The experimental protocol was approved by the ethics committee of La Paz University Hospital (Madrid, Spain), and written informed consent was obtained from the family for participation in this study.

Genomic DNA was extracted from whole blood with a kit (Qiagen GmbH, Hilden, Germany), according to the manufacturer’s instructions. Whole-exome sequencing (WES) was performed on genomic DNA from whole blood. The libraries were sequenced on an Illumina sequencing platform (mean coverage >80 to 100X).

WES results were validated by polymerase chain reaction (PCR)/Sanger sequencing analysis on genomic DNA from whole blood. PCR was performed with PCR Master Mix (Promega, Fitchburg, WI, USA) and the GeneAmp 9700 PCR System (Applied Biosystems, Foster City, California, USA). The following primer sequences were employed for the genomic coding region of BCL10.

Forward primers (FP): 1F, TCCTCTCCTTCTTCCCCATT; 2F, GCCTGAGCCTCCTGACTTTA; 3F, GATTTGAAATAGATTATGACGGAAA.

Reverse primers (RP): 1R, AGCTCTGCGTTTAGCGATGT; 2R, GGCTGGTCTCAAAACTCCTG; 3R, AAACAAATGATTACAGCCATTTTA.

The PCR products were purified with ExoSAP-IT PCR Product Cleanup Reagent (Applied Biosystems) and sequenced with the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems). Sequencing products were purified by precipitating in 70% ethanol, and the sequences were analyzed with an ABI Prism 3700 Genetic Analyser (Applied Biosystems).

Human PBMCs were isolated by Ficoll-Hypaque density gradient centrifugation (Amersham-Pharmacia-Biotech, Buckinghamshire, UK) from whole-blood samples obtained from the patient, parents, siblings, and healthy volunteers, and total cell extracts were prepared. Equal amounts of protein from each sample were separated by SDS-PAGE and blotted onto iBlot Gel Transfer Stacks (Invitrogen, Carlsbad, California, USA). These nitrocellulose membranes were then probed with anti-BCL10 rabbit mAb (ab108328, Abcam, Cambridge, MA, USA), followed by a secondary anti-rabbit IgG-HRP linked antibody (Cell Signaling, Beverly, MA, USA). Membranes were stripped and re-probed with an antibody against GADPH (Abcam) as a loading control. Antibody binding was detected by enhanced chemiluminescence (ECL; Amersham-Pharmacia-Biotech).

We investigated a female patient of consanguineous parents from Saudi Arabia. She presented at one year of age with fever and bacterial pneumonia that required hospitalization. Her immune workup was suggestive of hypogammaglobulinemia and lymphocytosis (see supplementary material and Table S1 for detailed clinical history). Furthermore, she had a sister who died at 12 months of age due to a severe chest infection. These observations were compatible with a PID, and she underwent WES. WES revealed a homozygous nonsense mutation (A/T) affecting the nucleotide position g.85270779 (GRCh38.p12) of exon 2 of the gene encoding BCL10 in genomic DNA (gDNA) extracted from leukocytes (g. 85270779A>T). This mutation affects the lysine at position 63 and generates a premature stop codon (c.187A>T, p.K63X). The mutation K63X has not been reported in public databases such as ExAC or gnomAD, suggesting that it is private to this kindred. All other family members tested were healthy and heterozygous for the mutation ( Figures 1A, B ). We then assessed BCL10 expression in PBMC from the patient, healthy controls, and heterozygous carriers. No BCL10 protein was detected in PBMCs from the patient, but BCL10 was detectable in the heterozygous carrier and a healthy donor ( Figure 1C ). Our results indicated that this patient has a BCL10 complete deficiency hence, we will refer to her as P3 since she is the third BCL10 deficient patient described to date (29, 30).

We previously reported that human BCL10 is critical for the proper development and function of hematopoietic and non-hematopoietic lineages (29). The paucity of patients with BCL10 deficiency and the limited amount of samples obtained from these patients due to the severity of their disease hindered our capacity to survey the consequences of the absence of BCL10 in the overall composition of circulating leukocytes. Furthermore, the low number of individuals reported with deleterious heterozygous variants in BCL10 prevented us from assessing the consequences of BCL10 gene dosage in leukocyte development and function. The samples obtained from P3, her five healthy heterozygous carrier relatives, and the advent of mass cytometry provided the tools to tackle these issues. We performed in-depth immunophenotyping of the patient, healthy heterozygous carriers, and healthy controls using mass cytometry and a cocktail of 33 antibodies directed against surface markers designed to identify most of the common leukocyte populations as well as some rare populations ( Table S2 ). Visualization using dimensionality reduction with the t-SNE algorithm revealed marked differences in the distribution of leukocyte populations when comparing a healthy control and heterozygote carrier with the patient ( Figures 2A –C ). Of the subpopulations identified by unsupervised clustering followed by manual clustering ( Figures 2A –C ), mucosal-associated invariant T cells (MAIT), γδT and natural killer (NK) cells showed a reduction in the patient when compared with healthy controls and heterozygous carriers ( Figure 2D ). This reduction in leukocyte subpopulations is further confirmed by manual gating ( Figures 2E and Figure S2 ). Considering that the patient was 1.5 years of age at the time of blood draw and the frequencies of MAIT cells at that age range from 0 to 3% of PBMCs, we cannot conclude that the reduction observed in the patient in BCL10 dependent (35). These results suggest that BCL10 deficiency causes changes in the leukocyte population distribution otherwise not seen in healthy individuals. Despite the frequencies of CD4⁺, CD8⁺, B cells, and myeloid cells in the patients falling within normal ranges when compared with healthy controls ( Figure 2D ), the distribution of cells within each of these populations differs in a genotype-dependent manner, suggesting a subtler difference in their subpopulations ( Figures 2A, B ). To further characterize these differences, we reclustered each of these populations and performed an unbiased computational analysis.

BCL10 is located downstream of the B-cell receptor (BCR). Upon BCR activation, the LYN kinase phosphorylates the immunoreceptor tyrosine-based activation motifs (ITAMS). These events initiate a molecular cascade that culminates in the activation of PI3K and a phospholipase called PLCγ2. This molecule mediates the formation of diglycerol (DAG) as a second messenger to activate protein kinase C, which will act on CARD11 and promote the formation of the CBM complex. The formation of the CBM complex leads to the activation of the IκB complex kinase (IKK) complex, which will result in the activation of NF-κB (2). Unsupervised clustering in the B cells from Figure 2 identified two major populations ( Figure 3A ). The frequency of cluster 2 in the patient was severely reduced compared to healthy controls and heterozygous carriers ( Figure 3B ). We used marker enrichment modelling (MEM) to study these two clusters (34). By using machine learning, MEM identifies the markers that distinguish each population allowing for an unbiased characterization of populations. This analysis showed that cluster 1 is characterized by the expression of IgD and CD38 and cluster 2 by CD27, CD24, and CD25 ( Figure 3C ). These markers are consistent with cluster 1 corresponding to naïve B cells and cluster 2 corresponding to memory B cells (36, 37). We confirmed this observation by manual gating and observed that the patient has few detectable double negative or switched memory B cells, but naïve and unswitched compartments comparable to healthy control and heterozygous carriers ( Figures 3D, E ). Our findings and previous reports of BCL10 deficient patients (29, 30) support the critical role of BCL10 in human BCR-dependent signaling and memory B cell generation.

We and others have shown that BCL10 is critical for TCR-mediated T cell activation in humans (29). Upon TCR activation, lymphocyte-specific tyrosine kinase phosphorylates ITAMs leading to the activation of PI3K and the phospholipase PLCγ1. As is the case for B cells, these signalling events culminate in the formation of the CBM complex, which will end in the translocation of NF-κB into the nucleus and promote cell proliferation. We studied the consequences of defective TCR-dependent signaling caused by the absence of BCL10 in the composition of the T cell compartment (2). We analyzed CD4⁺ and CD8⁺ T cells (identified in Figure 2 ) separately. By unsupervised clustering of the CD4⁺ cells, we observed three major cell populations ( Figure 4A ). Population 2 and 3 were severely reduced in the patient compared to healthy controls and heterozygous carriers ( Figure 4B ). MEM analysis showed that cluster 1 is characterized by CD27, CCR7, CD45A, and CD38 while cells from cluster 2 express high levels of CD27, CD45RO, CCR7, CXCR3, and CD25, and cluster 3 is characterized by CD45RO expression. This differential marker expression is compatible with cluster 1 corresponding to naïve CD4⁺ T cells and clusters 3 and 4 with memory CD4⁺ T cells ( Figure 4C ). We studied the CD4⁺ memory and naïve compartments by manual gating ( Figures 4D, E ). This analysis showed reduced central memory (CM), effector memory (EM), and TEMRA CD4⁺ T cell compartments with an increased naïve CD4⁺ T cell compartment in the patient when compared to the healthy controls or heterozygous carriers. Furthermore, by manual gating, we also observed a reduction in the frequency of Tregs and T_FH in the patient ( Figure S2 ). These results suggest that BCL10 is necessary for the differentiation from naïve to memory in CD4⁺ T cells.

Similarly, unsupervised clustering of the CD8⁺ T cell population rendered three major clusters, two of which were almost absent in the patient compared to the healthy controls and heterozygous carriers ( Figures 5A, B ). Marker characterization by MEM showed that cluster 1 expressed markers characteristic of naïve CD8⁺ T cells such as CD45RA and CCR7. In contrast, clusters 2 and 3 were characterized by the expression of the central memory and effector memory markers (CD45RO, CD127) (38) and TEMRA markers (CD45RA), respectively ( Figure 5C ). We studied the naïve and memory CD8⁺ T cell compartment by manual gating. Similar to our observations in CD4⁺ T cells, we observed an increased naïve CD8⁺ T cell population in the patient compared to the healthy controls or heterozygous carriers. We also observed decreased frequencies of central memory, effector memory, and TEMRA CD8⁺ T cells in P3 ( Figures 5D, E ). The absence of these populations in the patient suggests that BCL10 is necessary for the development of memory CD8⁺ T cells and confirms our previous results (29, 30). As in B cell analysis, we did not observe any difference in the samples from heterozygous carriers compared to healthy controls, suggesting that haploinsufficiency for BCL10 is immunologically silent.

Mouse studies have shown that BCL10 is critical for NF-κB activation in myeloid cells. This is mediated by the TLR4, TLR2, and TRL6 pathways, which are BCL10 dependent (39–42). Our previous results showed that in humans, BCL10 is redundant for NF-κB activation in these cells (29). We performed unsupervised clustering in the myeloid cluster from Figure 2 . We studied 10 clusters and observed that the frequencies of these clusters were comparable between healthy controls, heterozygous carriers, and P3 ( Figure S3 ). By manual gating, we showed that the frequencies of non-classical monocytes, classical monocytes, intermediate monocytes, myeloid dendritic cells, and plasmacytoid dendritic cells were comparable between healthy controls, heterozygous carriers, and P3 confirming the redundant role of human BCL10 in the development of cells from the myeloid lineage ( Figure S2 ).

P3 had a clinical presentation consistent with the previous two reported BCL10-deficient patients (29, 30) with respect to her bacterial lung infection (supplementary note 1: case report). She had a sister who died at the age of 15 months due to disseminated BCGitis and bacterial sepsis. She did not develop any gastrointestinal manifestations, and her clinical course was cured by HSCT.