The long C4B mutant genes for each of these three subjects were amplified in four fragments using long range PCR. The first fragment was 2.3 kb in size and spanned from the promoter region (C4 Pro1) of the C4 gene to exon 1 to exon 9. It was generated by the forward primer C4-Pro1: 5’-CAA GGT CCA GAG TCA ACT CTG C-3’ and a reverse primer at the 3’ end of exon 9 or C4-E9.32: 5’-CCT GGA GAC TAA TGA TGG CTG C-3’. The PCR conditions were one cycle at 94°C for 3 min; 35 cycles at 94°C for 45 s, 64°C for 60 s, and 72°C for 5 min; and one cycle at 72°C for 10 min. This PCR fragment did not differentiate between C4A and C4B genes.

The second fragment was 4.9 kb in size and covered exons 10–26 specific for C4B. It was amplified by a forward primer from exon 10 or C4-E10.5: 5’-GGA GGC AGA GCT CAC ATC CTG-3’ and a reverse primer from exon 26 with C4B specific sequence or C4B-UP: 5’-GCA CCT GCA TGC TCC TAT GTA TC-3’. The PCR conditions were one cycle at 94°C for 3 min; 35 cycles at 94°C for 45 s, 64°C for 60 s, and 72°C for 9 min; and one cycle at 72°C for 10 min.

The third fragment was 3.5 kb in size, corresponding to exons 26–35 specific for C4B, and was produced using a forward primer specific for C4B (at the 3’ end of exon 26) or C4B-down: 5’-GAC CTC TCT CCA GTG ATA CAT AG-3’, and a reverse primer at the 3’ end of exon 35 or C4-35.3: 5’-GAG TCA AAA TAC AGC AGG ACG TG-3’ The PCR conditions were one cycle at 94°C for 3 min; 35 cycles at 94°C for 45 s, 64°C for 60 s, and 72°C for 9 min, one cycle at 72°C for 10 min.

The fourth fragment was 3.6 kb in size, corresponding to exons 33–41 that is common to both C4A and C4B, and was produced using a forward primer at the 3’ end of exon 33 or C4- 33.5: 5’-GGA AGC AAA CGA GGA CTA TGA GG-3’, and a reverse primer at the 3’ end of exon 41 or C4-41.32: 5’-CAG CTT CAT GGT TCC CAG GTT C-3’. The PCR conditions were one cycle at 94°C for 3 min; 35 cycles at 94°C for 45 s, 64°C for 60 s, 72°C for 9 min; and one cycle at 72°C for 10 min (33).

All PCR were performed using the Failsafe PCR amplification kit (Epicentre Technologies, Madison, WI). The four DNA fragments were resolved using low gelling temperature agarose gel electrophoresis, and DNA fragments were excised from gel and purified using a PCR purification kit (Qiagen, Valencia, CA). They were sent to the Eurofins Genomics (Chicago, IL) for Sanger’s DNA sequencing with appropriate primers.

This multiplex family with SLE-related mortality had members consisting of a special HLA haplotype A18 B18 DR7 that is identical to patients with complete complement C4 deficiency, which was caused by a donor site mutation at intron-28 of all C4 genes (33). Thus, we investigated whether members of the E94 family had the same intron-28 splice site mutation of the C4 genes. An approximately 300 bp PCR product was produced using primers I27F (5’-CAA GAC CCT CCT CCC GTT TTC-3’) in combination with the reverse primer MBO-28R (5’-ACT TCA TTC CTC CTC TGA GTC -3’). The PCR conditions were one cycle 3 min at 94°C; 35 cycles of 30 s at 94°C, 30 s at 62°C and 45 s at 72°C, followed by a final extension of 5 minutes at 72°C. PCR products were purified and subject to Sanger’s DNA sequencing as described earlier (33).

To detect the G→A transition causing R729Q variation in exon 17 of C4B gene in HC74 sample, primers C4 E16.5F 5’-GTT GCT GGT CTC AAG GGG TC-3’ and C4 E18.3R 5’-GCC GGG CCG GCA CAC ACT CTC-3’ were used for DNA amplification. PCR conditions were identical to the C-deletion determination (see below). PCR products were digested overnight with restriction NciI enzyme at 37°C and resolved by electrophoresis with a 1.2% agarose gel (33).

To detect the C-nucleotide deletion in exon 17 of the C4B gene (L755 ΔC) in MS630 sample, primers C4 16.5F and C4 18.5R CCTGCAGGATCTCCAGGGCTG were used for DNA amplification. PCR was performed using the Failsafe PCR amplification kit and conditions were one cycle at 94°C for 3 min; 35 cycles at 94°C for 30 s, 62°C for 45 s, and 72°C for 1 min; and one cycle at 72°C for 10 min. PCR products were digested with restriction enzyme EcoNI enzyme at 37°C for 3 hr and resolved by electrophoresis with a 1.5% agarose gel. Genomic DNA for more than 500 White and Black subjects was tested for this mutation.

Sequence-specific Primer PCR (SSP-PCR) was used to determine the G→ A mutation in exons 15 for W660x of the C4B gene using primers C4-14.5F 5’-CTG GAG CTC AGC GTG GAC GGT-3’ and C4-18.3R in E133 family. PCR was performed using the Failsafe PCR amplification kit. The PCR conditions were one cycle at 94°C for 3 min; 35 cycles at 94°C for 30 s, 62°C for 45 s, and 72°C for 75 s; and one cycle at 72°C for 10 min. The PCR products were digested overnight with restriction enzyme AccI at 37°C and resolved by electrophoresis with a 1.2% agarose gel.

This multiplex SLE family came from Austria and Northern Italy. The index patient was a female (E94P) who was diagnosed with lupus at 35 years old and treated with azathioprine and steroids therapy. She developed nephritis with hematuria and proteinuria in the following several years. The main clinical laboratory results were as follows: anti-nuclear antibody (ANA) titer very high at 1:2,560; anti-double stranded DNA detectable at 1:40; anti-SSA (Ro) positive; serum C3 very low at 35.5 mg/dL; C4 very low at 6.4 mg/dL ( Figure 5A ). The patient contracted a fulminant pulmonary infection and died from therapy-refractory septic shock.

The family history of this patient was indicative of hereditary lupus nephritis. Her elder sister (E94-S4) developed severe lupus nephritis and lupus vasculitis at the age of 27. Despite intensified immunosuppressive therapy, her disease progressed to central nervous system vasculitis with intracranial hemorrhage, which became lethal (family pedigree shown in Figure 5A ).

As two family members were diagnosed with renal SLE and died at young ages, we screened other family members - two other sisters, one brother, their parents, two nieces and a nephew for clinical signs of SLE. All other family members were asymptomatic of SLE at the time of recruitment for this study. The father (F) and one sister (S2) had normal clinical laboratory results. However, the mother (M), another sister (S3), the brother (S1), and one niece (N3) had low to borderline low serum C4 protein levels of 12-16 mg/dL (lower limit for healthy subjects: 15 mg/dL). The patient’s mother tested positive for anti-dsDNA (3.6 U/ml) and ANA (1:160). Her brother tested positive for ANA (1:640) and anti-CENP; and two nieces (N1 and N3) tested positive for ANA with relatively low titers (1:80). Limited quantity of genomic DNA from the index patient (E94P), plus blood samples from two of her siblings S1 and S2, two nieces N1 and N3 and a nephew N2 were available for studies of complement C4 genetic diversity ( Figure 5A ).

As shown in Figure 5B , TaqI genomic RFLP demonstrated that E94P and her niece N3 were both heterozygous for LL and SS with two long or two short C4 genes in haplotypes, i.e., a total of four copies of C4 genes. S2 and N2 had LL/LL haplotypes with four long C4 genes; while N1 was heterozygous with LL/LS, three long and one short C4 genes.

On examining the constituents of the RCCX modules, the patient (E94P), her sibling S1 and her niece N3 shared a distinct haplotype characterized by the presence of two short C4 genes (SS) accompanied by two functional CYP21B genes (21B-21B; 3.7 kb; Figure 5B ). In contrast, S2 and N1 each showed a bimodular LL haplotype containing two mutant CYP21A genes (21A-21A; 3.2 kb; Figure 5B ). N2 had regular constituents with one pseudogene and one functional gene for CYP21-hydroxylase, i.e., 21A-21B in each of his bimodular RCCX haplotypes.

Figure 5C with Southern blot of PshAI-PvuII RFLP showed that S2, N1, N2 each had equal copy numbers of C4A genes and C4B genes, which equated to two copies for each of them. S1 and N3 presented with three copies of C4B and one copy of C4A. C4A and C4B gene copy numbers of E94P were determined by quantitative real-time PCR (36), which yielded one copy of C4A and three copies of C4B. The combined results suggested that C4 haplotypes of E94P, sister S1 and niece N3 were C4A-C4B and C4B-C4B.

Long range mapping using PFGE of PmeI digested DNA ( Figure 5D ) for four of the E94 family members confirmed the LL/LL structures for S2 and N2, heterozygous LL/LS for N1, and LL/SS for N3. Subjects C03 to C07 in Figure 5D were control samples with defined monomodular, bimodular and trimodular RCCX structures with different combinations of long and short genes (C03: LL/LS; C04: LL/LL; C05: LSS/LL; C06: LL/LS; C07: LS/L).

Figure 5E showed immunofixation results for C4 protein allotypes for five members of the E94 family. All members had C4A3 and C4B1. Subject N1 had an additional C4B2 allotype. Although subjects S1 and N3 each had one copy of C4A gene and three copies of C4B genes, the intra-individual protein band intensities for C4A3 and C4B1 allotypes in S1, and in N3, were similar. Such phenotypes suggested the possible mutations in two of the three C4B genes in S1 and N3, and likely the index patient E94P that reduced the expression of C4B protein to a level similar to that of C4A.

We investigated into the HLA class I and class II genotypes in this multiplex SLE family. HLA-A, B and DR alleles were ascertained by serology and/or DNA oligotyping. The availability of multiple family members for this study allowed segregations of HLA and RCCX haplotypes, which are shown in Table 3 .

Notably, the index patient E94P had haplotype with HLA-A30, B18 and DR7 that segregated with RCCX: SS, C4Bx-C4Bx, 21B-21B, XA-XB. This A30-B18-DR7-SS haplotype was shared with (a) her SLE sibling S3 who had CNS lupus and lupus nephritis and passed away of intracerebral hemorrhage, (b) another sibling S1 who had high titers of antinuclear autoantibodies (ANA, 1:640) and low level of serum C4 (12 mg/dL), and (c) niece N3 who had low level of serum C4 (14 mg/dL) and exhibited positivity of antinuclear antibodies. The other haplotype of E94P was HLA-A2, B7 and DR15 that segregated with RCCX: LL, C4A-C4B, 21A-21B and XA-XB, which was also present in sibling S2 and niece N2. Subjects S2 and N2 were healthy at the time of recruitment.

The third HLA haplotype of interest in this E94 family was A26, B7 and DR15 that segregated with RCCX: LL, C4A3-C4B1, 21A-21A and XA-XB. This is a carrier haplotype for cytochrome P450 21-hydroxylase (CYP21) deficiency that is one of the causes for congenital adrenal hyperplasia (CAH) (17). Such CAH-carrier haplotype was present in S2 and her daughter N1.

The haplotype with HLA A30 B18 DR7 and RCCX: SS, C4Bx-C4Bx and 21B-21B is identical to two multiplex SLE families in Austria with complete C4 deficiency reported by us previously (33). The molecular basis of C4 deficiency for both C4B genes was a splice junction defect with T to A mutation at the donor site of intron 28 (GT→AT). Thus, DNA fragments spanning exon 28 and intron 28 of C4 genes for six family members, E94P, S1, S2, N1, N2, N3, a completely C4-deficient patient (C4DF1) (33) who was homozygous with this haplotype, plus an unrelated control (GM3104) were amplified by PCR and sequenced by Sanger’s method. Figure 5F highlighted the sequence variations at the exon 28-intron 28 splice junction for those eight subjects. While GM3104 showed homozygous GT and C4DF1 homozygous AT sequences at the exon 28-intron 28 splice junction, three subjects including E94P, S1 and N3 had heterozygous GT/AT exon/intron 28 splice junction sequences. Three other subjects of the family, S2, N1 and N2 had the normal GT- sequences at the corresponding locations. Such results are consistent with the presence of the HLA A30, B18, DR7, RCCX: SS, C4Bx-C4Bx, 21B-21B haplotype in E94P, S1 and N3.

A fourteen-year-old boy was diagnosed with anti-NMDA receptor encephalitis as he presented with hypersomnolence, confused speech with echolalia, self-muttering, dysarthria, mood fluctuation, bilateral upper limbs tremor and headache (39). Immunological determination demonstrated detectable anti-NMDA receptor antibodies in the cerebrospinal fluid but not the serum. He had persistently low serum C4 concentrations (7 mg/dL at the time of recruitment). Treatment with intravenous immunoglobulin and pulsed methylprednisolone showed no effect at the beginning. However, after therapy with two sessions of plasmaphereses that replenished complement deficiency, and four doses of rituximab to suppress B-cell activity, this patient’s conditions improved remarkably. Our earlier case report showed that the patient had RCCX haplotypes LL/L with three copies of long C4 genes (39). Of those C4 genes were two copies of C4A and one copy of C4B. However, no C4B protein was detectable by immunofixation experiment (lane 1, Figure 6A ) and thus patient E133P carried a mutant C4B gene. The patient’s father had homozygous, monomodular-long RCCX (L/L) haplotypes with two copies of C4 genes both coding for C4A protein (lane 3, Figure 6A ) and thus also had a homozygous C4B deficiency (39).

To investigate the molecular basis of C4B-deficiency in this encephalitis patient, coded E133P, genomic DNA for the coding regions of the long mutant C4B gene was amplified by long-range PCR as four separate DNA fragments, as described earlier for HC74 and MS630, and sequenced by Sanger’s method. Sequence analyses identified a G2030A change that knocked out the codon for tryptophan-660 residue to a nonsense stop codon (TGG→TAG, W660x) at exon 15 ( Figure 6B ). The DNA mutation for W660x created a new cleavage site for the AccI restriction enzyme (GTAGAC, Figure 6C ). Thus, DNA fragments of 1.5 kb spanning between exons 14 and exon 18 were amplified by PCR (using primer E14F and primer E18R) from patient E133P, his parents and a maternal stepbrother, a C4B cosmid and three unrelated subjects (A04, HC74 and MS630). The amplified DNA fragments were subjected to AccI digest and resolved by agarose gel electrophoresis ( Figure 6D ). AccI digested fragments of 0.9 kb and 0.6 kb were present in the patient (E133P), his mother (E133M) and maternal stepbrother (E133S), but not in his father (E133F) and four unrelated controls. Genotyping of the HLA class II gene DRB1, class I gene HLA-B and HLA-A were performed using genomic DNA from this E133 family ( Table 2 ). Analyses of HLA haplotypes revealed that the RCCX-LL with *A3 and C4B mutation allele *Bx segregated with HLA-DRB1*04:06, HLA-B*15:27, HLA-A*11:01. The patient’s paternal haplotype with a single C4A gene segregate with HLA-DRB1*04:05, HLA-B*46:01 and HLA-A*11:01 ( Table 2 ).

To facilitate screening of the W660x mutation, a more robust version AccI RFLP analyses was developed. We reduced the amplicon size from 1.5 kb to 600-bp spanning from intron 14 (I-14) to intron 16 (I-16) of C4 genes. This improved method was applied to screen healthy subjects and patients with SLE (11).

The W660x nonsense mutation was firstly detected in an independent East-Asian healthy subject, A-285, residing in the US (panel E, Figure 6 ). This subject had a total of four copies of C4 genes organized in LL/LL structures for RCCX. Among those C4 genes were two copies of C4A and two copies of C4B. The phenotypes of his C4 protein allotypes were A3, A3 and B1, with C4A3 in greater quantity than C4B1, which implied that one of the two C4B genes was not producing a C4B protein. Thus, A-285 likely had heterozygous C4B deficiency caused by the W660x.

Altogether we have screened >1000 subjects (700 healthy subjects and 320 SLE patients) for the presence of W660x mutation in C4B genes. Among the self-reported healthy subjects were 468 East-Asians, 118 European-Americans and 114 African Americans. All SLE patients screened were East-Asians (11). We identified 7 unrelated subjects who were positive for the W660x mutation among healthy East-Asians, a frequency of 1.5% in healthy subjects we screened. Unexpectedly, we did not detect the W660x mutation in anyone of the East-Asian SLE patient samples, or in non-Asian healthy subjects.

Genotyping of HLA-DRB1, HLA-A, B and C were performed on the seven W660x-positive subject. Remarkably, those seven subjects all shared common alleles with HLA-DRB1*04:06, HLA-B*15:27, HLA-C*04:01 and LL for C4A3-C4Bx in RCCX ( Table 4 ). This haplotype with allelic combinations for HLA-DRB1, HLA-B and RCCX-LL is identical to that of the E133 family. Alleles for the more remote HLA-A ( Figure 1A ) exhibited diversity and three shared subtypes were found: *33:03, *24:02 and *11:01/02.

We looked into the C4 protein phenotypes in five of those seven subjects with W660x. Two of the W660x-positive subjects had single copy of C4B gene in a genome and thus manifested homozygous C4B protein deficiency, similar to the case in E133P. The other three subjects had reduced expression of C4B relative to C4A protein as expected.