To better understand the mechanisms of the host responses to pathogenic infection, we performed transcriptome RNA-sequencing (RNA-seq) of wild-type (N2) C. elegans fed on E. coli OP50 or exposed to P. aeruginosa PA14. Differential expression analyses of triplicate samples demonstrated that 643 genes were up-regulated and 582 genes were down-regulated upon P. aeruginosa PA14 exposure as compared to the gene expression levels in C. elegans fed on E. coli OP50 ( Figure 1A ; Tables S1 , S2 in Supplementary Material ). Subsequently, we compared our RNA-seq data with two previous studies (25, 26). The results show that about half of the differentially expressed genes in either of the previous studies were commonly regulated by P. aeruginosa infection as compared to that in this study ( Figure S1A in Supplementary Material ), which give us a notion that despite the known immune molecules and pathways, further efforts are needed to explore the regulatory network involved in innate immunity. Considering the mounting evidence shows that bZIP transcription factors play crucial roles in innate immune regulation, here, we focused on the immune function of zip class genes. Out of 12 members of the zip family in C. elegans, zip-2, zip-10 and zip-11 were up-regulated upon P. aeruginosa PA14 infection ( Figure 1B ; Table S3 in Supplementary Material ) and those results were verified by quantitative real-time PCR (qRT-PCR) ( Figure 1C ). ZIP-2 has been identified as a key mediator of infection-induced gene expression (27). Translational block caused by PA14-delivered ToxA can trigger an increase in protein level of ZIP-2 (23). Meanwhile, ZIP-10 acts downstream of the TGF-β signal pathway ligand DBL-1 and the SMAD transcription factor SMA-9 to regulate the body size and the male tail morphogenesis of C. elegans (28). Moreover, the exposure to pathogenic bacteria induces ZIP-10 expression (25), indicating ZIP-10 may also play an important role in innate immunity.

Since ZIP-11 has not been characterized yet, we focused on this bZIP transcription factor to investigate if and how it mediates the innate immunity of C. elegans. Using a tagged zip-11p::zip-11::GFP::FLAG allele in an integrated transgenic strain, we observed that the number of intestinal nuclei with visible ZIP-11::EGFP was significantly increased in P. aeruginosa PA14 exposed worms than that in E. coli OP50 fed worms ( Figure 1D ). Likely because of the low baseline expression level of ZIP-11, the EGFP fluorescence signal of the normal maintained C. elegans was barely visible in intestinal tissue. Moreover, the western blot results also showed that P. aeruginosa PA14 infection dramatically upregulated the expression level of ZIP-11 protein ( Figures 1E, F ). These results demonstrate that pathogen infection stimulates ZIP-11 expression which assist our presumption of possible role of ZIP-11 in innate immune response.

To test if ZIP-11 acts in innate immune response, we first examined the survival of ZIP-11 deficient worms upon P. aeruginosa PA14 infection. We found that zip-11(tm4554) null mutant worms exhibited reduced resistance to killing by P. aeruginosa PA14 as compared to wild-type ( Figure 2A ). Furthermore, the sensitive phenotype to P. aeruginosa PA14 infection was also observed in worms treated with zip-11 RNA interference (RNAi) ( Figure 2B ). These data suggest that the loss function or the suppression of ZIP-11 signaling impairs the innate immunity of C. elegans. Certain mutants susceptible to pathogen infection exhibit sensitivity to pathogen accumulation, while others exhibit reduced endurance to pathogen (11). Here, the numbers of bacterial cells in the intestine of zip-11 mutants were comparable to those in WT worms ( Figure S1B in Supplementary Material ). Moreover, compared to WT worms, zip-11(tm4554) worms exhibited a similar accumulation pattern of P. aeruginosa/green fluorescent protein (GFP) ( Figure S1C in Supplementary Material ). To ask whether the feeding or defecation behavior in zip-11(tm4554) animals may account for the immune phenotype, the pumping rate and enteric muscle contraction (EMC) cycle in the intestine were detected. We observed that there was no difference in these behaviors between zip-11(tm4554) and WT worms ( Figures S1D, S1E in Supplementary Material ). In addition, zip-11(tm4554) worms showed the equivalent brood size as that of WT worms ( Figure S1F in Supplementary Material ), suggesting that the observed sensitivity to P. aeruginosa infection in zip-11(tm4554) worms is not caused by the confounding effects varying on worm fecundity. There was no difference in survival rate between zip-11(tm4554) and WT worms that were fed with heat-killed P. aeruginosa ( Figure S1G in Supplementary Material ). Thus, ZIP-11 activates immune response to promote the endurance to living pathogen bacteria without altering the basic health of C. elegans.

Although ZIP-11 expression was only visible in the intestinal nuclei of worms exposed to P. aeruginosa using the translational reporter zip-11p::zip-11::GFP, we generated the zip-11 transcriptional reporter zip-11p::zip-11::SL2::GFP to monitor the expression pattern of zip-11 in C. elegans. Intriguingly, the GFP signal was detectable not only in intestine but also in pharynx and hypodermis tissue ( Figure 2C ; Figure S2 in Supplementary Material ), indicating that ZIP-11 may play a regulatory role in multiple biological processes. In order to determine the site of action of ZIP-11 and clarify the tissue specificity of ZIP-11 in terms of immune regulation to P. aeruginosa infection, the killing assay of worms treated with zip-11 RNAi restricted to specific tissue was performed. The specificity of tissue-specific RNAi worm strains was confirmed by tissue-specific RNAi clones, which acted only in the corresponding tissues and demonstrated specific phenotypes (29). With tissue-specific RNAi worms, only the knockdown of zip-11 in intestine reduced the resistance to P. aeruginosa infection ( Figure 2H ), of which the phenotype was in accordance with that observed in zip-11 loss-function and whole-body knockdown worms. However, suppressing zip-11 expression in the neuron ( Figure 2D ), or hypodermis ( Figure 2E ), or muscle ( Figure 2F ), or germline ( Figure 2G ) did not alter the survival rate of worms upon P. aeruginosa infection. Additionally, we found that overexpression of ZIP-11 under the control of endogenous zip-11 or intestinal specific ges-1 promoter in zip-11 mutant background converted the sensitive phenotype to the resistant state ( Figure 2I ). Taken together, these results support a role of ZIP-11 in activating a protective transcriptional response in the intestinal tissue of C. elegans to P. aeruginosa infection.

Upon P. aeruginosa infection, C. elegans mounts protective responses by triggering evolutionarily conserved innate immune pathways, such as the DBL-1/TGF-β, DAF-16/FOXO and PMK-1/p38 MAPK pathways (6–8). To gain insights into the molecular mechanism of ZIP-11 regulating C. elegans defense, we first used qRT-PCR to profile zip-11 expression in the worms with deficiency in the major immune pathways respectively. Interestingly, we found that loss of PMK-1/p38 signal significantly suppressed zip-11 mRNA level which did not differ between WT worms and DBL-1/TGF-β pathway (dbl-1 and sma-6) or DAF-16/FOXO pathway (daf-2 and daf-16) mutation worms ( Figure 3A ; Figure S3A in Supplementary Material ). Moreover, while P. aeruginosa infection induced the expression and accumulation of ZIP-11 in intestinal nuclei, the suppression of PMK-1 by RNAi dramatically inhibited visible ZIP-11::GFP signal ( Figure 3B ). Additionally, the similar changes of ZIP-11 level was confirmed by western blot ( Figures 3C, D ). These results indicate that PMK-1 signal may regulate immune response in part by controlling the expression of ZIP-11.

We further used survival rate upon P. aeruginosa infection to investigate the genetic relationship between ZIP-11 and the major innate immune pathways. As expected, the attenuated resistance to P. aeruginosa-mediated killing of zip-11(tm4554) worms was suppressed by MAPK pmk-1 RNAi ( Figure 3E ) but not dbl-1 or daf-16 RNAi ( Figures S3B, C in Supplementary Material ). The knockdown of MAPKK sek-1 or MAPKKK nsy-1 also eliminated the sensitive phenotype caused by zip-11 mutation ( Figures S3D, E in Supplementary Material ). In addition, western blot analysis indicated that zip-11(tm4554) worms exhibited lower level of active PMK-1 than that of WT worms ( Figures 3F, G ). Furthermore, seven PMK-1 pathway dependent genes, lys-1, F35E12.5, T24B8.5, clec-85, K08D8.5, F08G5.6 and M02F4.7, were down-regulated in zip-11(tm4554) worms relative to that in WT worms ( Figure 3H ). To confirm the in vivo role of ZIP-11 in the regulation of PMK-1 pathway, a transgenic transcriptional reporter strain of PMK-1 activity that expresses GFP under the control of T24B8.5 promoter was introduced (22). We observed that the T24B8.5p::GFP signal in zip-11 mutation or RNAi worms was lower than that in control worms when fed on E. coli or exposed to P. aeruginosa ( Figure 3I ; Figures S3F, G in Supplementary Material ), suggesting ZIP-11 not only accelerates the inducible immunity, but also the constitutive immunity. The similar activation effect in another transcriptional reporter strain of PMK-1 activity, F08G5.6p::GFP (30), was observed as well ( Figure 3J ; Figures S3H, I in Supplementary Material ). Thus, ZIP-11 promotes the expression of PMK-1-dependent genes by activating PMK-1.

Here, we reveal that PMK-1 signal can positively control ZIP-11 expression, indicating ZIP-11 lies downstream of PMK-1 pathway. On the other hand, ZIP-11 acts upstream of PMK-1 pathway in innate immune activation. These findings give us a notion that there may be a potential feedback regulatory loop between ZIP-11 and PMK-1 pathway.

As bZIP proteins commonly act as dimers, we attempted to identify the interaction partner that interacts with ZIP-11 in C. elegans immune response. A previous study about bZIP transcription factor protein-protein interaction network in vitro identified C. elegans CEBP-2 (CCAAT/enhancer-binding protein 2) as the highest-affinity binding partner for ZIP-11 (31). Here, the coimmunoprecipitation (Co-IP) experiments was performed to investigate the binding relationship between ZIP-11 and CEBP-2. When we co-expressed tagged ZIP-11 and CEBP-2 in 293T cells, we were able to coimmunoprecipitate the two proteins as a complex ( Figure 4A ), suggesting that ZIP-11 and CEBP-2 can physically interact indeed. This interactive relationship was further revealed by GST pull-down assay ( Figure S4A in Supplementary Material ). In addition, the decrease in survival upon P. aeruginosa infection of zip-11(tm4554) worms was abolished by cebp-2 RNAi ( Figure 4B ). Meanwhile, RNAi-mediated zip-11 knockdown can’t further weaken the survival of cebp-2(tm5421) worms upon P. aeruginosa infection ( Figure S4B in Supplementary Material ), indicating that ZIP-11 and CEBP-2 may act in the same genetic pathway in immune regulation. However, cebp-2-defect worms exhibited decreased survival compared to zip-11 mutants ( Figure 4B ), which may attribute to CEBP-2 can interact with various immune-related transcription factors, such as ZIP-2 (32), and plays a pivotal role in innate immune response. Although ZIP-11 and CEBP-2 are expressed in diverse tissues and P. aeruginosa infection can’t make change to CEBP-2, these two bZIP transcription factors exist noticeable co-localization in intestinal nucleus of worms upon P. aeruginosa infection ( Figure 4C ; Figure S4C in Supplementary Material ).

We next examined whether ZIP-11 regulates the expression of target genes known to be induced by CEBP-2 upon P. aeruginosa infection. Considering the previous study have shown that an infection response gene-1 (irg-1) was robustly induced upon P. aeruginosa infection which process is controlled by ZIP-2 and CEBP-2 (27, 32), the reporter strain irg-1p::GFP was introduced to further investigate the relationship between ZIP-11 and CEBP-2 in vivo. Interestingly, upon P. aeruginosa infection, zip-11 mutation significantly reduced the induction of irg-1p::GFP in vector control worms, but not in cebp-2 RNAi-treated worms ( Figures 4D, E ), suggesting irg-1 induction was controlled by ZIP-11 and CEBP-2. To a certain extent, this result also supports the equivalent survival between cebp-2- and zip-11-defect worms upon P. aeruginosa infection ( Figure 4B ; Figure S4B in Supplementary Material ).

Our results showed that there is a connection between ZIP-11 and PMK-1/p38 pathway in innate immune response ( Figure 3 ). However, the induction of irg-1 upon P. aeruginosa infection was independent of the known innate immune pathways, including PMK-1/p38 pathway (27). To further investigate the relationship between CEBP-2 and PMK-1, cebp-2 and irg-1 mRNA levels were examined in WT and pmk-1(km25) worms by using qRT-PCR. We found that not only irg-1 expression, but also cebp-2 expression didn’t rely on PMK-1 signal ( Figure S5A in Supplementary Material ). Meanwhile, RNAi-mediated cebp-2 knockdown further decreased the survival rate of pmk-1(km25) worms ( Figure S5B in Supplementary Material ), which could not alter the activation of PMK-1 ( Figures S5C, D in Supplementary Material ) or the GFP intensity of the two PMK-1 dependent reporters, T24B8.5p::GFP and F08G5.6p::GFP ( Figures S5E – H in Supplementary Material ), suggesting that CEBP-2-mediated immune regulation is independent of PMK-1/p38 pathway.

Taken together, these results indicate that ZIP-11 and CEBP-2 function together to regulate immune genes in the context of pathogenic bacteria infection, which process is independent PMK-1/p38 pathway.

Human activating transcription factor ATF4 (NP_001666.2), which acts as a master regulator and plays crucial role in the adaptation to stresses (33), is the top BLAST hit in the human protein database for C. elegans ZIP-11. ATF4 has a similar domain structure with ZIP-11 and most of the protein is composed of a bZIP domain. The BRLZ (basic region leucine zipper) domain of ZIP-11 shows a strong sequence similarity to that of the evolutionarily conserved basic leucine zipper transcriptional factor in eukaryotes ( Figure 5A ). We next expressed the human ATF4 as a transgene in WT worms using the intestine-specific promoter, and found that the transgene enhanced worm’s survival upon P. aeruginosa infection ( Figure 5B ). These results suggest that human ATF4 may play conserved function in innate immune regulation across species.

Given that ZIP-11 activates innate immune response through conserved PMK-1/p38 and CEBP-2 immune signals. We next investigated whether ATF4 expression induces the key components of these two pathways in C. elegans. As expected, western blot analysis showed that the ATF4-expressed worms had higher levels of active PMK-1 compared with control worms ( Figures 5C, D ). Furthermore, ATF4 expression significantly enhanced the GFP levels of PMK-1-dependent transgene worms, T24B8.5p::GFP ( Figure 5E ). In addition, human ATF4 also induced the expression of PMK-1-independent irg-1 upon P. aeruginosa infection ( Figure 5F ). These results indicate that human ATF4 can activate PMK-1- and CEBP-2-dependent immune signals in C. elegans.

Combined, these data present convincing evidences supporting that human bZIP transcription factor ATF4 can functionally substitute for C. elegans ZIP-11 in innate immune regulation, raising the possibility that it may play a similar role in human.

C. elegans strains were provided by the Caenorhabditis Genetics Center (CGC),which were maintained with standard procedures unless otherwise specified (43). The Bristol strain N2 was used as the reference wild type. The following mutants and transgenic strains were used: zip-11(tm4554), NU3 dbl-1(nk3), LT186 sma-6(wk7), CB1370 daf-2(e1370), CF1038 daf-16(mu86), KU25 pmk-1(km25), KU4 sek-1(km4), cebp-2(tm5421), AU3 nsy-1(ag3), OP761 wgIs761[zip-11::TY1::EGFP::Flag + unc-119(+)], RW11749 stlIs11749[cebp-2p::cebp-2::RFP], HTU388 zip-11(tm4554);aijEx179[zip-11p::zip-11::SL2::GFP + myo-2p::mcherry], HTU392 zip-11(tm4554);aijEx180[ges-1p::zip-11::SL2::GFP + myo-2p::mcherry], TU3311 uIs60[unc-119p::YFP + unc-119p::sid-1], NR222 rde-1(ne219);kzIs9, WM118 rde-1(ne300);neIs9, DCL569 rde-1(mkc36);mkcSi13, VP303 rde-1(ne219);kbIs7, AU78 agIs219[T24B8.5p::GFP], SAL148 denEx26[F08G5.6p::GFP], HTU405 zip-11(tm4554);agIs219[T24B8.5p::GFP], HTU406 zip-11(tm4554);denEx26[F08G5.6p::GFP], AU133 agIs17[irg-1p::GFP + myo-2p::mCherry], HTU431 zip-11(tm4554);agIs17[irg-1p::GFP + myo-2p::mCherry], HTU432 wgIs761[zip-11::TY1::EGFP::Flag + unc-119(+)];stlIs11749[cebp-2p::cebp-2::RFP].

To construct plasmids pXT08 (pjet1.2_zip-11p::zip-11::SL2::GFP::unc-54 3’-UTR), pXT09 (pjet1.2_ges-1p::zip-11::SL2::GFP::unc-54 3’-UTR) or pXT10 (pjet1.2_ges-1p::ATF4::SL2::GFP::unc-54 3’-UTR), the 3.0 kb zip-11 promoter or 2.5 kb ges-1 promoter sequence, the zip-11 or ATF4 coding sequence, the SL2::GFP sequence, and unc-54 3’-UTR sequence were respectively subcloned into pjet1.2 between NotI and NcoI sites using isothermal assembly (44). These two plasmids were microinjected into zip-11(tm4554) worms at a concentration of 50 ng/μl along with myo-2p::mcherry at a concentration of 5 ng/μl to create the zip-11(tm4554);aijEx179[zip-11p::zip-11::SL2::GFP], zip-11(tm4554);aijEx180[ges-1p::zip-11::SL2::GFP] and zip-11(tm4554);aijEx183[ges-1p::ATF4::SL2::GFP] transgenic lines. To construct plasmids pXT11 (pjet1.2_ges-1p::ATF4::unc-54 3’-UTR), the sequence with the deletion of the SL2::GFP was amplified by reverse PCR strategy and using pXT10 as a template, and then was self-fused using isothermal assembly. This plasmid was microinjected into WT worms at a concentration of 50 ng/μl along with myo-2p::mcherry at a concentration of 5 ng/μl to create the aijEx182[zip-11p::ATF4] transgenic line. For the construction of the plasmids pXT11 (pHT48_zip-11::GFP) or pXT12 (pHT48_ATF4::3×Flag), the zip-11 or ATF4 coding sequence, and the GFP or 3×Flag sequence were respectively subcloned into pHT48 between BamHI and XhoI sites using isothermal assembly.

To construct plasmid pXT07 for zip-11 RNAi, the 765 bp genomic sequence of zip-11 (from the start codon to the end of the second exon) was subcloned into the control vector L4440 between NotI and HindIII using isothermal assembly.

The slow-killing assay was performed as described previously (5) with minor modifications. The overnight culture of P. aeruginosa PA14 was seeded on modified NGM (0.35% instead of 0.25% peptone) in 35 mm-diameter plates. Plates were allowed to dry at room temperature and incubated at 37 °C for 24 h and at 25 °C for 8-24 h. Synchronized L4 worms were transferred to the P. aeruginosa PA14 slow killing plates and cultivated at 25 °C. Animals were scored at the indicated times for survival and transferred to fresh slow killing plates daily. Animals were considered dead if they failed to respond when touched. 5-Fluoro-2’-deoxyuridine (FUdR, 50 μg/ml) (Sigma, F0503) was included in the slow killing assay to prevent the growth of progeny and “bagging”. The worms died due to vulva burst or crawling off the plates were censored. Full-lawn P. aeruginosa PA14 plates were prepared for infection. All survival data were performed at least two replicates.

P. aeruginosa PA14 was grown as described above. Bacteria were concentrated 1:5 and heat-inactivated at 65 °C. Synchronized L4 worms were transferred to the plates of modified NGM containing heat- inactivated P. aeruginosa PA14, 50 μg/ml FUdR and 50 μg/ml ampicillin (Sangon Biotech, A610028, China).

The worms were exposed to P. aeruginosa PA14 as described above. After infection for 24 h, worms were transferred to M9 solution containing 25 mM sodium azide (Amresco, 0639) to paralyze the worms and stop the pharyngeal pumping. Worms were washed three times with an antibiotic M9 solution containing 1 mg/ml ampicillin and 1 mg/ml gentamicin (Solarbio, G8170, China) followed by 30 min of incubation in the antibiotic solution to kill the bacteria present on the exterior of the worms. After transfer onto the new NGM plates containing 1 mg/ml ampicillin and 1 mg/ml gentamicin for another 30 min to further eliminate the external P. aeruginosa PA14, the worms were lysed with a motorized pestle. Lysates were serially diluted with M9 buffer and plated on Luria-Bertani plates containing 100 μg/ml rifampicin (Solarbio, R8011, China) to select for P. aeruginosa PA14. After overnight incubation at 37 °C, colonies of P. aeruginosa PA14 were counted to determine CFU per worm. Ten worms were examined per treatment, and at least three replicate assays were performed.

Day 1 adult animals were used for the behavioral assays at room temperature. For the brood size assay, a single L4 worm was transferred to an individual plate. The worms were transferred to fresh plates every other day until laying ceased, and the offspring were subsequently scored for the brood size. For pumping rate assay, the pharyngeal pumping was determined directly under a digital automated microscope (Nikon, AZ100, Japan). For the defecation assay, the enteric muscle contractions (EMC) were scored for each defecation cycle using a dissecting microscope.

Synchronized L1 worms were placed onto NGM plates seeded with E. coli OP50 and grown at 20 °C until the L4 stage. Animals were collected and washed off the plates with M9 solution before being transferred to the modified NGM plates containing E. coli OP50 or P. aeruginosa PA14 for 24 h at 25 °C. Then, the animals were washed off the plates with M9 solution and frozen in TRIzol (Transgen, ER501-01, China). Total RNA was isolated using a TransZol Up Plus RNA kit (Transgen, ER501-01, China) and used for cDNA synthesis via an All-in- One first-strand cDNA synthesis SuperMix kit (Transgen, AT341-02, China). qRT-PCR was performed using SYBR PCR master mix (Transgen, AQ141-02, China) on a Bio-Rad CFX96 real-time PCR machine. Relative fold-changes for the transcripts were calculated using the comparative C_T (2^-ΔΔCT) method and normalized to the tba-1 gene, encoding a tubulin. All experiments were performed in triplicate.

Primer sequences used for qRT-PCR were tba-1: forward TCAACACTGCCATCGCCGCC and reverse TCCAAGCGAGACCAGGCTTCAG; zip-2: forward CGGATTGCCTGACGACTACA and reverse AATAACGGTCCGCTTTCGGT; zip-10: forward TCTGCTGCTCCTGGTAAA and reverse ATAAAGACGGCGATGACG; zip-11: forward CCGTAAACGCCAGCAAAACA and reverse TGAGCCGCTGATTACGATCC; lys-1: forward TTCGGATCTTTCAAGAAG and reverse TGGGATTCCAACAACGTA; F35E12.5: forward ACACAATCATTTGCGATGGA and reverse GGTAGTCATTGGAGCCGAAA; T24B8.5: forward TGCTTCAGAGTCGTGTGTCG and reverse ACGCAGACACCACAGGTTTT; clec-85: forward CCTGATGATAAGTATATT and reverse GGTTTTGGCTGTAGCACG; K08D8.5: forward TTACGATGGTGATTCCGT and reverse GCTTGTTGCCAGTTGAGA; F08G5.6: forward TGGACAACCCAGATATGCAA and reverse GTATGCGATGGAAATGGACA; M02F4.7: forward AAGCATGGGAGGAACACTGG and reverse CTGTCGCGGTAGAAACCCAA; cebp-2: forward AAGCTGTGAACAGAACCCGA and reverse CTGTAGCTGCTCGACCTTTCT; irg-1: forward GACATGGACATCGCAGAGCA and reverse TGCGCGGTACATTACATCCT.

Total RNA was obtained as described above. 1 μg total RNA from each sample was used as input material for the RNA sample preparations. Sequencing libraries were generated using NEBNext^® Ultra™ RNA Library Prep Kit for Illumina^® (NEB, USA) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample. After cluster generation on a cBot Cluster Generation System using TruSeq PE Cluster Kit v3-cBot-HS (Illumina), the library preparations were sequenced on an Illumina Hiseq platform and 125 bp/150 bp paired-end reads were generated.

The clean reads were mapped to the C. elegans genome sequence using Hisat2 v2.0.4. HTSeq v0.9.1 was used to count the reads numbers mapped to each gene. And then FPKM of each gene was calculated based on the length of the gene and reads count mapped to this gene. Differential expression analysis of two groups (three biological replicates per condition) was performed using the DESeq R package (1.18.0). The resulting p-values were adjusted using the Benjamini and Hochberg’s approach for controlling the false discovery rate. Genes with an adjusted p-value < 0.05 found by DESeq were assigned as differentially expressed.

RNAi was performed by feeding worms with E. coli strain HT115 (DE3) expressing double-stranded RNA homologous of target genes as described (45). HT115 (DE3) was grown overnight in LB broth containing 100 μg/ml ampicillin at 37 °C and plated over the NGM plates containing 100 μg/ml ampicillin and 2mM isopropyl 1-thio-β-D-galactopyranoside (IPTG) (Sangon Biotech, A600168). RNAi-expressing plates were allowed to grow for approximately 24 h at room temperature. The L2-L3 larval worms of the corresponding strain were placed on the RNAi plates for 2 days at 20 °C. The gravid adults were then transferred onto the fresh RNAi-expressing bacterial lawns and allowed to lay eggs for 2 h to obtain the second generation of RNAi population. The eggs were allowed to develop at 20 °C to reach the L4 stage for subsequent experimental use. In all experiments, uaf-1 RNAi was included as a positive control to account for RNAi efficiency.

The worm and cell lysate samples were prepared with the lysis buffer in the presence of protease inhibitors (Sigma-Aldrich, 10253286001, L2884-1MG, 10236624001, USA) or protease and phosphatase inhibitors (Sigma-Aldrich, 04906845001, USA). Proteins were detected using the following antibodies: a rabbit anti-GFP polyclonal antibody (Invitrogen, A-11122, USA), a rabbit anti-phospho-p38 MAPK monoclonal antibody (Cell Signaling Technology, 4511, USA), and a mouse anti-β-actin monoclonal antibody (Transgen, HC201-01, China).

Cell transfection and coimmunoprecipitation (Co-IP) were performed as previously described (46). Briefly, 293T cells (CRL-11268, ATCC) were maintained in DMEM medium (Gibco, C11995500BT, USA) with 10% inactive bovine fetal serum (Gibco, 10270106, USA). The cells were transiently transfected with the plasmids expressing CEBP-2-Flag, ZIP-11-GFP, or GFP by using Lipofectamine 3000 transfection reagent (Invitrogen, L3000015, USA). The cells were harvested at around 48 hours post-transfection and washed two times to remove the cell debris (800 g, 3 min). The cells were lysed with ice pre-cooled immunoprecipitation buffer (IPB, 50 mM HEPES, pH 7.7, 100 mM NaCl, 50 mM KCl, 2 mM MgCl₂, 2 mM CaCl₂, 1 mM EDTA, 1 μg/ml pepstatin, 1 μg/ml leupeptin, 2 μg ml-1 aprotinin, 1 mM PMSF) containing 1% Triton X-100 on ice for 60 min, then centrifuged at 20000 g for 10 min at 4°C. Total protein content was estimated by PierceTM BCA Protein Assay Kit (Thermo-Scientific, 23227, USA) following the manufacturer’s protocol. The protein was diluted with IPB (with 0.05% Triton X-100) to a final concentration of 1 ug/ul. The prewashed 20 μl of anti-GFP-Trap-A beads (Chromotek, gta-20, Germany) was added and incubated overnight at 4°C with gentle rotation. The anti-GFP-Trap-A beads were collected by centrifugation at 1000 g for 3 min at 4°C. The beads were washed six times with IPB containing 0.05% (w/v) Triton X-100. After last time wash, the beads were resuspended with 60 μL IPB buffer, the immunoprecipitated proteins were boiled in 3 × Sample buffer with beta-mercaptoethanol for 10 min at 98°C, and analyzed by western blotting. For the western blotting, the primary anti-GFP Rabbit polyclonal antibody (Invitrogen, A-11122, USA) at a 1:3000 dilution or anti-Flag mouse monoclonal antibody (MBL, M185-3L, USA) at a 1:12000 dilution was used, and horseradish peroxidase (HRP)-conjugated goat anti-rabbit (Transgen, HS101-01, China) or anti-mouse (Transgen, HS201-01,China) was used as secondary antibody at a 1:2000 or 1:5000 dilution. The images of blotting membranes were captured by an imaging system (MicroChemi 4.2, DNR Bio Imaging Systems). The coimmunoprecipitation experiment was repeated at least three times independently.

To confirm the interaction of CEBP-2 and ZIP-11, CEBP-2 was expressed as GST-fusion proteins in pGEX-4T-1, and the HEK293T cells were transfected with ZIP-11-GFP plasmid. The cells and bacteria were collected and extracted with working buffer (WB, 50 mM HEPES, pH7.4, 100 mM NaCl, 50 mM KCl, 2 mM CaCl₂, 2 mM MgCl₂, 1 mM EDTA, 1 μg/mL pepstatin, 1 μg/mL leupeptin, 2 μg/mL aprotinin, 1mM PMSF, 1 tablet of protease inhibitor cocktail per 10 mL buffer) containing 0.5% Triton X-100. Equal amounts of GST-fused CEBP-2 or GST protein was added to the cell lysate. Then the pre-washed 25 μl of GST-beads was added to the system, and incubated overnight at 4°C with gentle rotation. The GST-beads were collected by centrifugation at 700 g for 3 min at 4°C. The beads were washed six times with ice cold WB buffer containing 0.1% Triton X-100. After last time wash, the beads were resuspended by 70 μL WB buffer, the pull-downed proteins were boiled in 3 × Sample buffer with beta-mercaptoethanol for 10 min at 98°C, and analyzed by western blotting. For the western blotting, the primary anti-GFP Rabbit polyclonal antibody (Invitrogen, A-11122, USA) at a 1:3,000 dilution or anti-GST mouse monoclonal antibody (Transgen, HT601-01, China) at a 1:1,000 dilution was used, and horseradish peroxidase (HRP)-conjugated goat anti-rabbit (Transgen, HS101-01, China) or anti-mouse (Transgen, HS201-01,China) was used as secondary antibody at a 1:2000 or 1:5000 dilution. The images of blotting membranes were captured by the imaging system. The pull down experiment was repeated at least three times independently.

To observe zip-11p::zip-11::GFP, zip-11p::GFP or cebp-2p::cebp-2::RFP expression, L4 worms were exposed to E. coli OP50 or P. aeruginosa PA14 for 8 to 24 h and paralyzed with 1mM levamisole. The animals were mounted on the agar pad on a slide. An ultra-high resolution spectral confocal microscope (OLYMPUS, FV1000, Japan) was used to capture images. To observe T24B8.5p::GFP, F08G5.6p::GFP or irg-1p::GFP expression, he digital automated microscope (Nikon, AZ100, Japan) was used to capture images. Exposure was constant in each experiment.

Data were presented as mean ± SEM. Survival curves were created using GraphPad Prism 8 (GraphPad, CA). The log-rank (Kaplan-Meier) test was used to analyze the survival data. For fluorescence quantification, the worms in the images were outlined and the signal intensity was calculated by the ImageJ software (NIH, USA). Other data were analyzed by using an unpaired Student’s t-test. The difference was considered significant from control for p-value < 0.05. All experiments were performed at least three times independently.