Wild type (11), CD11a (αL) knockout (KO) mice (12), CD11b (αM) KO mice (13), CD11d (αD) KO mice (14) were obtained from Jackson Laboratory (Bar Harbor, Maine, USA). CD11c (αX) KO mice were kindly given by Dr. Christie Ballantyne (Baylor University). CD18 KO (β2) KO mice were kindly given by Dr. Dennis Wagner (Boston Children’s Hospital). They were housed under specific pathogen-free condition, with 12-hour light and dark cycles. All animal protocols were approved by the Institutional Animal Care and Use Committee (IACUC) at Boston Children’s Hospital.

All the experimental procedures complied with institutional and federal guidelines regarding the use of animals in research. Polymicrobial abdominal sepsis was induced by cecal ligation and puncture surgery, as we previously performed (7). In brief, mice were anesthetized with an intraperitoneal injection of ketamine 60 mg/kg and xylazine 5 mg/kg. Following its exteriorization, the cecum was ligated at a 1.0 cm from its tip and subjected to a single, through- and -through puncture using a 20-gauge needle. A small amount of fecal material was expelled with a gentle pressure to maintain the patency of puncture sites. The cecum was reinserted into the abdominal cavity. 0.1 mL/g of warmed saline was administered subcutaneously. Buprenorphine was given subcutaneously to alleviate postoperative surgical pain. For outcome study, mice were observed up to 7 days.

For histological analysis, lung was fixed with 4% paraformaldehyde for histological analysis. Lung histology was subjected to Hematoxylin and Eosin (H&E) staining. In some cases, we also examined bronchial lavage fluid (BAL) for protein concentrations, and performed wet to dry ratio.

To determine the bacterial loads in the organs and blood, tissue homogenates or blood were loaded on 5% blood agar plates (Teknova; Hollister, California, USA) after surgical dilutions and incubated for 18 hours as previously described (15). Colonies of all morphologies on plates were counted. For neutrophil depletion experiment, 250 µg of rat anti-Ly6G antibody (clone 1A8, Bio X Cell, Lebanon, NH) was injected intraperitoneally one day before CLP procedure as previously described (16). As a control, normal rat IgG2a isotype control was used.

Escherichia coli (E. coli)-GFP (ATCC25922-GFP) was overnight cultured in Luria-Bertani (17) ampicillin (100 µg/mL) medium at 37°C and washed twice with sterile PBS buffer. Mice were subjected to an intraperitoneal injection of E. coli- GFP (10⁸ CFU). At 6 hours after the injection, peritoneal fluid was collected by lavage using 5 mL of cold PBS buffer. Serial dilutions of the final bacterial inocula were plated on LB-ampicillin (100 µg/mL) agar plates and incubated overnight at 37°C to verify the number of live bacteria injected as above.

Cell death was examined using Annexin V apoptosis detection kit (BD Biosciences, San Jose, CA, USA). Briefly cells were stained with Annexin V-FITC. Then, cells were subjected to flow cytometry analysis using BD Accuri C6 (BD Biosciences).

To generate mixed bone marrow chimeras, recipient mice on the C57BL/6 background were irradiated with two doses of 550 rad with 4-hour intervals. Wild-type (WT; CD45.1) and CD11dKO (CD45.2) derived bone marrow cells (total of 5 × 10⁶ cells) were mixed at the ratio of 1:1 and injected into the tail vein of lethally irradiated recipients. Mice were evaluated for the reconstitution of the immune compartment at various time points after bone marrow transplantation. To prevent bacterial infection, the mice were provided with autoclaved drinking water containing sulfatrim for 1 week prior to and for 4 weeks after irradiation.

The neutrophil phagocytosis was done using Phagotest Kit (Glycotope Biotechnology; Heidelberg, Germany). Mouse neutrophils were incubated in complete RPMI 1640 on ice for 10 min, followed by the addition of FITC-E. Coli. Then the neutrophil suspension was kept on ice as cold control or was put into 37°C water bath for 10 min. At the end of incubation, cells were transferred back on ice, quenched, and washed. Cells were suspended in PBS/1% PFA and measured by BD Accuri C6 (BD Biosciences).

Mouse neutrophils (2 × 10⁵ in 200 µl) were cultured in complete RPMI 1640 at 37°C for 30 min. Dihydrorhodamine-123 (1 µM; Sigma-Aldrich) was added for 5 min at 37°C. Neutrophils were washed once. PMA (100 nM) was added, and the cells were incubated for additional 15 min at 37°C. After one wash, the cells were resuspended in cold PBS with 1% FCS for detection of ROS-induced rhodamine-123 on BD Accuri C6 (BD Biosciences).

Bone marrow neutrophils were subjected to horizontal chemotaxis assay using the EZ-TAXIScan apparatus (Effector Cell Institute; Tokyo, Japan) as previously performed. Neutrophils suspended in RPMI1640 containing 10 mM HEPES, 0.1% BSA and 10 mM EDTA were aligned on one edge of the chemotaxis channel. At the other end, 1 µM N-formylmethionine-leucyl-phenylalanine (fMLP) was injected, creating a gradient along the channel. Pictures were taken every 30 seconds for 20min, and recorded movies were analyzed using FIJI software (National Institute of Health; Bethesda, MD).

Reverse-phase mass spectrometry (MS)-based quantitation technique for eicosanoids was previously described (18). The lipids were extracted with methanol and diluted with water containing 0.1% formic acid to yield a final methanol concentration of 20%. After addition of deuterium-labeled internal standards, the samples were loaded on Oasis HLB cartridge (Waters, Milford, MA). The column was washed with 1 mL of water, 1 mL of 15% methanol, and 1 mL of petroleum ether and then eluted with 0.2 mL of methanol containing 0.1% formic acid. Eicosanoids were quantified by reverse-phase-HPLC-electrospray ionization-tandem MS method.

Blood or lung cells were stained with anti-Ly6G, CD11b, and CD45.2 antibodies. Neutrophils were sorted as Ly6G⁺/CD11b⁺/CD45.2⁺ population. They were subjected to RNA purification using Qiagen RNeasy Plus Mini Kit. RNA samples were quantified using Qubit 2 Fluorometer (Life Technology; Carlsbad, CA) and RNA integrity was checked with Agilent TapeStation (Agilent Technologies; Palo Alto, CA). SMART-Seq v4 Ultra Low Input kit for Sequencing was used for full-length cDNA synthesis and amplification (Clonetech; Mountain View, CA), and Illumina Nextera XT library was used for sequencing library preparation. Briefly, cDNA was fragmented, and adaptor was added using transposase, followed by limited-cycle PCR to enrich and add index to the cDNA fragments. The final library was assessed with Qubit 2.0 Fluorometer and Agilent TapeStation. The sequencing libraries were multiplexed and clustered on one lane of a flowcell. After clustering, the flowcell was loaded on the Illumina HiSeq instrument according to the manufacturer’s instructions. The samples were sequenced using a 2x150 paired end configuration. After investigating the quality of the raw data, sequencing reads were trimmed to remove possible adapter sequences and nucleotides with poor quality using Trimmomatic v.0.36. The trimmed reads were mapped to the mouse reference genome using STAR aligner v.2.5.2b. Only unique reads that fell within exon regions were counted. After extraction of gene hit counts, the gene hit counts table was used. Using DESeq2, a comparison between the groups of samples was performed. The Wald test was used to generate p-value and Log₂ fold changes. Genes with adjusted p-values < 0.05 and absolute log₂ fold change > 1 were called differentially expressed genes. Data are available at GSE215749 (GEO).

CRISPR/Cas9 editing to delete αD (gene: Itgad) expression was done in HL-60 cells as follows. HL-60 cells were cultured at 37°C in RPMI1640 supplemented with 10% FBS, 1% penicillin/streptomycin. Confluency was maintained between 3 x10⁵-1.5x 10⁶/ml. Electroporation was performed one day after passaging when cells were in log phase of growth using the Lonza 4D Nucleofector with 20 µl Nucleocuvette strips as described (19, 20). Briefly, ribonucleoprotein (RNP) complex was made by combining 100 pmol Cas9 (IDT; Newark, NJ) and 100pmol modified sgRNA (Synthego; Redwood City, CA) targeting ITGAD using either sg1 (UUCUUAUCAUGGAUUCAACC) or sg2 (AUGAUAAGAAGCCAGGACUG) and incubating at room temperature for 15 minutes.

2 x10⁵- 4 x 10⁵ HL-60 cells were resuspended in 20 µl SF cell line solution (Lonza; Basel, Switzerland) and were mixed with RNP and underwent nucleofection with program EN-138 as per manufacturer recommendations. Cells were returned to RPMI1640 media and editing efficiency was measured 48 hours after electroporation by polymerase chain reaction (PCR). First, genomic DNA was extracted using the DNeasy kit (Qiagen; Hildgen, Germany) according to the manufacturer’s instructions. Genomic PCR was performed using Platinum II Hotstart Mastermix (Thermo Fischer Scientific), and edited allele frequency was detected by Sanger sequencing and analyzed by ICE (21). The following primer pairs were used: ITGAD (forward: ATGATAAGAAGCCAGGACTG; reverse: CAGTCCTGGCTTCTTATCAT).

Data were analyzed as indicated in the figure legends. Statistical analysis methods were included under each figure legend. Statistical significance was defined as P<0.05. All the statistical calculations were performed using PRISM9 software (GraphPad Software, La Jolla, CA).

Polymicrobial abdominal sepsis induced by CLP surgery is the most frequently used preclinical sepsis model that best recapitulates human sepsis (22, 23). We previously reported that sepsis outcomes of αL KO, αM KO and αX KO mice were worse than that of wild-type (11) mice in this model (5–7). Because blocking β2 integrin as a whole attenuated lung injury (9, 10), we examined the degree of lung injury in mice deficient of each of the β2 integrin members. In line, β2 KO mice had less lung injury following CLP ( Figure 1A ). Histological analysis demonstrated that lung injury was highly induced following sepsis in WT, αL KO, and αM KO mice ( Figure 1A ). In contrast, αD KO mice manifested less histological lung injury ( Figure 1B ). Wet-to-dry and BAL fluid analyses also supported the finding ( Figure 1B ). αD KO mice also showed better survival compared to WT mice ( Figure 1C ), suggesting that αDβ2 may be a good target to attenuate sepsis. We further examined bacterial loads at various organs. Bacterial loads at the lungs, spleen, kidney, and blood were significantly less in αD KO mice ( Figure 1D ), consistent with the survival data. However, bacterial loads at the peritoneal cavity did not show any difference between the two strains ( Figure 1D ). Neutrophils are the first-line defense immune cells critical for bacterial eradication (24). The relationship between neutrophil numbers in the blood, the peritoneal cavity, and the lungs between the two strains correlated with the data of bacterial loads above ( Figure 1E ), suggesting that the difference in neutrophil numbers at various sites was in part responsible for the degree of bacterial clearance. CLP sepsis is a sepsis with mixed bacterial flora. Considering the possibility that the flora between the two strains would not likely be the same., we also examined bacterial clearance in E. coli intraperitoneal injection model. Bacterial loads were significantly less in αD KO mice at 6 hours after an intraperitoneal injection ( Figure 1D ), indicating that integrin αD deficiency might enhance bacterial eradication.

The correlation of the degree of splenic apoptosis with sepsis outcome has been previously described (25–27). Splenic neutrophil and monocyte cell death was significantly less in αD KO mice ( Figure 2A ), consistent with the sepsis outcome data above. However, the degree of cell death was comparable in T and B cells between WT and αD KO mice ( Figure 2A ). The expression of αDβ2 was previously reported on neutrophils and monocytes/macrophages (28). We examined the contribution of neutrophils to CLP sepsis in both WT and αD KO mice by depleting neutrophils using 1A8 antibody. Neutrophil depletion worsened both lung and peritoneal bacterial loads in WT mice, but it significantly worsened only lung bacterial loads in αD KO mice ( Figure 2B ), which would likely be due to the difference in lung bacterial loads after CLP between the two strains. While lung bacterial loads were significantly lower in αD KO mice receiving isotype control compared to WT mice receiving isotype control, they were comparable between WT and αD KO mice subjected to neutrophil depletion.

Although we observed the difference in neutrophil numbers in the lungs between WT and αD KO mice, it is yet to be determined if the result was intrinsically derived from integrin αD. To validate if the result of higher αD KO neutrophil numbers in the lungs is intrinsic, we generated mixed bone marrow chimera to harbor both WT and αD KO mice-derived hematopoietic systems, which were distinguished by congenic markers CD45.1 and CD45.2, respectively. Control mixed chimeras were made by the reconstitution of CD45.1 and CD45.2 WT bone marrow cells ( Figure 2C ). At 12 weeks after bone marrow transplantation, we examined peripheral blood and confirmed the peripheral blood leukocytes were constituted equally by CD45.1 and CD45.2 cells (data not shown). We found that more αD KO derived neutrophils existed in the lungs compared to WT (CD45.1) neutrophils, supporting that the phenotype was intrinsic to αD KO neutrophils ( Figure 2D ). LTB₄ is a major neutrophil chemoattractant. At 6 and 12 hours after CLP in WT and αD KO mice, we observed LTB₄ level was significantly higher in the lungs of αD KO mice ( Figure 2E ). In contrast, peritoneal LTB₄ level was not statistically significant between the strains. We did not see any difference in neutrophil recruitment to neutrophil chemoattractant LTB₄ in vitro ( Figure 2F ), indicating that the difference of numbers between WT and αD KO neutrophils in chimera’ lungs was not driven by chemotaxis. Here we examined the role of αDβ2 in neutrophils using WT and αD KO neutrophils. The level of reactive oxygen species (ROS) production was comparable between WT and αD KO mice ( Figure 2G ), while there was an increased phagocytosis by lung αD KO neutrophils ( Figure 2H ), supporting the result of the E. coli injection model ( Figure 1F ). To examine if higher αD KO neutrophil counts in the lung is explained by neutrophil survival, we also examined the cell death of lung neutrophils. Consistent with the result of splenic neutrophil apoptosis, the cell death of αD KO lung neutrophils was less compared to WT neutrophils ( Figure 2I ), which at least in part explains these results. Taken together, αD KO mice demonstrated a difference in neutrophil phenotypes characterized as less cell death and more efficient phagocytosis in the lungs. Higher lung αD KO neutrophil counts will be likely in part responsible for less neutrophil cell death.

To further characterize αD KO neutrophils, we performed transcriptomic analysis of blood and lung neutrophils. We found only 5 DEGs in blood and 7 DEGs in lung between WT and αD KO mice at the baseline. One DEG was overlapped between blood and lung. This result suggested that the transcriptomic signature of WT and αD KO neutrophils in the blood and lung at the baseline was quite similar ( Figure 3A ). The DEG analysis of αD KO neutrophils at 12 hours post CLP vs at the baseline (time 0h) in blood and lung showed that there was no DEG in lung, suggesting that there was no DEGs in the lung between baseline and 12 hours post-CLP ( Figure 3B ). When we compared lung neutrophils between WT and αD KO mice, we identified 55 upregulated DEGs and 90 upregulated DEGs in αD KO lung neutrophils ( Figure 3C ). Upregulated genes include phagocytosis related genes ( Figure 3D ), and downregulated genes include cell arrest and proliferation genes ( Figure 3E ).

Human neutrophils were previously reported to express αDβ2 (29). To determine the role of αDβ2 in human neutrophils, we performed CRISPR/Cas9 deletion of αD in HL-60 cells. Expression of αD was confirmed by flow cytometry ( Figure 4A ).

Phagocytosis, ROS, and apoptosis were examined. We found that phagocytosis was significantly enhanced in αD KO HL-60 cells compared to the control ( Figure 4B ). No difference in ROS was observed ( Figure 4C ). Cell death was attenuated in αD KO HL-60 cells ( Figure 4D ). This is consistent with the findings in murine experiment, indicating the relevance of our findings in human.