer surgery</article-title>. <source>Lymphat Res Biol</source> (<year>2014</year>) <volume>12</volume>(<issue>1</issue>):<fpage>10</fpage>&#x2013;<lpage>22</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1089/lrb.2013.0024</pub-id>
</citation>
</ref>
<ref id="B36">
<label>36</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Galuppo</surname> <given-names>P</given-names>
</name>
<name>
<surname>Vettorazzi</surname> <given-names>S</given-names>
</name>
<name>
<surname>Hovelmann</surname> <given-names>J</given-names>
</name>
<name>
<surname>Scholz</surname> <given-names>CJ</given-names>
</name>
<name>
<surname>Tuckermann</surname> <given-names>JP</given-names>
</name>
<name>
<surname>Bauersachs</surname> <given-names>J</given-names>
</name>
<etal/>
</person-group>. <article-title>The glucocorticoid receptor in monocyte-derived macrophages is critical for cardiac infarct repair and remodeling</article-title>. <source>FASEB J</source> (<year>2017</year>) <volume>31</volume>(<issue>11</issue>):<page-range>5122&#x2013;32</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1096/fj.201700317R</pub-id>
</citation>
</ref>
<ref id="B37">
<label>37</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bhattacharyya</surname> <given-names>S</given-names>
</name>
<name>
<surname>Brown</surname> <given-names>DE</given-names>
</name>
<name>
<surname>Brewer</surname> <given-names>JA</given-names>
</name>
<name>
<surname>Vogt</surname> <given-names>SK</given-names>
</name>
<name>
<surname>Muglia</surname> <given-names>LJ</given-names>
</name>
</person-group>. <article-title>Macrophage glucocorticoid receptors regulate toll-like receptor 4-mediated inflammatory responses by selective inhibition of p38 MAP kinase</article-title>. <source>Blood</source> (<year>2007</year>) <volume>109</volume>(<issue>10</issue>):<page-range>4313&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1182/blood-2006-10-048215</pub-id>
</citation>
</ref>
<ref id="B38">
<label>38</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Biasucci</surname> <given-names>LM</given-names>
</name>
<name>
<surname>D'Onofrio</surname> <given-names>G</given-names>
</name>
<name>
<surname>Liuzzo</surname> <given-names>G</given-names>
</name>
<name>
<surname>Zini</surname> <given-names>G</given-names>
</name>
<name>
<surname>Monaco</surname> <given-names>C</given-names>
</name>
<name>
<surname>Caligiuri</surname> <given-names>G</given-names>
</name>
<etal/>
</person-group>. <article-title>Intracellular neutrophil myeloperoxidase is reduced in unstable angina and acute myocardial infarction, but its reduction is not related to ischemia</article-title>. <source>J Am Coll Cardiol</source> (<year>1996</year>) <volume>27</volume>(<issue>3</issue>):<page-range>611&#x2013;6</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/0735-1097(95)00524-2</pub-id>
</citation>
</ref>
<ref id="B39">
<label>39</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dinerman</surname> <given-names>JL</given-names>
</name>
<name>
<surname>Mehta</surname> <given-names>JL</given-names>
</name>
<name>
<surname>Saldeen</surname> <given-names>TG</given-names>
</name>
<name>
<surname>Emerson</surname> <given-names>S</given-names>
</name>
<name>
<surname>Wallin</surname> <given-names>R</given-names>
</name>
<name>
<surname>Davda</surname> <given-names>R</given-names>
</name>
<etal/>
</person-group>. <article-title>Increased neutrophil elastase release in unstable angina pectoris and acute myocardial infarction</article-title>. <source>J Am Coll Cardiol</source> (<year>1990</year>) <volume>15</volume>(<issue>7</issue>):<page-range>1559&#x2013;63</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/0735-1097(90)92826-n</pub-id>
</citation>
</ref>
<ref id="B40">
<label>40</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ng</surname> <given-names>JL</given-names>
</name>
<name>
<surname>Chan</surname> <given-names>MT</given-names>
</name>
<name>
<surname>Gelb</surname> <given-names>AW</given-names>
</name>
</person-group>. <article-title>Perioperative stroke in noncardiac, nonneurosurgical surgery</article-title>. <source>Anesthesiology</source> (<year>2011</year>) <volume>115</volume>(<issue>4</issue>):<page-range>879&#x2013;90</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1097/ALN.0b013e31822e9499</pub-id>
</citation>
</ref>
<ref id="B41">
<label>41</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tedgui</surname> <given-names>A</given-names>
</name>
<name>
<surname>Mallat</surname> <given-names>Z</given-names>
</name>
</person-group>. <article-title>Cytokines in atherosclerosis: Pathogenic and regulatory pathways</article-title>. <source>Physiol Rev</source> (<year>2006</year>) <volume>86</volume>(<issue>2</issue>):<page-range>515&#x2013;81</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1152/physrev.00024.2005</pub-id>
</citation>
</ref>
<ref id="B42">
<label>42</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>de Boer</surname> <given-names>OJ</given-names>
</name>
<name>
<surname>van der Wal</surname> <given-names>AC</given-names>
</name>
<name>
<surname>Teeling</surname> <given-names>P</given-names>
</name>
<name>
<surname>Becker</surname> <given-names>AE</given-names>
</name>
</person-group>. <article-title>Leucocyte recruitment in rupture prone regions of lipid-rich plaques: A prominent role for neovascularization</article-title>? <source>Cardiovasc Res</source> (<year>1999</year>) <volume>41</volume>(<issue>2</issue>):<page-range>443&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/s0008-6363(98)00255-7</pub-id>
</citation>
</ref>
<ref id="B43">
<label>43</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bajpai</surname> <given-names>G</given-names>
</name>
<name>
<surname>Bredemeyer</surname> <given-names>A</given-names>
</name>
<name>
<surname>Li</surname> <given-names>W</given-names>
</name>
<name>
<surname>Zaitsev</surname> <given-names>K</given-names>
</name>
<name>
<surname>Koenig</surname> <given-names>AL</given-names>
</name>
<name>
<surname>Lokshina</surname> <given-names>I</given-names>
</name>
<etal/>
</person-group>. <article-title>Tissue resident CCR2- and CCR2+ cardiac macrophages differentially orchestrate monocyte recruitment and fate specification following myocardial injury</article-title>. <source>Circ Res</source> (<year>2019</year>) <volume>124</volume>(<issue>2</issue>):<page-range>263&#x2013;78</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1161/CIRCRESAHA.118.314028</pub-id>
</citation>
</ref>
<ref id="B44">
<label>44</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ricardo</surname> <given-names>SD</given-names>
</name>
<name>
<surname>van Goor</surname> <given-names>H</given-names>
</name>
<name>
<surname>Eddy</surname> <given-names>AA</given-names>
</name>
</person-group>. <article-title>Macrophage diversity in renal injury and repair</article-title>. <source>J Clin Invest</source> (<year>2008</year>) <volume>118</volume>(<issue>11</issue>):<page-range>3522&#x2013;30</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1172/JCI36150</pub-id>
</citation>
</ref>
<ref id="B45">
<label>45</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mantovani</surname> <given-names>A</given-names>
</name>
<name>
<surname>Sica</surname> <given-names>A</given-names>
</name>
<name>
<surname>Sozzani</surname> <given-names>S</given-names>
</name>
<name>
<surname>Allavena</surname> <given-names>P</given-names>
</name>
<name>
<surname>Vecchi</surname> <given-names>A</given-names>
</name>
<name>
<surname>Locati</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>The chemokine system in diverse forms of macrophage activation and polarization</article-title>. <source>Trends Immunol</source> (<year>2004</year>) <volume>25</volume>(<issue>12</issue>):<page-range>677&#x2013;86</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.it.2004.09.015</pub-id>
</citation>
</ref>
<ref id="B46">
<label>46</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bastard</surname> <given-names>JP</given-names>
</name>
<name>
<surname>Maachi</surname> <given-names>M</given-names>
</name>
<name>
<surname>Lagathu</surname> <given-names>C</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>MJ</given-names>
</name>
<name>
<surname>Caron</surname> <given-names>M</given-names>
</name>
<name>
<surname>Vidal</surname> <given-names>H</given-names>
</name>
<etal/>
</person-group>. <article-title>Recent advances in the relationship between obesity, inflammation, and insulin resistance</article-title>. <source>Eur Cytokine Netw</source> (<year>2006</year>) <volume>17</volume>(<issue>1</issue>):<fpage>4</fpage>&#x2013;<lpage>12</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1104/pp.92.4.891</pub-id>
</citation>
</ref>
<ref id="B47">
<label>47</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Baker</surname> <given-names>RG</given-names>
</name>
<name>
<surname>Hayden</surname> <given-names>MS</given-names>
</name>
<name>
<surname>Ghosh</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>NF-kappaB, inflammation, and metabolic disease</article-title>. <source>Cell Metab</source> (<year>2011</year>) <volume>13</volume>(<issue>1</issue>):<fpage>11</fpage>&#x2013;<lpage>22</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.cmet.2010.12.008</pub-id>
</citation>
</ref>
<ref id="B48">
<label>48</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Crayne</surname> <given-names>CB</given-names>
</name>
<name>
<surname>Albeituni</surname> <given-names>S</given-names>
</name>
<name>
<surname>Nichols</surname> <given-names>KE</given-names>
</name>
<name>
<surname>Cron</surname> <given-names>RQ</given-names>
</name>
</person-group>. <article-title>The immunology of macrophage activation syndrome</article-title>. <source>Front Immunol</source> (<year>2019</year>) <volume>10</volume>:<elocation-id>119</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2019.00119</pub-id>
</citation>
</ref>
<ref id="B49">
<label>49</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sheu</surname> <given-names>JJ</given-names>
</name>
<name>
<surname>Sung</surname> <given-names>PH</given-names>
</name>
<name>
<surname>Leu</surname> <given-names>S</given-names>
</name>
<name>
<surname>Chai</surname> <given-names>HT</given-names>
</name>
<name>
<surname>Zhen</surname> <given-names>YY</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>YC</given-names>
</name>
<etal/>
</person-group>. <article-title>Innate immune response after acute myocardial infarction and pharmacomodulatory action of tacrolimus in reducing infarct size and preserving myocardial integrity</article-title>. <source>J BioMed Sci</source> (<year>2013</year>) <volume>20</volume>:<elocation-id>82</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/1423-0127-20-82</pub-id>
</citation>
</ref>
<ref id="B50">
<label>50</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>P</given-names>
</name>
<name>
<surname>Li</surname> <given-names>J</given-names>
</name>
<name>
<surname>Huo</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Wan</surname> <given-names>L</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>Q</given-names>
</name>
<etal/>
</person-group>. <article-title>Adenovirus-mediated expression of orphan nuclear receptor NR4A2 targeting hepatic stellate cell attenuates liver fibrosis in rats</article-title>. <source>Sci Rep</source> (<year>2016</year>) <volume>6</volume>:<elocation-id>33593</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/srep33593</pub-id>
</citation>
</ref>
<ref id="B51">
<label>51</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname> <given-names>S</given-names>
</name>
<name>
<surname>Cao</surname> <given-names>J</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>T</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>K</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>G</given-names>
</name>
<etal/>
</person-group>. <article-title>Electroacupuncture ameliorates the coronary occlusion related tachycardia and hypotension in acute rat myocardial ischemia model: Potential role of hippocampus</article-title>. <source>Evid Based Complement Alternat Med</source> (<year>2015</year>) <volume>2015</volume>:<elocation-id>925987</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1155/2015/925987</pub-id>
</citation>
</ref>
<ref id="B52">
<label>52</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>H</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>P</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>X</given-names>
</name>
<name>
<surname>Yin</surname> <given-names>D</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>NR4A2 protects cardiomyocytes against myocardial infarction injury by promoting autophagy</article-title>. <source>Cell Death Discov</source> (<year>2018</year>) <volume>4</volume>:<fpage>27</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41420-017-0011-8</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>