<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Immunol.</journal-id>
<journal-title>Frontiers in Immunology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Immunol.</abbrev-journal-title>
<issn pub-type="epub">1664-3224</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fimmu.2021.757909</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Immunology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>
<italic>Salmonella</italic> Infantis Delays the Death of Infected Epithelial Cells to Aggravate Bacterial Load by Intermittent Phosphorylation of Akt With <italic>SopB</italic>
</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Chu</surname>
<given-names>Bing-Xin</given-names>
</name>
<uri xlink:href="https://loop.frontiersin.org/people/1350746"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Li</surname>
<given-names>Ya-Nan</given-names>
</name>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Liu</surname>
<given-names>Ning-</given-names>
</name>
<uri xlink:href="https://loop.frontiersin.org/people/1350757"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Yuan</surname>
<given-names>Lan-Xin</given-names>
</name>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Chen</surname>
<given-names>Shi-Yan</given-names>
</name>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhu</surname>
<given-names>Yao-Hong</given-names>
</name>
<uri xlink:href="https://loop.frontiersin.org/people/433114"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Wang</surname>
<given-names>Jiu-Feng</given-names>
</name>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/110306"/>
</contrib>
</contrib-group>
<aff id="aff1">
<institution>Department of Veterinary Clinical Sciences, College of Veterinary Medicine, China Agricultural University</institution>, <addr-line>Beijing</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Mario Alberto Flores-Valdez, Centro de Investigaci&#xf3;n y Asistencia en Tecnolog&#xed;a y Dise&#xf1;o del Estado de Jalisco (CIATEJ), Mexico</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Felix Ngosa Toka, Ross University School of Veterinary Medicine, Saint Kitts and Nevis; Kendal Galbraith Cooper, Rocky Mountain Laboratories (NIAID), United States</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Jiu-Feng Wang, <email xlink:href="mailto:jiufeng_wang@hotmail.com">jiufeng_wang@hotmail.com</email>
</p>
</fn>
<fn fn-type="other" id="fn002">
<p>This article was submitted to Microbial Immunology, a section of the journal Frontiers in Immunology</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>05</day>
<month>11</month>
<year>2021</year>
</pub-date>
<pub-date pub-type="collection">
<year>2021</year>
</pub-date>
<volume>12</volume>
<elocation-id>757909</elocation-id>
<history>
<date date-type="received">
<day>13</day>
<month>08</month>
<year>2021</year>
</date>
<date date-type="accepted">
<day>19</day>
<month>10</month>
<year>2021</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2021 Chu, Li, Liu, Yuan, Chen, Zhu and Wang</copyright-statement>
<copyright-year>2021</copyright-year>
<copyright-holder>Chu, Li, Liu, Yuan, Chen, Zhu and Wang</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>
<italic>Salmonella</italic> Infantis has emerged as a major clinical pathogen causing gastroenteritis worldwide in recent years. As an intracellular pathogen, <italic>Salmonella</italic> has evolved to manipulate and benefit from the cell death signaling pathway. In this study, we discovered that <italic>S</italic>. Infantis inhibited apoptosis of infected Caco-2 cells by phosphorylating Akt. Notably, Akt phosphorylation was observed in a discontinuous manner: immediately 0.5&#xa0;h after the invasion, then before peak cytosolic replication. Single-cell analysis revealed that the second phase was only induced by cytosolic hyper-replicating bacteria at 3&#x2013;4 hpi. Next, Akt-mediated apoptosis inhibition was found to be initiated by <italic>Salmonella SopB.</italic> Furthermore, Akt phosphorylation increased mitochondrial localization of Bcl-2 to prevent Bax oligomerization on the mitochondrial membrane, maintaining the mitochondrial network homeostasis to resist apoptosis. In addition, <italic>S</italic>. Infantis induced pyroptosis, as evidenced by increased caspase-1 (p10) and GSDMS-N levels. In contrast, cells infected with the &#x394;<italic>SopB</italic> strain displayed faster but less severe pyroptosis and had less bacterial load. The results indicated that <italic>S</italic>. Infantis <italic>SopB</italic>&#x2013;mediated Akt phosphorylation delayed pyroptosis, but aggravated its severity. The wild-type strain also caused more severe diarrhea and intestinal inflammatory damage than the &#x394;<italic>SopB</italic> strain in mice. These findings revealed that <italic>S</italic>. Infantis delayed the cells&#x2019; death by intermittent activation of Akt, allowing sufficient time for replication, thereby causing more severe inflammation.</p>
</abstract>
<kwd-group>
<kwd>
<italic>Salmonella</italic> Infantis</kwd>
<kwd>Akt</kwd>
<kwd>
<italic>SopB</italic>
</kwd>
<kwd>apoptosis</kwd>
<kwd>pyroptosis</kwd>
<kwd>inflammation</kwd>
<kwd>host-pathogen interactions</kwd>
</kwd-group>
<counts>
<fig-count count="6"/>
<table-count count="3"/>
<equation-count count="0"/>
<ref-count count="41"/>
<page-count count="14"/>
<word-count count="7022"/>
</counts>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<title>Introduction</title>
<p>For decades, non-typhoidal salmonella (NTS) has been one of the most common foodborne zoonosis pathogens worldwide that cause host gastroenteritis. There are more than 2,600 known <italic>Salmonella enterica</italic> serovars, with <italic>Salmonella enterica</italic> serovar Infantis (<italic>S</italic>. Infantis) the third most prevalent serovar of human NTS infections in Europe (<xref ref-type="bibr" rid="B1">1</xref>, <xref ref-type="bibr" rid="B2">2</xref>). It is mainly transmitted through contaminated food, such as broiler chicken and pork (<xref ref-type="bibr" rid="B3">3</xref>&#x2013;<xref ref-type="bibr" rid="B5">5</xref>). Worryingly, <italic>S</italic>. Infantis infection has been frequently reported in many countries recently, indicating that <italic>S</italic>. Infantis is an emerging pathogen causing gastroenteritis worldwide (<xref ref-type="bibr" rid="B6">6</xref>, <xref ref-type="bibr" rid="B7">7</xref>).</p>
<p>
<italic>Salmonella</italic> is a Gram-negative facultative intracellular pathogen that possesses two functionally distinct T3SSs (T3SS1 and T3SS2) encoded in <italic>Salmonella</italic> pathogenicity islands 1 and 2&#xa0;(SPI1 and SPI2), respectively (<xref ref-type="bibr" rid="B8">8</xref>). In epithelial cells, approximately 10&#x2013;30% of <italic>Salmonella</italic> can escape from the <italic>Salmonella</italic>-containing vacuole (SCV) to the cytoplasm after internalization and replicate there (<xref ref-type="bibr" rid="B9">9</xref>). Cytosolic <italic>Salmonella</italic> proliferates faster than SCV bacteria, a phenomenon known as hyper-replication (defined as &gt;20 bacteria/cell) (<xref ref-type="bibr" rid="B10">10</xref>, <xref ref-type="bibr" rid="B11">11</xref>). Hyper-replicating <italic>Salmonella</italic> proliferates geometrically within several hours in host cells, causing cell death and extrusion and releasing invasive bacteria into the gastrointestinal tract (<xref ref-type="bibr" rid="B11">11</xref>).</p>
<p>
<italic>Salmonella</italic> appears to have evolved to benefit from host cell signaling pathways involved in regulating cell proliferation and death (<xref ref-type="bibr" rid="B12">12</xref>&#x2013;<xref ref-type="bibr" rid="B14">14</xref>). Apoptosis is a highly conserved and gene-regulated physiological programmed cell death mechanism. An increasing body of evidence indicated that the pathogenic mechanism of bacteria involves the regulation of apoptosis. The manipulation of apoptosis by <italic>Salmonella</italic> depends on the type of host cell and the stage of infection. Multiple apoptotic pathways are found to be rapidly activated during <italic>Salmonella</italic> infection of macrophages (<xref ref-type="bibr" rid="B15">15</xref>&#x2013;<xref ref-type="bibr" rid="B17">17</xref>). In contrast, the apoptosis of infected epithelial cells is inhibited by <italic>Salmonella</italic> (<xref ref-type="bibr" rid="B18">18</xref>&#x2013;<xref ref-type="bibr" rid="B20">20</xref>). It is beneficial for <italic>Salmonella</italic> to prolong the lifespan of infected cells, enabling bacteria to gain sufficient time for intracellular replication. <italic>Salmonella</italic> then induces the assembly of inflammasomes when the intracellular bacterial load increases (<xref ref-type="bibr" rid="B11">11</xref>, <xref ref-type="bibr" rid="B13">13</xref>). Caspase-1 is subsequently activated, which converts gasdermin D (GSDMD) and the precursors of IL-1&#x3b2; and IL-18 to their active forms. The N-terminal fragment of GSDMD accumulates on the cell membrane, forming a polymeric pore and inducing pyroptosis, which results in the release of the intracellular bacteria and inflammatory cytokines, all of which contribute to inflammation (<xref ref-type="bibr" rid="B21">21</xref>&#x2013;<xref ref-type="bibr" rid="B23">23</xref>). During an enteric infection, the induction of inflammation may be conducive to the spread of <italic>Salmonella</italic> in the gastrointestinal tract through the induction of rapid inflammatory pyroptosis. <italic>Salmonella</italic> can effectively escape from infected host cells, infect adjacent normal cells, and eliminate host immunocytes, leading to a weakened immune response (<xref ref-type="bibr" rid="B24">24</xref>).</p>
<p>In the battle between the host and <italic>Salmonella</italic>, two pivotal biological processes that occur are apoptosis and pyroptosis. For <italic>Salmonella</italic>, the regulation of cell death is also dependent on the serotype. Interestingly, <italic>Salmonella</italic> Typhi can replicate in macrophages without inducing cytotoxicity, while <italic>Salmonella</italic> Typhimurium causes severe cytotoxicity in macrophages (<xref ref-type="bibr" rid="B25">25</xref>). Most studies have focused on the interaction between <italic>S</italic>. Typhimurium and macrophages or other phagocytes, and little is known about the role of programmed cell death in controlling the pathogenesis of <italic>S</italic>. Infantis in epithelial cells. Furthermore, intestinal epithelial cells represent the first point of contact for <italic>Salmonella</italic> with the host after invasion (<xref ref-type="bibr" rid="B20">20</xref>, <xref ref-type="bibr" rid="B26">26</xref>). In addition, there are significant differences in SPI-1 expression between <italic>S</italic>. Infantis and <italic>S</italic>. Typhimurium (<xref ref-type="bibr" rid="B27">27</xref>). In this study, we revealed that cytosolic <italic>S</italic>. Infantis phosphorylated Akt in a discontinuous manner through <italic>SopB</italic> to delay apoptosis and pyroptosis in infected Caco-2 cells. <italic>S</italic>. Infantis gained sufficient time to proliferate by prolonging the lifespan of infected cells, eventually causing pyroptosis, which was accompanied by the release of inflammatory factors and bacteria. This created favorable conditions for the spread and infection of <italic>S</italic>. Infantis.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<title>Materials and Methods</title>
<sec id="s2_1">
<title>Reagents and Antibodies</title>
<p>The reagents and antibodies used in the study are shown in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Reagents and antibodies.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Reagents and antibodies</th>
<th valign="top" align="center">Catalog number</th>
<th valign="top" align="center">Company/Brand</th>
<th valign="top" align="center">Origin</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">Mito-Tracker Red CMXRos</td>
<td valign="top" align="center">C1035</td>
<td valign="top" align="left">Beyotime Biotechnology</td>
<td valign="top" align="left">Shanghai, China</td>
</tr>
<tr>
<td valign="top" align="left">Hoechst 33342</td>
<td valign="top" align="center">C1025</td>
<td valign="top" align="left">Beyotime Biotechnology</td>
<td valign="top" align="left">Shanghai, China</td>
</tr>
<tr>
<td valign="top" align="left">SC79</td>
<td valign="top" align="center">SF2730</td>
<td valign="top" align="left">Beyotime Biotechnology</td>
<td valign="top" align="left">Shanghai, China</td>
</tr>
<tr>
<td valign="top" align="left">MK2206</td>
<td valign="top" align="center">SF2712</td>
<td valign="top" align="left">Beyotime Biotechnology</td>
<td valign="top" align="left">Shanghai, China</td>
</tr>
<tr>
<td valign="top" align="left">Cell Mitochondria Isolation Kit</td>
<td valign="top" align="center">C3601</td>
<td valign="top" align="left">Beyotime Biotechnology</td>
<td valign="top" align="left">Shanghai, China</td>
</tr>
<tr>
<td valign="top" align="left">Enhanced Cell Counting Kit-8</td>
<td valign="top" align="center">C0042</td>
<td valign="top" align="left">Beyotime Biotechnology</td>
<td valign="top" align="left">Shanghai, China</td>
</tr>
<tr>
<td valign="top" align="left">Alexa Fluor 488-labeled Goat Anti-Rabbit lgG(H+L)</td>
<td valign="top" align="center">A0423</td>
<td valign="top" align="left">Beyotime Biotechnology</td>
<td valign="top" align="left">Shanghai, China</td>
</tr>
<tr>
<td valign="top" align="left">4&#x2019;,6&#x2019;-diamidino-2-phenylindole (DAPI) solution</td>
<td valign="top" align="center">C0060</td>
<td valign="top" align="left">Beijing Solarbio Science &amp; Technology Co., Ltd.</td>
<td valign="top" align="left">Beijing, China</td>
</tr>
<tr>
<td valign="top" align="left">Calcein-AM/PI</td>
<td valign="top" align="center">CA1630</td>
<td valign="top" align="left">Beijing Solarbio Science &amp; Technology Co., Ltd.</td>
<td valign="top" align="left">Beijing, China</td>
</tr>
<tr>
<td valign="top" align="left">Gentamycin Sulfate</td>
<td valign="top" align="center">G8170</td>
<td valign="top" align="left">Beijing Solarbio Science &amp; Technology Co., Ltd.</td>
<td valign="top" align="left">Beijing, China</td>
</tr>
<tr>
<td valign="top" align="left">Carbonyl cyanide 3-chlorophenylhydrazone (CCCP)</td>
<td valign="top" align="center">C6700</td>
<td valign="top" align="left">Beijing Solarbio Science &amp; Technology Co., Ltd.</td>
<td valign="top" align="left">Beijing, China</td>
</tr>
<tr>
<td valign="top" align="left">Chlorquine diphosphate salt</td>
<td valign="top" align="center">C6628</td>
<td valign="top" align="left">Sigma-Aldrich</td>
<td valign="top" align="left">St. Louis, USA</td>
</tr>
<tr>
<td valign="top" align="left">Triton X-100</td>
<td valign="top" align="center">T8787</td>
<td valign="top" align="left">Sigma-Aldrich</td>
<td valign="top" align="left">St. Louis, USA</td>
</tr>
<tr>
<td valign="top" align="left">Dulbecco&#x2019;s Modified Eagle Medium (DMEM)/High Glucose</td>
<td valign="top" align="center">SH30022.01</td>
<td valign="top" align="left">GE Healthcare Life Sciences HyClone Laboratories</td>
<td valign="top" align="left">Utah, USA</td>
</tr>
<tr>
<td valign="top" align="left">Phosphate buffered saline (PBS)</td>
<td valign="top" align="center">SH30256.01</td>
<td valign="top" align="left">GE Healthcare Life Sciences HyClone Laboratories</td>
<td valign="top" align="left">Utah, USA</td>
</tr>
<tr>
<td valign="top" align="left">Fetal bovine serum (FBS)</td>
<td valign="top" align="center">10099141</td>
<td valign="top" align="left">Thermo Fisher Scientific</td>
<td valign="top" align="left">Rockford, USA</td>
</tr>
<tr>
<td valign="top" align="left">Annexin V-PE/7-AAD Apoptosis Detection Kit</td>
<td valign="top" align="center">A213</td>
<td valign="top" align="left">Vazyme Biotech Co., Ltd</td>
<td valign="top" align="left">Jiangsu, China</td>
</tr>
<tr>
<td valign="top" align="left">TUNEL FITC Apoptosis Detection Kit</td>
<td valign="top" align="center">A111-01</td>
<td valign="top" align="left">Vazyme Biotech Co., Ltd</td>
<td valign="top" align="left">Jiangsu, China</td>
</tr>
<tr>
<td valign="top" align="left">Rabbit Anti-LAMP 1 polyclonal antibody</td>
<td valign="top" align="center">21997-1-AP</td>
<td valign="top" align="left">Proteintech Group Inc</td>
<td valign="top" align="left">Rosemont, USA</td>
</tr>
<tr>
<td valign="top" align="left">Rabbit Anti-Occludin polyclonal antibody</td>
<td valign="top" align="center">27260-1-AP</td>
<td valign="top" align="left">Proteintech Group Inc</td>
<td valign="top" align="left">Rosemont, USA</td>
</tr>
<tr>
<td valign="top" align="left">Rabbit Anti-Claudin-1 polyclonal antibody</td>
<td valign="top" align="center">13050-1-AP</td>
<td valign="top" align="left">Proteintech Group Inc</td>
<td valign="top" align="left">Rosemont, USA</td>
</tr>
<tr>
<td valign="top" align="left">Rabbit Anti-Caspase 9/p35/p10 polyclonal antibody</td>
<td valign="top" align="center">10380-1-AP</td>
<td valign="top" align="left">Proteintech Group Inc</td>
<td valign="top" align="left">Rosemont, USA</td>
</tr>
<tr>
<td valign="top" align="left">Rabbit Anti-Bax polyclonal antibody</td>
<td valign="top" align="center">50599-2-Ig</td>
<td valign="top" align="left">Proteintech Group Inc</td>
<td valign="top" align="left">Rosemont, USA</td>
</tr>
<tr>
<td valign="top" align="left">Rabbit Anti-Bcl-2 polyclonal antibody</td>
<td valign="top" align="center">12789-1-AP</td>
<td valign="top" align="left">Proteintech Group Inc</td>
<td valign="top" align="left">Rosemont, USA</td>
</tr>
<tr>
<td valign="top" align="left">Rabbit Anti-VDAC1 polyclonal antibody</td>
<td valign="top" align="center">55259-1-AP</td>
<td valign="top" align="left">Proteintech Group Inc</td>
<td valign="top" align="left">Rosemont, USA</td>
</tr>
<tr>
<td valign="top" align="left">Rabbit Anti-Phospho-Caspase-9 (Ser196) polyclonal antibody</td>
<td valign="top" align="center">28794-1-AP</td>
<td valign="top" align="left">Proteintech Group Inc</td>
<td valign="top" align="left">Rosemont, USA</td>
</tr>
<tr>
<td valign="top" align="left">Rabbit Anti-Cytochrome c monoclonal antibody</td>
<td valign="top" align="center">66264-1-Ig</td>
<td valign="top" align="left">Proteintech Group Inc</td>
<td valign="top" align="left">Rosemont, USA</td>
</tr>
<tr>
<td valign="top" align="left">Mouse Anti-Beta ACTIN monoclonal antibody</td>
<td valign="top" align="center">60008-1-lg</td>
<td valign="top" align="left">Proteintech Group Inc</td>
<td valign="top" align="left">Rosemont, USA</td>
</tr>
<tr>
<td valign="top" align="left">HRP-conjugated Affinipure Goat Anti-Rabbit IgG(H+L)</td>
<td valign="top" align="center">SA00001-2</td>
<td valign="top" align="left">Proteintech Group Inc</td>
<td valign="top" align="left">Rosemont, USA</td>
</tr>
<tr>
<td valign="top" align="left">HRP-conjugated Affinipure Goat Anti-Mouse IgG(H+L)</td>
<td valign="top" align="center">SA00001-1</td>
<td valign="top" align="left">Proteintech Group Inc</td>
<td valign="top" align="left">Rosemont, USA</td>
</tr>
<tr>
<td valign="top" align="left">Rabbit Anti-Cleaved Caspase-3 monoclonal antibody</td>
<td valign="top" align="center">9661T</td>
<td valign="top" align="left">Cell Signaling Technology</td>
<td valign="top" align="left">Danvers, USA</td>
</tr>
<tr>
<td valign="top" align="left">Mouse Anti-Cleaved PARP monoclonal antibody</td>
<td valign="top" align="center">9548T</td>
<td valign="top" align="left">Cell Signaling Technology</td>
<td valign="top" align="left">Danvers, USA</td>
</tr>
<tr>
<td valign="top" align="left">Rabbit Anti-Phospho-Akt (Ser473) monoclonal antibody</td>
<td valign="top" align="center">4060T</td>
<td valign="top" align="left">Cell Signaling Technology</td>
<td valign="top" align="left">Danvers, USA</td>
</tr>
<tr>
<td valign="top" align="left">Rabbit Anti-Phospho-Akt (Thr308) monoclonal antibody</td>
<td valign="top" align="center">13038T</td>
<td valign="top" align="left">Cell Signaling Technology</td>
<td valign="top" align="left">Danvers, USA</td>
</tr>
<tr>
<td valign="top" align="left">Rabbit Anti- Caspase-1 monoclonal antibody</td>
<td valign="top" align="center">24232S</td>
<td valign="top" align="left">Cell Signaling Technology</td>
<td valign="top" align="left">Danvers, USA</td>
</tr>
<tr>
<td valign="top" align="left">Rabbit Anti-ZO-1 polyclonal antibody</td>
<td valign="top" align="center">40-2300</td>
<td valign="top" align="left">Thermo Fisher Scientific</td>
<td valign="top" align="left">Rockford, USA</td>
</tr>
<tr>
<td valign="top" align="left">Rabbit Anti-Phospho-Bad (Ser136) polyclonal antibody</td>
<td valign="top" align="center">ab15098</td>
<td valign="top" align="left">Abcam</td>
<td valign="top" align="left">Cambridge, UK</td>
</tr>
<tr>
<td valign="top" align="left">Rabbit Anti GSDMD-N monoclonal antibody</td>
<td valign="top" align="center">ab215203</td>
<td valign="top" align="left">Abcam</td>
<td valign="top" align="left">Cambridge, UK</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_2">
<title>Bacterial Strains</title>
<p>The <italic>S</italic>. Infantis wild-type strain CAU1508 was isolated from the intestinal contents of diarrhea piglets. <italic>S</italic>. Infantis with the pFPV-mCherry plasmid has been previously described (<xref ref-type="bibr" rid="B12">12</xref>). The <italic>SopB</italic> mutant strain was derived from the parental <italic>S</italic>. Infantis wild-type strain CAU1508 and constructed using the &#x3bb;-Red homologous recombination system.</p>
</sec>
<sec id="s2_3">
<title>Host Cell Infection and Enumeration of Intracellular Bacteria</title>
<p>Caco-2 cells were purchased from Kunming Cell Bank of Chinese Academy of Sciences. The Caco-2 cells were cultured in DMEM/High Glucose media supplemented with 10% FBS and 1% penicillin streptomycin at 37&#xb0;C in a 5% CO<sub>2</sub> incubator. Cells were seeded in six-well (1&#xd7;10<sup>6</sup> cells per well) or 24-well culture plates (1&#xd7;10<sup>5</sup> cells per well) and infected when the cell density reached 60% (this is to ensure that bacteria can infect as many cells as possible). <italic>Salmonella</italic> was grown in LB medium overnight with shaking at 200 rpm and 37&#xb0;C, then subcultured in 10&#xa0;ml fresh LB medium (1:40) with shaking under the same conditions for 4&#xa0;h. Following that, the bacteria were centrifuged at 4,000 g for 15&#xa0;min at room temperature and resuspended in PBS. The entire infection was according to the experimental procedure of the gentamicin protection assay. The monolayers were infected at an MOI of ~50 for 15&#xa0;min and washed three times with PBS supplemented with gentamicin (100 &#x3bc;g/ml) to remove extracellular bacteria. Cells were then incubated in fresh growth medium containing gentamicin (100 mg/ml) for 2&#xa0;h, followed by growth medium supplemented with gentamicin (10 &#x3bc;g/ml) until the infection was complete. After 15&#xa0;min of <italic>Salmonella</italic> invasion, the time was 0 hpi (hours post-infection), and the infection lasted for 8&#xa0;h in total. For groups that required treatment with MK2206 (1 &#x3bc;M) and SC79 (25 &#x3bc;M), both drugs were added 2&#xa0;h before infection, and their concentrations remained unchanged in the medium until the end of the experiment. For the positive control of apoptosis, cells treated with CCCP (Carbonyl cyanide 3-chlorophenylhydrazone, an apoptosis inducer, 50 &#x3bc;M) for 1&#xa0;h before other experiments were carried out (immunoblotting or immunofluorescence).</p>
</sec>
<sec id="s2_4">
<title>Cell Viability Assay</title>
<p>Cell viability was determined using the Cell Counting Kit-8. Cells were seeded in 96-well culture plates. At the end of each treatment, the medium was removed and replaced with 100 &#x3bc;l medium containing 10 &#x3bc;l fresh CCK-8 solution, then incubated at 37&#xb0;C for 2&#xa0;h. Following that, absorbance was measured at 450 nm. Experiments were performed six times on each group to ensure the authenticity of the results.</p>
</sec>
<sec id="s2_5">
<title>Enumeration of Intracellular Bacteria</title>
<p>In order to quantify viable intracellular bacteria, monolayers in six-well plates were washed three times with PBS containing gentamicin (100 mg/ml) for 5&#xa0;min each time before being lysed in 1&#xa0;ml of 0.3% (v/v) Triton X-100. Serial dilutions were plated on LB agar plates. For quantification of intracellular cytosolic bacteria, cells were co-incubated with media containing chloroquine (700 &#x3bc;M) for 1&#xa0;h before being solubilized in 1&#xa0;ml of 1% (v/v) Triton X-100, then plated on LB agar plates.</p>
</sec>
<sec id="s2_6">
<title>Apoptosis Assay</title>
<p>After <italic>Salmonella</italic> infection, Caco-2 cells were collected, washed twice with PBS, suspended in 100 &#x3bc;l 1&#xd7; binding buffer, and stained with the Annexin V-PE/7-AAD Apoptosis Detection Kit.&#xa0;Next, 5 &#x3bc;l each of Annexin V-PE and 7-ADD were added to each sample and incubated in the dark for 15&#xa0;min. Flow cytometry analysis was performed using a BD FACSVerse&#x2122; Flow Cytometer.</p>
</sec>
<sec id="s2_7">
<title>Calcein-AM/PI Assay</title>
<p>Cells were seeded into 24-well plates. After 8&#xa0;h of <italic>Salmonella</italic> infection, media was removed and the cells were washed with PBS. Following that, 2&#xa0;ml of 1&#xd7; assay buffer supplemented with Calcein-AM (2 &#x3bc;M) and PI (4.5 &#x3bc;M) was added to the cells and incubated at 37&#xb0;C for 15&#xa0;min. The samples were then examined with a fluorescence microscope under a 490 &#xb1; 10 nm excitation filter.</p>
</sec>
<sec id="s2_8">
<title>Western Blotting</title>
<p>Total protein of Caco-2 cells was extracted using RIPA buffer (Solarbio, Beijing, China) containing a protease/phosphatase inhibitor cocktail (Cell Signaling Technology, USA) on ice for 30&#xa0;min. Protein concentration was quantified using the BCA Protein Assay kit (23227, ThermoFisher Scientific). SDS-PAGE was used to separate protein samples, which were then transferred to polyvinylidene fluoride membranes. After incubation with 5% skim milk, the membranes were incubated with primary antibodies. Further details about the primary antibodies are described in the <xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>. Next, the membranes were incubated with secondary antibodies, then coated with ECL immunoblotting substrate. Images were captured using a Tanon 6200 chemiluminescence imaging workstation.</p>
<table-wrap id="T2" position="float">
<label>Table&#xa0;2</label>
<caption>
<p>The dilution ratio of primary antibodies.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Antibody</th>
<th valign="top" align="center">Dilution rate</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">Rabbit Anti-LAMP 1 polyclonal antibody</td>
<td valign="top" align="center">1:2,000</td>
</tr>
<tr>
<td valign="top" align="left">Rabbit Anti-Occludin polyclonal antibody</td>
<td valign="top" align="center">1:1,500</td>
</tr>
<tr>
<td valign="top" align="left">Rabbit Anti-Claudin-1 polyclonal antibody</td>
<td valign="top" align="center">1:2,000</td>
</tr>
<tr>
<td valign="top" align="left">Rabbit Anti-Caspase 9/p35/p10 polyclonal antibody</td>
<td valign="top" align="center">1:500</td>
</tr>
<tr>
<td valign="top" align="left">Rabbit Anti-Bax polyclonal antibody</td>
<td valign="top" align="center">1:5,000</td>
</tr>
<tr>
<td valign="top" align="left">Rabbit Anti-Bcl-2 polyclonal antibody</td>
<td valign="top" align="center">1:1,000</td>
</tr>
<tr>
<td valign="top" align="left">Rabbit Anti-VDAC1 polyclonal antibody</td>
<td valign="top" align="center">1:1,000</td>
</tr>
<tr>
<td valign="top" align="left">Rabbit Anti-Phospho-Caspase-9 (Ser196) polyclonal antibody</td>
<td valign="top" align="center">1:1,000</td>
</tr>
<tr>
<td valign="top" align="left">Rabbit Anti-Cytochrome c monoclonal antibody</td>
<td valign="top" align="center">1:5,000</td>
</tr>
<tr>
<td valign="top" align="left">Mouse Anti-Beta ACTIN monoclonal antibody</td>
<td valign="top" align="center">1:5,000</td>
</tr>
<tr>
<td valign="top" align="left">Rabbit Anti-Cleaved Caspase-3 monoclonal antibody</td>
<td valign="top" align="center">1:1,000</td>
</tr>
<tr>
<td valign="top" align="left">Mouse Anti-Cleaved PARP monoclonal antibody</td>
<td valign="top" align="center">1:1,000</td>
</tr>
<tr>
<td valign="top" align="left">Rabbit Anti-Phospho-Akt (Ser473) monoclonal antibody</td>
<td valign="top" align="center">1:2,000</td>
</tr>
<tr>
<td valign="top" align="left">Rabbit Anti-Phospho-Akt (Thr308) monoclonal antibody</td>
<td valign="top" align="center">1:2,000</td>
</tr>
<tr>
<td valign="top" align="left">Rabbit Anti- Caspase-1 monoclonal antibody</td>
<td valign="top" align="center">1:1,000</td>
</tr>
<tr>
<td valign="top" align="left">Rabbit Anti-ZO-1 polyclonal antibody</td>
<td valign="top" align="center">1:500</td>
</tr>
<tr>
<td valign="top" align="left">Rabbit Anti-Phospho-Bad (Ser136) polyclonal antibody</td>
<td valign="top" align="center">1:500</td>
</tr>
<tr>
<td valign="top" align="left">Rabbit Anti GSDMD-N monoclonal antibody</td>
<td valign="top" align="center">1:1,000</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_9">
<title>Immunofluorescence</title>
<p>Cells were fixed with 4% paraformaldehyde and permeabilized with 1% (v/v) Triton X-100. Following that, the samples were blocked with 2% bovine serum albumin at room temperature. The samples were then incubated with anti-LAMP1 (1:100); anti-Cleaved-caspase-3 (1:100); anti-Cytochrome c (1:50); anti-Phospho-Akt (Thr308) (1:800); anti-Tom-20 (1:200) at 4&#xb0;C overnight. The Mito-Tracker Red CMXRos was used to label mitochondria. Next, the samples were incubated with secondary antibodies at room temperature. Either DAPI or Hoechst 33342 was used to stain the DNA. Images were taken using a Nikon A1 confocal laser scanning microscope.</p>
</sec>
<sec id="s2_10">
<title>Mitochondrial Network Morphology Assay</title>
<p>Mitochondria were labeled with Tom-20 and imaged using confocal microscopy. The Mitochondrial Network Analysis (MiNA) toolset, which consists of a relatively simple pair of macros using existing ImageJ plug-ins, was used to analyze the mitochondrial networks.</p>
</sec>
<sec id="s2_11">
<title>Animal Infection Experiment</title>
<p>All animal work was performed in accordance with the Guidelines for Laboratory Animal Use and Care of the Chinese Center for Disease Control and Prevention and the Rules for Medical Laboratory Animals (1998) of the Chinese Ministry of Health. A total of 36 six-week-old male C57BL/6 mice were obtained from Charles River Laboratory Animal Technology Co., Ltd (Beijing, China). Mice were provided food and water <italic>ad libitum</italic> throughout the entire experiment. All mice were administered a single dose of streptomycin (15 mg per mouse) <italic>via</italic> gastric gavage before being infected <italic>via</italic> gavage 24&#xa0;h later (2 &#xd7; 10<sup>6</sup> <italic>Salmonella</italic> in 200 &#x3bc;l of PBS). Control mice were orally fed an equal volume of PBS. The mice were then euthanized, and their ileum tissues were harvested 3 days after infection. Mice feces were homogenized in 1&#xa0;ml of PBS, and serial dilutions were plated on LB agar plates to quantify bacterial burdens.</p>
</sec>
<sec id="s2_12">
<title>Assessment of Diarrhea Degree</title>
<p>The severity of diarrhea was evaluated using the fecal score and the dry/wet weight of fecal pellets. The fecal scoring criteria were as follows: 1 (normal stool); 2 (slightly wet, soft stool and formed stool); 3 (wet and unformed stool with mucus); 4 (watery stool). In order to determine the fecal dry/wet weight ratio, mice were separately placed in a clean cage, without food or water. Next, 0.5&#xa0;g of feces was collected and weighed. Following that, the feces were placed in a 60&#xb0;C oven for 24&#xa0;h until the weight change was less than 1% before being weighed. The dry/wet weight ratio was then calculated.</p>
</sec>
<sec id="s2_13">
<title>Histopathologic Section</title>
<p>In order to evaluate ileal pathology, the mid-segments of the ileum were excised, rinsed with saline, then fixed with 4% paraformaldehyde for 48&#xa0;h. Paraffin-embedded tissue samples were sectioned (3 &#x3bc;m) and stained with hematoxylin and eosin. A neutral resin was used for sealing. Tissue sections were observed and imaged using an Olympus CX23 microscope equipped with an imaging system.</p>
</sec>
<sec id="s2_14">
<title>Real-Time Quantitative PCR</title>
<p>For gene expression analysis, total RNA was extracted from ileal tissues using the Trizol reagent (Invitrogen, Carlsbad, CA, USA). RNA transcription was performed using the PrimeScriptTM RT Reagent Kit according to the manufacturer&#x2019;s instructions (RR047A, TaKaRa, Japan). Quantitative real-time RT-PCR was performed using the SYBR Green PCR Master Mix (LS2062, Promega, USA). The cycle threshold (CT) values of target genes were normalized to the CT value of hypoxanthine gene hypoxanthine phosphoribosyl-transferase. The results were presented as fold-change using the 2<sup>&#x2212;&#x394;&#x394;CT</sup> method. Primer sequences for PCR are listed in <xref ref-type="table" rid="T3">
<bold>Table&#xa0;3</bold>
</xref>.</p>
<table-wrap id="T3" position="float">
<label>Table&#xa0;3</label>
<caption>
<p>Real-time PCR primers.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Primer name</th>
<th valign="top" align="center">Direction<xref ref-type="table-fn" rid="fnT3_1">
<sup>a</sup>
</xref>
</th>
<th valign="top" align="center">Sequence (5&#x2032;&#x2192;3&#x2032;)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" rowspan="2" align="left">TNF-&#x3b1;</td>
<td valign="top" align="center">F</td>
<td valign="top" align="left">CCTGTAGCCCACGTCGTAG</td>
</tr>
<tr>
<td valign="top" align="center">R</td>
<td valign="top" align="left">GGGAGTAGACAAGGTACAACCC</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="left">IL-6</td>
<td valign="top" align="center">F</td>
<td valign="top" align="left">TCTATACCACTTCACAAGTCGGA</td>
</tr>
<tr>
<td valign="top" align="center">R</td>
<td valign="top" align="left">GAATTGCCATTGCACAACTCTTT</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="left">IL-1&#x3b2;</td>
<td valign="top" align="center">F</td>
<td valign="top" align="left">GAAATGCCACCTTTTGACAGTG</td>
</tr>
<tr>
<td valign="top" align="center">R</td>
<td valign="top" align="left">TGGATGCTCTCATCAGGACAG</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="left">IL-18</td>
<td valign="top" align="center">F</td>
<td valign="top" align="left">TGTTGAGCATGAAAAGCCTCTAT</td>
</tr>
<tr>
<td valign="top" align="center">R</td>
<td valign="top" align="left">AGGTCTCCCGAATTGGAAAGG</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="left">IL-22</td>
<td valign="top" align="center">F</td>
<td valign="top" align="left">ATGAGTTTTTCCCTTATGGGGAC</td>
</tr>
<tr>
<td valign="top" align="center">R</td>
<td valign="top" align="left">GCTGGAAGTTGGACACCTCAA</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="left">IFN-&#x3b3;</td>
<td valign="top" align="center">F</td>
<td valign="top" align="left">ATGAACGCTACACACTGCATC</td>
</tr>
<tr>
<td valign="top" align="center">R</td>
<td valign="top" align="left">CCATCCTTTTGCCAGTTCCTC</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="left">&#x3b2;-Actin</td>
<td valign="top" align="center">F</td>
<td valign="top" align="left">CTACCTCATGAAGATCCTGACC</td>
</tr>
<tr>
<td valign="top" align="center">R</td>
<td valign="top" align="left">CACAGCTTCTCTTTGATGTCAC</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="fnT3_1">
<label>a</label>
<p>F, forward; R, reverse.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s2_15">
<title>Statistical Analysis</title>
<p>All statistical analysis was performed using GraphPad Prism 7 with a one-way ANOVA or a t-test with Bonferroni correction. Data were presented as means &#xb1; SEM. <italic>P</italic> &lt; 0.05 was considered statistically significant.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<title>Results</title>
<sec id="s3_1">
<title>
<italic>S</italic>. Infantis Can Hyper-Replicate in Caco-2 Cells</title>
<p>The curves showed that the bacterial load began to rapidly increase at 4 hpi and peaked at 8 hpi (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>). We discovered two bacterial subpopulations in the cell by adding chloroquine (used to selectively kill vacuolar bacteria): one in the SCV and the other free in the cytoplasm. The bacterial load was mainly contributed by cytosolic bacteria (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>). Next, we used mCherry-<italic>S</italic>. Infantis to infect the cells and LAMP-1 to label SCV for confirmation. Confocal microscopy images revealed that&#xa0;cytosolic <italic>S</italic>. Infantis was the absolute dominant subpopulation (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref>).</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Infected cells containing hyper-replicating cytosolic <italic>S</italic>. Infantis did not undergo apoptosis. <bold>(A)</bold> Detection of intracellular bacterial load using the gentamicin protection assay, without (total intracellular bacteria, red curve) or with (cytosolic bacteria, blue curve) chloroquine. Data were obtained from three independent replicates of each sample at 0, 2, 4, 6, 8, 10, and 12 hpi. <bold>(B)</bold> Detection of the distribution and proportion of two subpopulations in Caco-2 cells by immunofluorescence staining. SI, <italic>S</italic>. Infantis. Red: <italic>Salmonella</italic>. Green: Lamp-1. Blue: DAPI. Scale bar, 10 &#xb5;m. <bold>(C)</bold> Cell viability assay of Caco-2 cells infected with <italic>S</italic>. Infantis within 12&#xa0;h. CN, control. <bold>(D)</bold> Western blot analysis of Caspase-9, Cleaved-caspase-3, and Cleaved-PARP protein expression levels within 12&#xa0;h after bacterial infection. A total of 10 time points were set for sampling: 0, 0.5, 1, 2, 3, 4, 5, 6, 7, 8 hpi. CN, control. ns, no significant difference. <bold>(E)</bold> Immunofluorescence staining analysis of Cleaved-caspase-3 in Caco-2 cells. Samples were treated at 1, 4, and 8 hpi, respectively. CN, control; SI, <italic>S</italic>. Infantis. Red: <italic>S</italic>. Infantis. Green: Cleaved-caspase-3. Blue: DAPI. Scale bar, 10 &#xb5;m. CCCP was the apoptosis-positive control group. Data were presented as the mean &#xb1; SEM from three independent experiments (n = 3). *<italic>P</italic> &lt; 0.05, **<italic>P</italic> &lt; 0.01, ***<italic>P</italic> &lt; 0.001.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-12-757909-g001.tif"/>
</fig>
</sec>
<sec id="s3_2">
<title>
<italic>S</italic>. Infantis Infection Does Not Induce Apoptosis of Caco-2 Cells</title>
<p>The cell survival rate significantly decreased at 6 hpi and remained almost unchanged after 8 hpi (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1C</bold>
</xref>). Therefore, we focused on the 0&#x2013;8 hpi period, which encompasses the peak of cytosolic replication and the low phase of cell viability. The results showed that Caspase-9, Cleaved-caspase-3, and Cleaved-PARP were not activated during <italic>S</italic>. Infantis infection (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1D</bold>
</xref>). Morphological analysis of apoptosis revealed that <italic>S</italic>. Infantis infection did not result in apoptotic characteristics of the nucleus (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1B, E</bold>
</xref>). These findings indicated that cytosolic <italic>S</italic>. Infantis hyper-replicated in Caco-2 cells without inducing apoptosis.</p>
</sec>
<sec id="s3_3">
<title>Cytosolic <italic>S</italic>. Infantis Inhibits Apoptosis by Intermittently Phosphorylating Akt</title>
<p>Akt regulates cell survival and suppresses apoptosis <italic>via</italic> phosphorylation at Thr308 and Ser473 sites (<xref ref-type="bibr" rid="B27">27</xref>&#x2013;<xref ref-type="bibr" rid="B29">29</xref>). Several studies have found that Akt is constantly phosphorylated after <italic>S</italic>. Typhimurium invades epithelial cells (<xref ref-type="bibr" rid="B18">18</xref>, <xref ref-type="bibr" rid="B20">20</xref>). In this study, we hypothesized that continuous Akt phosphorylation contributes to the inhibition of apoptosis. As seen in <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>, phosphorylation of Akt occurred in a discontinuous manner during <italic>S</italic>. Infantis infection. The first phase occurred at 0.5 hpi and rapidly decreased to near the background level. The second phase was observed at 3&#x2013;4 hpi, with the expression of p-Akt higher than in the first phase. The levels of Cleaved-caspase-3 and Cleaved-PARP significantly increased after Akt phosphorylation was inhibited by MK2206, an Akt inhibitor that inhibits Akt phosphorylation at Thr 308 and Ser 473 (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2B, C</bold>
</xref>).</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Cytosolic hyper-replicating <italic>S</italic>. Infantis inhibited apoptosis by intermittently phosphorylating Akt. <bold>(A)</bold> Western blot analysis of p-Akt (Ser473) and p-Akt (Thr308) protein expression levels at 0, 0.5, 1, 2, 3, 4, 5, 6, 7, 8 hpi, respectively. CN, control. <bold>(B)</bold> Immunoblotting verified the inhibitory effect of MK2206 on p-Akt (Ser473) and p-Akt (Thr308) protein expression levels at 0.5, 3, and 4 hpi. <bold>(C)</bold> Western blot analysis of Cleaved-caspase-3 and Cleaved-PARP protein expression levels at 0.5, 3, and 4 hpi after after p-Akt was suppressed by MK2206. <bold>(D&#x2013;F)</bold> Immunofluorescence staining analysis p-Akt (Thr308) distribution. CN, control; SI, <italic>S</italic>. Infantis. <bold>(D)</bold> Distribution of p-Akt (Thr308) in all infected cells at 0.5 hpi. <bold>(E)</bold> Expression of p-Akt (Thr308) in infected cells containing cytosolic hyper-replicating <italic>S</italic>. Infantis at 4 and 8 hpi. <bold>(F)</bold> Expression of p-Akt (Thr308) in infected cells without cytosolic hyper-replicating <italic>S</italic>. Infantis at 4 and 8 hpi. At least 100 cells were counted for each group. Red: <italic>S</italic>. Infantis. Green: p-Akt (Thr308). Blue: Hoechst 333342. Data were presented as the mean &#xb1; SEM from three independent experiments (n = 3).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-12-757909-g002.tif"/>
</fig>
<p>Next, we explored which parts of the bacteria induced Akt phosphorylation. At 0.5 hpi, Akt phosphorylation was observed in all infected cells (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2D</bold>
</xref>). Images at 4 hpi revealed high levels of p-Akt in cells containing cytosolic hyper-replicating <italic>S</italic>. Infantis (bacteria number &gt;20), which were not observed at 8 hpi (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2E</bold>
</xref>). In infected cells without cytosolic bacteria, phosphorylation of p-Akt was not detected at 4 and 8 hpi (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2F</bold>
</xref>). These results demonstrated that <italic>S</italic>. Infantis-induced Akt phosphorylation occurred in two distinct phases. The first phase is widely induced after the invasion and rapidly depleted within 30&#xa0;min, whereas the second phase is only induced by cytosolic bacteria at 3&#x2013;4 hpi. Both phases of Akt phosphorylation inhibited apoptosis of the infected cells.</p>
</sec>
<sec id="s3_4">
<title>Inhibition of Apoptosis by Akt Intermittent Phosphorylation Is Mediated by Cytosolic <italic>S</italic>. Infantis <italic>SopB</italic>
</title>
<p>Notably, the SPI1 effector <italic>SopB</italic>, which contributes to invasion and SCV maturation, has 4-phosphatase activity, which can induce Akt activation during <italic>S</italic>. Typhimurium infection (<xref ref-type="bibr" rid="B18">18</xref>, <xref ref-type="bibr" rid="B20">20</xref>). As expected, the p-Akt level was almost completely diminished in cells infected with the <italic>&#x394;SopB</italic> mutant (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3A, C</bold>
</xref>). Interestingly, LY294002 (Ly, a pan Akt inhibitor) completely inhibited Akt phosphorylation, but there was a certain expression of p-Akt after Wortmannin (Wor, a PI3K/Akt inhibitor) treatment (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3B</bold>
</xref>). Furthermore, infection with the <italic>SopB</italic> mutant induced apoptosis, as demonstrated by nuclear chromatin condensation and increase of Cleaved-caspase-3 and Cleaved-PARP levels (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3C, D</bold>
</xref>). The SC79 (an Akt phosphorylation activator) was used to activate Akt (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3E</bold>
</xref>), with findings confirming that <italic>SopB</italic>-mediated Akt intermittent phosphorylation inhibited apoptosis of infected cells (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3F, G</bold>
</xref>). Importantly, wild-type (WT) <italic>S</italic>. Infantis had enough time for intracellular replication, resulting in increased bacterial load by inhibiting apoptosis (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3H</bold>
</xref>).</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Inhibition of apoptosis by intermittent Akt phosphorylation was mediated by Cytosolic <italic>S</italic>. Infantis <italic>SopB</italic>. <bold>(A)</bold> Western blot analysis of p-Akt (Ser473) and p-Akt (Thr308) protein expression levels after WT <italic>S</italic>. Infantis or <italic>SopB</italic> mutant infection at 0.5, 3, and 4 hpi. CN, control. <bold>(B)</bold> Immunoblotting verified the repressive effects of Ly294002 (Ly) and Wortmannin (Wor) on p-Akt (Thr308) protein expression levels after infection with WT <italic>S</italic>. Infantis. CN, control. <bold>(C)</bold> Immunofluorescence staining of p-Akt (Thr308) after infection with WT <italic>S</italic>. Infantis or the <italic>SopB</italic> mutant at 4 hpi. Red: <italic>S</italic>. Infantis. Green: p-Akt (Thr308). Blue: Hoechst 333342. <bold>(D)</bold> Western blot analysis of Cleaved-caspase-3 and Cleaved-PARP protein expression levels within 8&#xa0;h after <italic>SopB</italic> mutant infection. CN, control. <bold>(E)</bold> Immunoblotting verified the activation of SC79 on p-Akt (Thr308) protein expression level after <italic>SopB</italic> mutant infection at 4 hpi. CN, control. <bold>(F, G)</bold> Apoptosis was evaluated after infection with WT <italic>S</italic>. Infantis or the <italic>SopB</italic> mutant at 4 hpi. In the process of bacterial infection, the phosphorylation level of Akt was regulated by the addition of MK2206 or SC79. <bold>(F)</bold> The protein levels of Cleaved-caspase-3 and Cleaved-PARP were analyzed using Western blotting. <bold>(G)</bold> The proportion of apoptotic cells was detected using flow cytometry. <bold>(H)</bold> Detection of intracellular bacterial load using the gentamicin protection assay without (total intracellular bacteria, black curve) or with (total intracellular bacteria, gray curve) MK2206. ns, no significant difference. Data were presented as the mean &#xb1; SEM from three independent experiments (n = 3). *<italic>P</italic> &lt; 0.05, **<italic>P</italic> &lt; 0.01, ***<italic>P</italic> &lt; 0.001.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-12-757909-g003.tif"/>
</fig>
</sec>
<sec id="s3_5">
<title>
<italic>SopB</italic> Mediated Akt Phosphorylation Inhibits Apoptosis by Maintaining Mitochondrial Dynamic Network Homeostasis</title>
<p>The mitochondrion is the primary control organelle responsible for endogenous apoptosis. In normal cells, individual mitochondria connect to form tubules and shape dynamic networks through continuous division and fusion (<xref ref-type="bibr" rid="B30">30</xref>). Therefore, we evaluated the morphology of the infected cells&#x2019; mitochondrial network. At 4 hpi, the mitochondria of WT <italic>S</italic>. Infantis&#x2013;infected cells still maintained an abundant network structure, but infection with the <italic>SopB</italic> mutant disrupted the mitochondrial network (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4A</bold>
</xref>). The mitochondrial cavity also appeared to be expanding, as evidenced by the ring-shaped structure (yellow arrows) (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4A</bold>
</xref>). Morphological analysis of the mitochondrial network revealed that infection with the WT strain had no discernible effect on the dynamics of the mitochondrial network (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4B</bold>
</xref>).</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>
<italic>SopB</italic>-mediated Akt phosphorylation inhibited apoptosis by maintaining mitochondrial dynamic network homeostasis. In <bold>(A&#x2013;D)</bold>, all cell samples were collected and processed at 4 hpi after infection with <italic>S</italic>. Infantis. Immunofluorescence analysis of mitochondrial network after infection with WT <italic>S</italic>. Infantis or the <italic>SopB</italic> mutant. Red: <italic>Salmonella</italic>; Green: Tom20 (mitochondria); Blue: Hoechst 333342. <bold>(B)</bold> Mitochondrial network analysis using the MiNA toolset of Image (J) <bold>(C)</bold> Co-localization of cytochrome c and mitochondria was detected using immunofluorescence. In the bacterial infection process, the phosphorylation level of Akt was regulated by the addition of MK2206 or SC79. CSA was used to inhibit the opening of the mitochondrial permeability transition pore (MPTP) Red: Mitochondria; Green: Cytochrome c; Blue: Hoechst 333342 (Nucleus and bacteria). <bold>(D)</bold> Detection of Cytochrome c, Bcl-2, and Bax protein levels in mitochondrial and cytoplasmic protein after infection with WT <italic>S</italic>. Infantis or the <italic>SopB</italic> mutant. In the bacterial infection process, the phosphorylation level of Akt was regulated by the addition of MK2206 or SC79. <bold>(E)</bold> Western blot analysis of p-Caspase-9 (Ser136) and p-Bad (Ser196) protein expression levels within 8&#xa0;h after infection with <italic>S</italic>. Infantis. Data were presented as the mean &#xb1; SEM from three independent experiments (n = 3). *<italic>P</italic> &lt; 0.05, **<italic>P</italic> &lt; 0.01, ***<italic>P</italic> &lt; 0.001. CN, control. ns, no significant difference.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-12-757909-g004.tif"/>
</fig>
<p>The key events of mitochondria-mediated apoptosis are the opening of mitochondrial permeability transition pore (MPTP) and the release of cytochrome c (<xref ref-type="bibr" rid="B31">31</xref>, <xref ref-type="bibr" rid="B32">32</xref>). In the WT group, cytochrome c and mitochondria remained co-localized, while mk2206 treatment resulted in cytochrome c translocation from the mitochondria to the cytoplasm (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4C, D</bold>
</xref>). Infection with the <italic>SopB</italic> mutant resulted in massive cytochrome c release into cytoplasm, which was reversed by the addition of SC79, partially restoring the mitochondrial network (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4C, D</bold>
</xref>). Interestingly, co-localization of cytochrome c and mitochondria was also restored by the addition of CSA (a MPTP blocker) (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4C</bold>
</xref>). The mitochondrial membrane permeability may be&#xa0;affected by p-Akt induced by <italic>SopB</italic>, and the Bcl-2 family regulates the permeability of the mitochondrial outer membrane by inhibiting Bax translocation from the cytosol to the mitochondria (<xref ref-type="bibr" rid="B33">33</xref>, <xref ref-type="bibr" rid="B34">34</xref>). We extracted mitochondrial protein and detected the distribution of Bcl-2 and Bax. As shown in <xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4D</bold>
</xref>, WT <italic>S</italic>. Infantis infection significantly increased the distribution of Bcl-2 in the mitochondria, while the addition of mk2206 decreased Bcl-2 and increased the distribution of Bax in the mitochondria. Infection with the <italic>SopB</italic> mutant also resulted in the decrease of Bcl-2 and the increase of Bax in mitochondria, which could be reversed by adding SC79. In addition, WT <italic>S</italic>. Infantis infection could phosphorylate Bad and Caspase-9 (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4E</bold>
</xref>), which enhanced the inhibition of apoptosis. In summary, <italic>S</italic>. Infantis-mediated Akt phosphorylation by <italic>SopB</italic> maintained mitochondrial dynamic network homeostasis, hence suppressing the apoptosis in infected cells.</p>
</sec>
<sec id="s3_6">
<title>
<italic>SopB</italic>-Mediated Akt Phosphorylation Delays Pyroptosis by Inhibiting Caspase-1</title>
<p>Flow cytometry results showed that the proportion of 7-ADD<sup>+</sup>/Annexin-V PE<sup>+</sup> cells significantly increased during 6&#x2013;8 hpi, and the cells entered later stage of apoptosis without the early phase (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5A</bold>
</xref>). This indicated that there was a change in the membrane permeability of infected cells. In order to validate this conjecture, we performed double staining with Calcein-AM and PI during infection with <italic>S</italic>. Infantis. Images revealed that a subset of cells in the <italic>S</italic>. Infantis infection group had been damaged, as evidenced by PI-positive staining (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5B</bold>
</xref>). The scanning electron microscope images revealed that plasmalemma was destroyed and bacteria had been drilled out along the pores (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5C</bold>
</xref>), suggesting the occurrence of pyroptosis.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p> <italic>SopB</italic>-mediated Akt phosphorylation delayed pyroptosis. <bold>(A)</bold> The proportion of apoptotic cells within 8&#xa0;h after infection with WT <italic>S</italic>. Infantis was detected using flow cytometry. <bold>(B)</bold> Calcein-AM/PI was used to evaluate cell membrane permeability after 8&#xa0;h of infection with WT <italic>S</italic>. Infantis. Green: Calcein-AM; Red: PI. <bold>(C)</bold> Observation of the apical surface of Caco-2 cell monolayer ultrastructure using scanning electron microscopy. WT (I) (6 hpi) and WT (II) (8 hpi) showed that the WT <italic>S</italic>. Infantis&#x2013;infected cell was bacteria-laden, which were extruded from the monolayer. <bold>(D)</bold> Detection of intracellular bacterial load using the gentamicin protection assay at 0, 2, 4, 6, 8, 10, and 12 hpi after infection (Black curve: WT <italic>S</italic>. Infantis; Gray curve: <italic>SopB</italic> mutant). <bold>(E&#x2013;J)</bold> Western blot analysis of Caspase-1 and GSDMD-N protein levels after infection with WT <italic>S</italic>. Infantis or the <italic>SopB</italic> mutant within 8&#xa0;h. <bold>(E)</bold> Infection with WT <italic>S</italic>. Infantis; <bold>(F)</bold> infection with the <italic>SopB</italic> mutant; <bold>(G)</bold> comparison of WT <italic>S</italic>. Infantis and the <italic>SopB</italic> mutant; <bold>(H)</bold> infection with WT <italic>S</italic>. Infantis in the presence of SC79; <bold>(I)</bold> infection with WT <italic>S</italic>. Infantis in the presence of MK2206; <bold>(J)</bold> infection with the <italic>SopB</italic> mutant infection in the presence of SC79. Data were presented as the mean &#xb1; SEM from three independent experiments (n = 3). *<italic>P</italic> &lt; 0.05, **<italic>P</italic> &lt; 0.01, ***<italic>P</italic> &lt; 0.001. CN, control; SI, <italic>S</italic>. Infantis. ns, no significant difference.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-12-757909-g005.tif"/>
</fig>
<p>Next, the protein markers of pyroptosis, caspase-1 (p10), and GSDMD-N were examined. Infection with WT <italic>S</italic>. Infantis significantly activated pyroptosis (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5E</bold>
</xref>). Surprisingly, the <italic>&#x394;SopB</italic> strain induced caspase-1 (p10) and GSDMD-N activation 2&#xa0;h earlier than WT <italic>S</italic>. Infantis (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5F</bold>
</xref>). However, the <italic>SopB</italic> mutant induced lower levels of caspase-1 (p10) and GSDMD-N compared to the WT strain, indicating a weaker degree of pyroptosis induced by the <italic>SopB</italic> mutant (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5G</bold>
</xref>). A recent study reported that p-Akt suppressed inflammasome activation in <italic>Salmonella</italic>-infected macrophages (<xref ref-type="bibr" rid="B35">35</xref>). Pyroptosis can be regulated by <italic>S</italic>. Infantis through p-Akt. MK2206 significantly reduced the levels of caspase-1 (p10) and GSDMD-N induced by WT <italic>S</italic>. Infantis, while SC79 treatment caused the WT strain to display a similar regulation as the <italic>&#x394;SopB</italic> strain (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5H, I</bold>
</xref>). Furthermore, SC79 treatment resulted in a significant decrease in caspase-1 (p10) and GSDMD-N levels during infection with the <italic>&#x394;SopB</italic> strain (<xref ref-type="fig" rid="f5">
<bold>Figure 5J</bold>
</xref>), indicating that Akt phosphorylation both delayed pyroptosis and aggravated the severity of pyroptosis of infected Caco-2 cells. Intracellular bacterial load detection revealed that the number of bacteria in cells infected with the WT strain was much higher than in cells infected with the <italic>&#x394;SopB</italic> strain (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5D</bold>
</xref>). This may explain the two phenotypes of <italic>S</italic>. Infantis causing varying degrees of pyroptosis: the WT strain has a greater bacterial load and stimulates the inflammasome more strongly.</p>
</sec>
<sec id="s3_7">
<title>WT <italic>S</italic>. Infantis Causes More Severe Intestinal Inflammatory Damage Than the <italic>&#x394;SopB</italic> Strain</title>
<p>In order to verify our findings <italic>in vivo</italic>, we infected the C57BL/6 mouse model with <italic>Salmonella</italic>. The severity of diarrhea was determined by fecal score and the dry/wet weight of fecal pellets. The results revealed that WT <italic>S</italic>. Infantis caused more severe diarrhea than the <italic>&#x394;SopB</italic> strain (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6A, B</bold>
</xref>). In addition, the fecal bacterial load in the WT group was also significantly higher than the <italic>&#x394;SopB</italic> group (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6C</bold>
</xref>). Since <italic>Salmonella</italic> infection can cause severe ileal injury, the pathological changes in the ileum were examined. Infection with WT <italic>S</italic>. Infantis resulted in more severe ileal damage than infection with the <italic>&#x394;SopB</italic> strain (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6D, E</bold>
</xref>). Consistent with the <italic>in vitro</italic> results, p-Akt (Ser473 and Thr308) was found to be highly expressed in the WT group (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6F</bold>
</xref>). As shown in <xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6G</bold>
</xref>, infection with WT <italic>S</italic>. Infantis significantly increased the mRNA level of inflammatory factors, while the mRNA level of inflammatory factors induced by the <italic>&#x394;SopB</italic> strain was lower compared to WT <italic>S</italic>. Infantis. In combination with the detection of caspase-1 level (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6H</bold>
</xref>), we discovered that the infection with WT strain led to more severe intestinal inflammatory injury. Furthermore, immunoblotting and the TUNEL fluorescence assay showed that the <italic>&#x394;SopB</italic> strain caused more severe apoptosis of intestinal cells than the WT stain (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6I, J</bold>
</xref>). Intestinal cells infected with the <italic>&#x394;SopB</italic> strain may shed rapidly from the epithelium through apoptosis and be eliminated from the body, reducing the gut <italic>Salmonella</italic> load and inflammatory response.</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>WT <italic>S</italic>. Infantis caused more severe intestinal inflammatory damage to the C57BL/6 mice gut than the &#x394;<italic>SopB</italic> mutant. <bold>(A)</bold> The fecal score curve of mice in three groups after <italic>Salmonella</italic> infection. The fecal status of mice was scored daily. <bold>(B)</bold> Results of the dry/wet weight ratio of feces. The starting day of the experiment was considered as day 0 (24&#xa0;h after streptomycin gavage). Three representative feces images of each group are shown on the right side of the curve. <bold>(C)</bold> Quantification of fecal bacterial burdens on day 3. Three representative plots of bacterial colonies images in each group are below the curve. <bold>(D)</bold> Ileum representative photomicrographs of sections stained with H&amp;E. <bold>(E, F)</bold> Western blot analysis of Claudin-1, Occludin, p-Akt (Ser473), and p-Akt (Thr308) protein levels of three groups. <bold>(G)</bold> Expression of IL-1&#x3b2;, IL-18, IL-6, IL-22, TNF-&#x3b1;, and IFN-&#x3b3; mRNA in ileal tissues. <bold>(H, I)</bold> Western blot analysis of Caspase-1, Cleaved-caspase-3, and Cleaved-PARP protein levels of three groups. <bold>(J)</bold> The representative images of TUNEL fluorescence staining in ileum tissue pathological sections. Blue: DAPI; Green: TUNEL positive cells. Data were presented as mean &#xb1; SEM. (n = 6). Data were presented as the mean &#xb1; SEM from three independent experiments (n = 3). *<italic>P</italic> &lt; 0.05, **<italic>P</italic> &lt; 0.01, ***<italic>P</italic> &lt; 0.001. CN, control. ns, no significant difference.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-12-757909-g006.tif"/>
</fig>
<p>In conclusion, <italic>S</italic>. Infantis delayed the death of infected Caco-2 cells through intermittent activation of Akt mediated by <italic>SopB</italic>, allowing intracellular cytosolic bacteria sufficient time&#xa0;for replication and resulting in more severe intestinal inflammation.</p>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<title>Discussion</title>
<p>Many pathogenic bacteria that are closely related to public health reproduce intracellularly, enhancing their virulence. Invasion and colonization in epithelial cells are crucial processes in <italic>Salmonella</italic> pathogenesis (<xref ref-type="bibr" rid="B36">36</xref>). The replication of cytosolic <italic>Salmonella</italic> is key to the early establishment of the infection (<xref ref-type="bibr" rid="B10">10</xref>, <xref ref-type="bibr" rid="B11">11</xref>). In this study, we elucidated the mechanism by which cytosolic <italic>S</italic>. Infantis delayed the death of infected epithelial cells <italic>via</italic> intermittent Akt phosphorylation mediated by <italic>SopB</italic>.</p>
<p>
<italic>Salmonella</italic> utilizes <italic>SopB</italic> to activate Akt, suggesting that it&#xa0;plays an important role in regulating host cell survival (<xref ref-type="bibr" rid="B18">18</xref>,&#xa0;<xref ref-type="bibr" rid="B19">19</xref>). However, the distribution of <italic>SopB</italic>-dependent Akt phosphorylation in epithelial cells remained unclear. A single-cell approach was used&#xa0;to evaluate the relationship between <italic>SopB</italic> and Akt phosphorylation. Because <italic>SopB</italic> was transported to cells to play a role in mediating both actin-dependent and myosin II-dependent bacterial invasion, we attributed the induction of the first wave of Akt phosphorylation to its residual activity. The second wave of Akt phosphorylation activity only occurred at 3&#x2013;4 hpi, with Akt phosphorylation only strongly induced in infected cells containing hyper-replicating cytosolic bacteria. Notably, there was no Akt phosphorylation at any other time in all infected cells. We hypothesized that the second wave of Akt activation was due to the residual SPI-1 activity of bacteria escaping from the SCV. This was similar to Akt phosphorylation by <italic>S</italic>. Typhimurium: the first stage was widely induced during invasion, and the second stage was induced only in the infected cells containing cytosolic <italic>Salmonella</italic> (<xref ref-type="bibr" rid="B20">20</xref>). However, there were some differences between the two types of <italic>Salmonella</italic>: the first phase of Akt phosphorylation induced by <italic>S</italic>. Typhimurium was largely depleted by 3 hpi, whereas the first phase of Akt phosphorylation induced by <italic>S</italic>. Infantis induced was almost depleted at 1 hpi. The second stage of Akt activation induced by <italic>S</italic>. Infantis induction was occurred at 3&#x2013;4 hpi, while <italic>S</italic>. Typhimurium-induced Akt activation was later at 6 hpi (<xref ref-type="bibr" rid="B20">20</xref>). Previous studies have shown that <italic>S</italic>. Infantis was less invasive and induced considerably weaker enteritis than <italic>S</italic>.&#xa0;Typhimurium (<xref ref-type="bibr" rid="B37">37</xref>). These differences were attributed to the&#xa0;low expression of SPI-1 in <italic>S.</italic> Infantis than that in <italic>S</italic>. Typhimurium (<xref ref-type="bibr" rid="B37">37</xref>).</p>
<p>
<italic>SopB</italic> delayed the inevitable and rapid apoptosis of intestinal epithelial cells. For <italic>Salmonella</italic>, the most obvious advantage gained by inhibiting apoptosis is time, which allows <italic>Salmonella</italic> to establish an intracellular stronghold to rapidly proliferate, as well as regulate its and the host&#x2019;s gene expression to prepare for the spread of infection in the gut. The mitochondrion is the primary organelle for endogenous apoptosis (<xref ref-type="bibr" rid="B30">30</xref>). In this study, we discovered that cytosolic <italic>S</italic>. Infantis phosphorylated Akt through <italic>SopB</italic> to (i) reposition Bcl-2 to regulate the permeability of the mitochondrial outer membrane by inhibiting Bax translocation from cytosol to the mitochondria; (ii) maintain mitochondrial dynamic network homeostasis; (iii) phosphorylate Bad and Caspase-9 to inhibit apoptosis of infected cells, thereby maintaining the mitochondrial membrane and network homeostasis to suppress the apoptosis of infected cells.</p>
<p>Importantly, we discovered that <italic>SopB</italic>-mediated Akt phosphorylation delayed the pyroptosis of infected cells. Recently, it has been reported that <italic>SopB</italic> inhibited the activation of NLRC4 inflammasome in BMDMs through an Akt signal-dependent process (<xref ref-type="bibr" rid="B35">35</xref>). Another study found that <italic>SopB</italic> promoted YAP phosphorylation through Akt in B cells, thereby inhibiting the assembly of the inflammasome (<xref ref-type="bibr" rid="B38">38</xref>). The activation of the inflammasome is a crucial step in inducing of pyroptosis. Our findings demonstrated that <italic>SopB</italic>-mediated Akt phosphorylation also delayed the activation of caspase-1 and pyroptosis in Caco-2 cells. Compared to apoptosis, pyroptosis occurs faster and is accompanied by the release of pro-inflammatory factors, such as IL-1&#x3b2; and IL-18 (<xref ref-type="bibr" rid="B21">21</xref>&#x2013;<xref ref-type="bibr" rid="B23">23</xref>). Inflammatory factors increase the number of inflammatory cells and aggravate the inflammatory response, which is a vital defense mechanism for the host to combat pathogenic microorganism infection (<xref ref-type="bibr" rid="B39">39</xref>). Although the inflammatory response accelerates the elimination of pathogens, it also alters the intestinal environment by disrupting gut microbiota and causing a burst of intestinal electron acceptors (<xref ref-type="bibr" rid="B40">40</xref>, <xref ref-type="bibr" rid="B41">41</xref>). An alteration in the intestinal ecosystem provides variables for pathogens to gain a growth advantage to spread infection. In this study, <italic>S</italic>. Infantis rapidly induced the pyroptosis within 2&#xa0;h after Akt phosphorylation diminished. The WT <italic>S</italic>. Infantis caused more severe intestinal inflammation <italic>in vivo</italic> than the <italic>SopB</italic> mutant (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref>). We hypothesized that <italic>SopB</italic> contributes to the rapid proliferation of bacteria in the intestinal infection phase of <italic>S</italic>. Infantis, which leads to inflammatory response, intestinal damage, and other intestinal environmental variables, as well as provides favorable conditions for the subsequent establishment of long-term colonization infection in the gut.</p>
<p>In conclusion, this study demonstrated that the <italic>S</italic>. Infantis SPI-1 effector <italic>SopB</italic> acts as a pro-survival factor in epithelial cells by inhibiting apoptosis and delaying pyroptosis. <italic>S</italic>. Infantis gained sufficient time to proliferate through the regulation of host cell death, which resulted in inflammation and suitable conditions for the spread and colonization of pathogens in the gut. As it is interesting that bacterial pathogens can manipulate host cell death mechanisms to enhance pathogen survival and spread infection, further studies focusing on how <italic>S</italic>. Infantis regulates different types of host cell death to cause enteritis will be performed. This study also provides a solid theoretical basis as well as potential drug targets for the treatment of salmonellosis.</p>
</sec>
<sec id="s5" sec-type="data-availability">
<title>Data Availability Statement</title>
<p>The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.</p>
</sec>
<sec id="s6" sec-type="ethics-statement">
<title>Ethics Statement</title>
<p>The animal study was reviewed and approved by the Guidelines for Laboratory Animal Use and Care from the Chinese Center for Disease Control and Prevention and the Rules for Medical Laboratory Animals (1998) from the Chinese Ministry of Health, under the approval of the Animal Ethics Committee of the China Agricultural University.</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author Contributions</title>
<p>B-XC designed and performed the experiments. Y-NL, N-L, and Y-HZ participated and assisted in the experiments as well as provided advice during the procedure. L-XY and S-YC contributed to data analysis. B-XC drafted the manuscript, and J-FW critically revised the manuscript. J-FW was responsible for obtaining funding and overseeing the project. All authors contributed to the article and approved the submitted version.</p>
</sec>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>This work was supported by the National Key R&amp;D Program of China (Project No. 2017YFD0502200).</p>
</sec>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of Interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s10" sec-type="disclaimer">
<title>Publisher&#x2019;s Note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
</body>
<back>
<ack>
<title>Acknowledgments</title>
<p>We thank the fund for support in this work: The National Key&#xa0;R&amp;D Program of China (Project No. 2017YFD0502200). We are very grateful to Drs. Ning Xie and Jin Hui Su for technical support.</p>
</ack>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1</label>
<citation citation-type="book">
<person-group person-group-type="author">
<collab>Centers for Disease Control and Prevention (CDC)</collab>
</person-group>. <source>National Salmonella Surveillance Annual Report &#x2014; Appendices, 2010</source>. <publisher-loc>Atlanta, Georgia</publisher-loc>: <publisher-name>US Department of Health and Human Services, CDC</publisher-name>, (<year>2013</year>).</citation>
</ref>
<ref id="B2">
<label>2</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gili</surname> <given-names>A</given-names>
</name>
<name>
<surname>Katherine</surname> <given-names>TS</given-names>
</name>
<name>
<surname>Natalie</surname> <given-names>S</given-names>
</name>
<name>
<surname>Mali</surname> <given-names>SD</given-names>
</name>
<name>
<surname>Antje</surname> <given-names>C</given-names>
</name>
<name>
<surname>Galia</surname> <given-names>R</given-names>
</name>
<etal/>
</person-group>. <article-title>A Unique Megaplasmid Contributes to Stress Tolerance and Pathogenicity of an Emergent Salmonella Enterica Serovar Infantis Strain</article-title>. <source>Environ Microbiol</source> (<year>2014</year>) <volume>16</volume>:<page-range>977&#x2013;94</page-range>. doi: <pub-id pub-id-type="doi">10.1111/1462-2920.12351</pub-id>
</citation>
</ref>
<ref id="B3">
<label>3</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<collab>European Food Safety Authority</collab>
</person-group>. <article-title>European Centre for Disease Prevention and Control. The European Union Summary Report on Antimicrobial Resistance in Zoonotic and Indicator Bacteria From Humans, Animals and Food in 2015</article-title>. <source>EFSA J</source> (<year>2017</year>) <volume>15</volume>:<page-range>e04694</page-range>. doi: <pub-id pub-id-type="doi">10.2903/j.efsa.2017.4694</pub-id>
</citation>
</ref>
<ref id="B4">
<label>4</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<collab>European Food Safety Authority</collab>
</person-group>. <article-title>European Centre for Disease Prevention and Control-</article-title>. <source>EFSA J</source> (<year>2017</year>) <volume>15</volume>:<elocation-id>e05077</elocation-id>. doi: <pub-id pub-id-type="doi">10.2903/j.efsa.2017.5077</pub-id>
</citation>
</ref>
<ref id="B5">
<label>5</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<collab>European Food Safety Authority</collab>
</person-group>. <article-title>European Centre for Disease Prevention and Control. The European Union Summary Report on Antimicrobial Resistance in Zoonotic and Indicator Bacteria From Humans, Animals and Food in 2017</article-title>. <source>EFSA J</source> (<year>2019</year>) <volume>17</volume>:<page-range>e05598</page-range>. doi: <pub-id pub-id-type="doi">10.2903/j.efsa.2019.5598</pub-id>
</citation>
</ref>
<ref id="B6">
<label>6</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hauser</surname> <given-names>E</given-names>
</name>
<name>
<surname>Tietze</surname> <given-names>E</given-names>
</name>
<name>
<surname>Helmuth</surname> <given-names>R</given-names>
</name>
<name>
<surname>Junker</surname> <given-names>E</given-names>
</name>
<name>
<surname>Prager</surname> <given-names>R</given-names>
</name>
<name>
<surname>Schroeter</surname> <given-names>A</given-names>
</name>
<etal/>
</person-group>. <article-title>Clonal Dissemination of Salmonella Enterica Serovar Infantis in Germany</article-title>. <source>Foodborne Pathog Dis</source> (<year>2012</year>) <volume>9</volume>:<page-range>352&#x2013;60</page-range>. doi: <pub-id pub-id-type="doi">10.1089/fpd.2011.1038</pub-id>
</citation>
</ref>
<ref id="B7">
<label>7</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shahada</surname> <given-names>F</given-names>
</name>
<name>
<surname>Sugiyama</surname> <given-names>H</given-names>
</name>
<name>
<surname>Chuma</surname> <given-names>T</given-names>
</name>
<name>
<surname>Sueyoshi</surname> <given-names>M</given-names>
</name>
<name>
<surname>Okamoto</surname> <given-names>K</given-names>
</name>
</person-group>. <article-title>Genetic Analysis of Multi-Drug Resistance and the Clonal Dissemination of Beta-Lactam Resistance in Salmonella Infantis Isolated From Broilers</article-title>. <source>Vet Microbiol</source> (<year>2010</year>) <volume>140</volume>:<page-range>136&#x2013;41</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.vetmic.2009.07.007</pub-id>
</citation>
</ref>
<ref id="B8">
<label>8</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>LaRock</surname> <given-names>DL</given-names>
</name>
<name>
<surname>Chaudhary</surname> <given-names>A</given-names>
</name>
<name>
<surname>Miller</surname> <given-names>SI</given-names>
</name>
</person-group>. <article-title>
<italic>Salmonellae</italic> Interactions With Host Processes</article-title>. <source>Nat Rev Microbiol</source> (<year>2015</year>) <volume>13</volume>:<fpage>191</fpage>&#x2013;<lpage>205</lpage>. doi: <pub-id pub-id-type="doi">10.1038/nrmicro3420</pub-id>
</citation>
</ref>
<ref id="B9">
<label>9</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Knodler</surname> <given-names>LA</given-names>
</name>
<name>
<surname>Nair</surname> <given-names>V</given-names>
</name>
<name>
<surname>Steele-Mortimer</surname> <given-names>O</given-names>
</name>
</person-group>. <article-title>Quantitative Assessment of Cytosolic Salmonella in Epithelial Cells</article-title>. <source>PloS One</source> (<year>2014</year>) <volume>9</volume>:<fpage>e84681</fpage>. doi: <pub-id pub-id-type="doi">10.1371/journal.pone.0084681</pub-id>
</citation>
</ref>
<ref id="B10">
<label>10</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Malik-Kale</surname> <given-names>P</given-names>
</name>
<name>
<surname>Winfree</surname> <given-names>S</given-names>
</name>
<name>
<surname>Steele-Mortimer</surname> <given-names>O</given-names>
</name>
</person-group>. <article-title>The Bimodal Lifestyle of Intracellular Salmonella in Epithelial Cells: Replication in the Cytosol Obscures Defects in Vacuolar Replication</article-title>. <source>PloS One</source> (<year>2012</year>) <volume>7</volume>:<fpage>e38732</fpage>. doi: <pub-id pub-id-type="doi">10.1371/journal.pone.0038732</pub-id>
</citation>
</ref>
<ref id="B11">
<label>11</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Knodler</surname> <given-names>LA</given-names>
</name>
<name>
<surname>Vallance</surname> <given-names>BA</given-names>
</name>
<name>
<surname>Celli</surname> <given-names>J</given-names>
</name>
<name>
<surname>Winfree</surname> <given-names>S</given-names>
</name>
<name>
<surname>Hansen</surname> <given-names>B</given-names>
</name>
<name>
<surname>Montero</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Dissemination of Invasive Salmonella <italic>via</italic> Bacterial-Induced Extrusion of Mucosal Epithelia</article-title>. <source>Proc Natl Acad Sci USA</source> (<year>2010</year>) <volume>107</volume>:<page-range>17733&#x2013;8</page-range>. doi: <pub-id pub-id-type="doi">10.1073/pnas.1006098107</pub-id>
</citation>
</ref>
<ref id="B12">
<label>12</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chu</surname> <given-names>BX</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>YH</given-names>
</name>
<name>
<surname>Su</surname> <given-names>JH</given-names>
</name>
<name>
<surname>Xia</surname> <given-names>B</given-names>
</name>
<name>
<surname>Zou</surname> <given-names>YJ</given-names>
</name>
<name>
<surname>Nie</surname> <given-names>JW</given-names>
</name>
</person-group>. <article-title>Butyrate-Mediated Autophagy Inhibition Limits Cytosolic Salmonella Infantis Replication in the Colon of Pigs Treated With a Mixture of Lactobacillus and Bacillus</article-title>. <source>Vet Res</source> (<year>2020</year>) <volume>51</volume>:<fpage>99</fpage>. doi: <pub-id pub-id-type="doi">10.1186/s13567-020-00823-8</pub-id>
</citation>
</ref>
<ref id="B13">
<label>13</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yu</surname> <given-names>HB</given-names>
</name>
<name>
<surname>Croxen</surname> <given-names>MA</given-names>
</name>
<name>
<surname>Marchiando</surname> <given-names>AM</given-names>
</name>
<name>
<surname>Ferreira</surname> <given-names>RBR</given-names>
</name>
<name>
<surname>Cadwell</surname> <given-names>K</given-names>
</name>
<name>
<surname>Foster</surname> <given-names>LJ</given-names>
</name>
<etal/>
</person-group>. <article-title>Autophagy Facilitates Salmonella Replication in Hela Cells</article-title>. <source>mBio</source> (<year>2014</year>) <volume>5</volume>:<page-range>e00865&#x2013;14</page-range>. doi: <pub-id pub-id-type="doi">10.1128/mBio.00865-14</pub-id>
</citation>
</ref>
<ref id="B14">
<label>14</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Birmingham</surname> <given-names>CL</given-names>
</name>
<name>
<surname>Shahnazari</surname> <given-names>S</given-names>
</name>
<name>
<surname>Shiu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Zheng</surname> <given-names>YT</given-names>
</name>
<name>
<surname>Smith</surname> <given-names>AC</given-names>
</name>
<etal/>
</person-group>. <article-title>Antibacterial Autophagy Occurs at PI(3)P-Enriched Domains of the Endoplasmic Reticulum and Requires Rab1 GTPase</article-title>. <source>Autophagy</source> (<year>2011</year>) <volume>7</volume>:<fpage>17</fpage>&#x2013;<lpage>26</lpage>. doi: <pub-id pub-id-type="doi">10.4161/auto.7.1.13840</pub-id>
</citation>
</ref>
<ref id="B15">
<label>15</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yrlid</surname> <given-names>U</given-names>
</name>
<name>
<surname>Wick</surname> <given-names>MJ</given-names>
</name>
</person-group>. <article-title>Salmonella-Induced Apoptosis of Infected Macrophages Results in Presentation of a Bacteria-Encoded Antigen After Uptake by Bystander Dendritic Cells</article-title>. <source>J Exp Med</source> (<year>2000</year>) <volume>191</volume>:<page-range>613&#x2013;24</page-range>. doi: <pub-id pub-id-type="doi">10.1084/jem.191.4.613</pub-id>
</citation>
</ref>
<ref id="B16">
<label>16</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname> <given-names>S</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Chu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>R</given-names>
</name>
<etal/>
</person-group>. <article-title>A Salmonella Enterica Serovar Typhi Plasmid Induces Rapid and Massive Apoptosis in Infected Macrophages</article-title>. <source>Cell Mol Immunol</source> (<year>2010</year>) <volume>7</volume>:<page-range>271&#x2013;8</page-range>. doi: <pub-id pub-id-type="doi">10.1038/cmi.2010.17</pub-id>
</citation>
</ref>
<ref id="B17">
<label>17</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Takaya</surname> <given-names>A</given-names>
</name>
<name>
<surname>Suzuki</surname> <given-names>A</given-names>
</name>
<name>
<surname>Kikuchi</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Eguchi</surname> <given-names>M</given-names>
</name>
<name>
<surname>Isogai</surname> <given-names>E</given-names>
</name>
<name>
<surname>Tomoyasu</surname> <given-names>T</given-names>
</name>
<etal/>
</person-group>. <article-title>Derepression of Salmonella Pathogenicity Island 1 Genes Within Macrophages Leads to Rapid Apoptosis <italic>via</italic> Caspase-1 and Caspase-3-Dependent Pathways</article-title>. <source>Cell Microbiol</source> (<year>2010</year>) <volume>7</volume>:<fpage>79</fpage>&#x2013;<lpage>90</lpage>. doi: <pub-id pub-id-type="doi">10.1111/j.1462-5822.2004.00435.x</pub-id>
</citation>
</ref>
<ref id="B18">
<label>18</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Knodler</surname> <given-names>LA</given-names>
</name>
<name>
<surname>Finlay</surname> <given-names>BB</given-names>
</name>
<name>
<surname>Steele-Mortimer</surname> <given-names>O</given-names>
</name>
</person-group>. <article-title>The Salmonella Effector Protein Sopb Protects Epithelial Cells From Apoptosis by Sustained Activation of Akt</article-title>. <source>J Biol Chem</source> (<year>2005</year>) <volume>280</volume>:<page-range>9058&#x2013;64</page-range>. doi: <pub-id pub-id-type="doi">10.1074/jbc.M412588200</pub-id>
</citation>
</ref>
<ref id="B19">
<label>19</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ruan</surname> <given-names>H</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Tian</surname> <given-names>L</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>S</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>S</given-names>
</name>
<name>
<surname>Qiao</surname> <given-names>JJ</given-names>
</name>
</person-group>. <article-title>The Salmonella Effector Sopb Prevents Ros-Induced Apoptosis of Epithelial Cells by Retarding Traf6 Recruitment to Mitochondria</article-title>. <source>Biochem Biophys Res Commun</source> (<year>2016</year>) <volume>478</volume>:<page-range>618&#x2013;23</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.bbrc.2016.07.116</pub-id>
</citation>
</ref>
<ref id="B20">
<label>20</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Finn</surname> <given-names>CE</given-names>
</name>
<name>
<surname>Chong</surname> <given-names>A</given-names>
</name>
<name>
<surname>Cooper</surname> <given-names>KG</given-names>
</name>
<name>
<surname>Starr</surname> <given-names>T</given-names>
</name>
<name>
<surname>Steele-Mortimer</surname> <given-names>O</given-names>
</name>
</person-group>. <article-title>A Second Wave of Salmonella T3ss1 Activity Prolongs the Lifespan of Infected Epithelial Cells</article-title>. <source>PloS Pathog</source> (<year>2017</year>) <volume>13</volume>:<fpage>e1006354</fpage>. doi: <pub-id pub-id-type="doi">10.1371/journal.ppat.1006354</pub-id>
</citation>
</ref>
<ref id="B21">
<label>21</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shi</surname> <given-names>J</given-names>
</name>
<name>
<surname>Gao</surname> <given-names>W</given-names>
</name>
<name>
<surname>Feng</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>Pyroptosis: Gasdermin-Mediated Programmed Necrotic Cell Death</article-title>. <source>Trends Biochem Sci</source> (<year>2016</year>) <volume>42</volume>:<page-range>245&#x2013;54</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.tibs.2016.10.004</pub-id>
</citation>
</ref>
<ref id="B22">
<label>22</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Martinon</surname> <given-names>F</given-names>
</name>
<name>
<surname>Tschopp</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>Inflammatory Caspases and Inflammasomes: Master Switches of Inflammation</article-title>. <source>Cell Death Differ</source> (<year>2007</year>) <volume>14</volume>:<page-range>10&#x2013;2</page-range>. doi: <pub-id pub-id-type="doi">10.1038/sj.cdd.4402038</pub-id>
</citation>
</ref>
<ref id="B23">
<label>23</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Miao</surname> <given-names>EA</given-names>
</name>
<name>
<surname>Leaf</surname> <given-names>IA</given-names>
</name>
<name>
<surname>Treuting</surname> <given-names>PM</given-names>
</name>
<name>
<surname>Mao</surname> <given-names>DP</given-names>
</name>
<name>
<surname>Dors</surname> <given-names>M</given-names>
</name>
<name>
<surname>Sarkar</surname> <given-names>A</given-names>
</name>
<etal/>
</person-group>. <article-title>Caspase-1-Induced Pyroptosis Is an Innate Immune Effector Mechanism Against Intracellular Bacteria</article-title>. <source>Nat Immunol</source> (<year>2010</year>) <volume>11</volume>:<page-range>1136&#x2013;42</page-range>. doi: <pub-id pub-id-type="doi">10.1038/ni.1960</pub-id>
</citation>
</ref>
<ref id="B24">
<label>24</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Knodler</surname> <given-names>LA</given-names>
</name>
<name>
<surname>Finlay</surname> <given-names>BB</given-names>
</name>
</person-group>. <article-title>Salmonella and Apoptosis: To Live or Let Die</article-title>. <source>Microbes Infect</source> (<year>2001</year>) <volume>3</volume>:<page-range>1321&#x2013;6</page-range>. doi: <pub-id pub-id-type="doi">10.1016/S1286-4579(01)01493-9</pub-id>
</citation>
</ref>
<ref id="B25">
<label>25</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Schwan</surname> <given-names>WR</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>XZ</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>L</given-names>
</name>
<name>
<surname>Kopecko</surname> <given-names>DJ</given-names>
</name>
</person-group>. <article-title>Differential Bacterial Survival, Replication, and Apoptosis-Inducing Ability of Salmonella Serovars Within Human and Murine Macrophages</article-title>. <source>Infect Immun</source> (<year>2000</year>) <volume>68</volume>:<page-range>1005&#x2013;13</page-range>. doi: <pub-id pub-id-type="doi">10.1128/IAI.68.3.1005-1013.2000</pub-id>
</citation>
</ref>
<ref id="B26">
<label>26</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Geiser</surname> <given-names>P</given-names>
</name>
<name>
<surname>Martino</surname> <given-names>M</given-names>
</name>
<name>
<surname>Ventayol</surname> <given-names>PS</given-names>
</name>
<name>
<surname>Eriksson</surname> <given-names>J</given-names>
</name>
<name>
<surname>Sellin</surname> <given-names>ME</given-names>
</name>
<name>
<surname>Al-Saffar</surname> <given-names>AK</given-names>
</name>
<etal/>
</person-group>. <article-title>Salmonella Enterica Serovar Typhimurium Exploits Cycling Through Epithelial Cells to Colonize Human and Murine Enteroids</article-title>. <source>mBio</source> (<year>2021</year>) <volume>12</volume>:<page-range>e02684&#x2013;20</page-range>. doi: <pub-id pub-id-type="doi">10.1128/mBio.02684-20</pub-id>
</citation>
</ref>
<ref id="B27">
<label>27</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Slingerland</surname> <given-names>JM</given-names>
</name>
</person-group>. <article-title>Multiple Roles of the PI3K/PKB (Akt) Pathway in Cell Cycle Progression</article-title>. <source>Cell Cycle</source> (<year>2014</year>) <volume>2</volume>:<page-range>336&#x2013;42</page-range>. doi: <pub-id pub-id-type="doi">10.4161/cc.2.4.433</pub-id>
</citation>
</ref>
<ref id="B28">
<label>28</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sarbassov</surname> <given-names>DD</given-names>
</name>
<name>
<surname>Guertin</surname> <given-names>DA</given-names>
</name>
<name>
<surname>Ali</surname> <given-names>SM</given-names>
</name>
<name>
<surname>Sabatini</surname> <given-names>DM</given-names>
</name>
</person-group>. <article-title>Phosphorylation and Regulation of Akt/PKB by the rictor-mTOR Complex</article-title>. <source>Science</source> (<year>2005</year>) <volume>307</volume>:<page-range>1098&#x2013;101</page-range>. doi: <pub-id pub-id-type="doi">10.1126/science.1106148</pub-id>
</citation>
</ref>
<ref id="B29">
<label>29</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Song</surname> <given-names>G</given-names>
</name>
<name>
<surname>Ouyang</surname> <given-names>GL</given-names>
</name>
<name>
<surname>Bao</surname> <given-names>SD</given-names>
</name>
</person-group>. <article-title>The Activation of Akt/PKB Signaling Pathway and Cell Survival</article-title>. <source>J Cell Mol Med</source> (<year>2005</year>) <volume>1</volume>:<fpage>59</fpage>&#x2013;<lpage>71</lpage>. doi: <pub-id pub-id-type="doi">10.1111/j.1582-4934.2005.tb00337.x</pub-id>
</citation>
</ref>
<ref id="B30">
<label>30</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Green</surname> <given-names>DR</given-names>
</name>
<name>
<surname>Kroemer</surname> <given-names>G</given-names>
</name>
</person-group>. <article-title>The Pathophysiology of Mitochondrial Cell Death</article-title>. <source>Science</source> (<year>2004</year>) <volume>305</volume>:<page-range>626&#x2013;9</page-range>. doi: <pub-id pub-id-type="doi">10.1126/science.1099320</pub-id>
</citation>
</ref>
<ref id="B31">
<label>31</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jason</surname> <given-names>K</given-names>
</name>
<name>
<surname>Onur</surname> <given-names>K</given-names>
</name>
<name>
<surname>Brody</surname> <given-names>MJ</given-names>
</name>
<name>
<surname>Sargent</surname> <given-names>MA</given-names>
</name>
<name>
<surname>Michael</surname> <given-names>DM</given-names>
</name>
<name>
<surname>Molkentin</surname> <given-names>JD</given-names>
</name>
<etal/>
</person-group>. <article-title>Necroptosis Interfaces With Momp and the Mptp in Mediating Cell Death</article-title>. <source>PloS One</source> (<year>2015</year>) <volume>10</volume>:<fpage>e0130520</fpage>. doi: <pub-id pub-id-type="doi">10.1371/journal.pone.0130520</pub-id>
</citation>
</ref>
<ref id="B32">
<label>32</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Halestrap</surname> <given-names>AP</given-names>
</name>
</person-group>. <article-title>What Is the Mitochondrial Permeability Transition Pore</article-title>? <source>J Mol Cell Cardiol</source> (<year>2009</year>) <volume>46</volume>:<page-range>821&#x2013;31</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.yjmcc.2009.02.021</pub-id>
</citation>
</ref>
<ref id="B33">
<label>33</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Edlich</surname> <given-names>F</given-names>
</name>
<name>
<surname>Banerjee</surname> <given-names>S</given-names>
</name>
<name>
<surname>Suzuki</surname> <given-names>M</given-names>
</name>
<name>
<surname>Cleland</surname> <given-names>M</given-names>
</name>
<name>
<surname>Arnoult</surname> <given-names>D</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>C</given-names>
</name>
<etal/>
</person-group>. <article-title>Bcl-X(L) Retrotranslocates Bax From the Mitochondria Into the Cytosol</article-title>. <source>Cell</source> (<year>2011</year>) <volume>145</volume>:<page-range>104&#x2013;16</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.cell.2011.02.034</pub-id>
</citation>
</ref>
<ref id="B34">
<label>34</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mikhailov</surname> <given-names>V</given-names>
</name>
<name>
<surname>Mikhailova</surname> <given-names>M</given-names>
</name>
<name>
<surname>Pulkrabek</surname> <given-names>DJ</given-names>
</name>
<name>
<surname>Dong</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Venkatachalam</surname> <given-names>MA</given-names>
</name>
<name>
<surname>Saikumar</surname> <given-names>P</given-names>
</name>
</person-group>. <article-title>Bcl-2 Prevents Bax Oligomerization in the Mitochondrial Outer Membrane</article-title>. <source>J Biol Chem</source> (<year>2001</year>) <volume>276</volume>:<page-range>18361&#x2013;74</page-range>. doi: <pub-id pub-id-type="doi">10.1074/jbc.M100655200</pub-id>
</citation>
</ref>
<ref id="B35">
<label>35</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hu</surname> <given-names>GQ</given-names>
</name>
<name>
<surname>Song</surname> <given-names>PX</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>W</given-names>
</name>
<name>
<surname>Qi</surname> <given-names>S</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>SX</given-names>
</name>
<name>
<surname>Du</surname> <given-names>CT</given-names>
</name>
</person-group>. <article-title>Cirtical Role for Salmonella Effector SopB in Regulating Inflammasome Activation</article-title>. <source>Mol Immunol</source> (<year>2017</year>) <volume>90</volume>:<page-range>280&#x2013;6</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.molimm.2017.07.011</pub-id>
</citation>
</ref>
<ref id="B36">
<label>36</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Haraga</surname> <given-names>A</given-names>
</name>
<name>
<surname>Ohlson</surname> <given-names>MB</given-names>
</name>
<name>
<surname>Miller</surname> <given-names>SI</given-names>
</name>
</person-group>. <article-title>Salmonellae Interplay With Host Cells</article-title>. <source>Nat Rev Microbiol</source> (<year>2008</year>) <volume>6</volume>:<fpage>53</fpage>&#x2013;<lpage>66</lpage>. doi: <pub-id pub-id-type="doi">10.1038/nrmicro1788</pub-id>
</citation>
</ref>
<ref id="B37">
<label>37</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gili</surname> <given-names>A</given-names>
</name>
<name>
<surname>Antje</surname> <given-names>C</given-names>
</name>
<name>
<surname>Maya</surname> <given-names>D</given-names>
</name>
<name>
<surname>Helit</surname> <given-names>C</given-names>
</name>
<name>
<surname>Abdulhadi</surname> <given-names>S</given-names>
</name>
<name>
<surname>Alibek</surname> <given-names>G</given-names>
</name>
<etal/>
</person-group>. <article-title>Differences in the Expression of SPI-1 Genes Pathogenicity and Epidemiology Between the Emerging Salmonella Enterica Serovar Infantis and the Model Salmonella Enterica Serovar Typhimurium</article-title>. <source>J Infect Dis</source> (<year>2019</year>) <volume>6</volume>:<page-range>1071&#x2013;81</page-range>. doi: <pub-id pub-id-type="doi">10.1093/infdis/jiz235</pub-id>
</citation>
</ref>
<ref id="B38">
<label>38</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Abraham</surname> <given-names>G</given-names>
</name>
<name>
<surname>Carlos</surname> <given-names>S</given-names>
</name>
<name>
<surname>Araceli</surname> <given-names>P</given-names>
</name>
<name>
<surname>Nava</surname> <given-names>P</given-names>
</name>
<name>
<surname>Ortiz-Navarrete</surname> <given-names>V</given-names>
</name>
</person-group>. <article-title>SopB Activates the Akt-YAP Pathway to Promote Salmonella Survival Within B Cells</article-title>. <source>Virulence</source> (<year>2018</year>) <volume>9</volume>:<page-range>1390&#x2013;402</page-range>. doi: <pub-id pub-id-type="doi">10.1080/21505594.2018.1509664</pub-id>
</citation>
</ref>
<ref id="B39">
<label>39</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Crowley</surname> <given-names>SM</given-names>
</name>
<name>
<surname>Knodler</surname> <given-names>LA</given-names>
</name>
<name>
<surname>Vallance</surname> <given-names>BA</given-names>
</name>
</person-group>. <article-title>Salmonella and the Inflammasome: Battle for Intracellular Dominance</article-title>. <source>Curr Top Microbiol Immunol</source> (<year>2016</year>) <volume>397</volume>:<fpage>43</fpage>&#x2013;<lpage>67</lpage>. doi: <pub-id pub-id-type="doi">10.1007/978-3-319-41171-2_3</pub-id>
</citation>
</ref>
<ref id="B40">
<label>40</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Winter</surname> <given-names>SE</given-names>
</name>
<name>
<surname>Thiennimitr</surname> <given-names>P</given-names>
</name>
<name>
<surname>Winter</surname> <given-names>MG</given-names>
</name>
<name>
<surname>Butler</surname> <given-names>BP</given-names>
</name>
<name>
<surname>Huseby</surname> <given-names>DL</given-names>
</name>
<name>
<surname>Crawford</surname> <given-names>RW</given-names>
</name>
</person-group>. <article-title>Gut Inflammation Provides a Respiratory Electron Acceptor for Salmonella</article-title>. <source>Nature</source> (<year>2010</year>) <volume>467</volume>:<page-range>426&#x2013;9</page-range>. doi: <pub-id pub-id-type="doi">10.1038/nature09415</pub-id>
</citation>
</ref>
<ref id="B41">
<label>41</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hakansson</surname> <given-names>A</given-names>
</name>
<name>
<surname>Molin</surname> <given-names>G</given-names>
</name>
</person-group>. <article-title>Gut Microbiota and Inflammation</article-title>. <source>Nutrients</source> (<year>2011</year>) <volume>3</volume>:<page-range>637&#x2013;82</page-range>. doi: <pub-id pub-id-type="doi">10.3390/nu3060637</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>