THP-1 and HEK-293 were purchased from the American Type Culture Collection (ATCC). THP-1 cells were cultured in RPMI supplemented with 10% FBS. HEK-293 cells were cultured in DMEM supplemented with 10% FBS. CD14 monocytes (Lonza) were either untreated for monocytes, or differentiated with M-CSF or GM-CSF (R&D systems) for 7 days to produce macrophages. HAMs were isolated via ex vivo lavage from de-identified lungs rejected for transplant and obtained from Lifeline of Ohio Organ Procurements agency (Columbus, OH) as described (15). All lungs were from subjects with no history of chronic lung disease or cancer and were non-smokers for at least 1 year. After collection, red blood cells were lysed and cells were enumerated and frozen down in FBS and 10% DMSO. Prior to experiments, HAMs were rapidly thawed, added to RPMI (10% FBS, 1% antibiotic/antimycotic). Total concentration and viability of cells were determined with trypan blue staining before seeding. Differentiated human bronchial epithelial (HBE) cultures were supplied by the Cure CF Columbus (C3) Epithelial Cell Core at Nationwide Children’s Hospital as described (16). Briefly, HBE progenitors were isolated from donor airways as described previously, grown for a week to confluency and frozen for later use (17). Progenitor cells were thawed and plated on 0.4 μM pore Transwells (Corning) membranes 12 mm in diameter. Medium in both chambers was replaced with fresh medium every 2–3 days. At 7 days, when the cells were confluent and had formed tight junctions as demonstrated by electrical resistance, the apical medium was removed, and the basal medium was replaced with complete Pneumacult-ALI Medium (STEMCELL Technologies). The medium was replaced with fresh medium and the apical surface was washed with 100 μL of DMEM every 2–3 days for 3 weeks at which time they had become fully differentiated. Murine bone marrow derived macrophage (BMDM) were derived from C57Bl/6 mice. Bone marrow from the femurs and tibias were collected and following RBC lysis cells were resuspended in HEPES-buffered RPMI-1640 containing L-glutamine, penicillin/streptomycin, and 10% HI-FBS with the addition of either recombinant murine GM-CSF or M-CSF. Cells were plated on petri dishes overnight and the non-adherent were passaged to new dishes to allow for expansion and differentiation of macrophages for 7 days. Macrophages were removed from petri dishes, counted, and plated into tissue culture treated wells overnight before experiment initiation. Precision cut lung slices (PCLS) were prepared as described previously (18), Briefly, transplant-rejected lungs were filled with agarose by injecting liquid agar into a lobe via the bronchi. Approximately 1 cm³ of human lung tissue was sliced with a Vibratome into 400µM sections. Tissue was cultured in DMEM containing antibiotic/antimycotic.

Influenza PR8 and influenza CA09 strains were propagated in MDCK cells (ATCC CCL-34) (19). HAMs, CD14 macrophages, and THP-1 macrophages were infected at the indicated MOI for 1 hour, and the media was replaced. Differentiated HBECs were infected with CA09 influenza at the indicated MOI on the apical side of the transwell. After 2 h incubation, the apical layer was washed three times with DPBS to remove unbound virus. PCLS were incubated with 1x10⁵ pfu PR8 and 8x10⁶ pfu CA09 virus for 2 h prior to replacing the media.

IFNLR1 knockout THP-1 cells were generated as described previously (20). Briefly, control sgRNA (#1 GTATTACTGATATTGGTGGG; #2 GTTCCGCGTTACATAACTTA) and sgRNA targeted against IFNLR1 (#1 ACAAGTTCAAGGGACGCGTG; #2 CTCATACTTCAGATCCAGTG) were inserted into the backbone plasmid lentCRISPRv2. HEK-293 T cells were transfected with the 3rd generation lentiviral packaging plasmids pMD2.G, pRSV-Rev, pMDLg/pRRE and the lentCRISPRv2 backbone with the targeting sgRNA. Single clones of THP-1 KO monocytes were generated via lentiviral transduction and selection with puromycin.

Total cellular RNA was collected from cells using the Qiagen RNeasy Miniprep plus Kit (Qiagen), following the manufacturer’s protocol. The cellular RNA was then used to create cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) according to the manufacturer’s protocol. qPCR was performed using SYBR Select Master Mix (Applied Biosystems) according to the manufacturer’s protocol with 20 ng cDNA as a template and primer concentration of 200 nM. Each biological replicate was performed in at least technical duplicate; data was analyzed using the ΔΔCq method. qPCR primer sequences are available in Table 1 .

Immunoblotting was performed as described previously (21). Briefly, cells were lysed in RIPA buffer, sonicated and clarified by centrifugation. Lysates were diluted in SDS protein sample buffer. Proteins were separated by electrophoresis and transferred to a nitrocellulose membrane. Blots were blocked in 5% milk, followed by probing overnight with antibodies. Following addition of secondary antibodies (goat anti-mouse, Biorad, 170–6516, and goat anti-rabbit, Biorad, 170–6515; 1:2000 dilution), membranes were developed using a Western Bright Sirius immunoblotting detection kit (Advansta) and imaged using Biorad imaging software. Single band intensity was quantified using ImageJ software. Antibodies used are available in Table 2 .

Normal control lungs were obtained under a protocol approved by the University of Pittsburgh, Committee for Oversight of Research and Clinical Training Involving Decedents, following rejection as candidate donors for transplant. The whole lung tissue samples were processed as described previously (22). Briefly, tissue for scRNA-seq was diced and enzymatically digested in DMEM (Thermo Fisher Scientific) containing collagenase A and 30 µg/mL DNAase I and further mechanically dispersed using the Miltenyi gentleMACS Octo Dissociator. Single cell RNA library preparation was performed utilizing the 10X Genomics Chromium instrument and its associated V2 single cell chemistry per the manufacturer’s protocol. In brief, 7000 cells were mixed with reverse transcription reagents, loaded into a Single Cell A chip. Cells were separated into oil micro-droplet partitions by the Chromium instrument, containing a cell and a gel bead scaffold for an oligonucleotide composed of oligo-dT, and 10X and UMI barcodes, and reverse transcription reagents. Reverse transcription was performed, the emulsion broken and pooled fractions obtained using a recovery agent. cDNAs were amplified by 11 cycles of PCR (C1000, Bio-Rad), enzymatically sheared and DNA fragment ends were repaired, A-tailed and adaptors ligated. The library was quantified using a KAPA Universal Library Quantification Kit KK4824 (KAPA Biosystems) and further characterized for cDNA length on a Bioanalyzer using a High Sensitivity DNA kit (Agilent). Single cell RNA-seq libraries were sequenced using the Illumina NextSeq-500 through the University of Pittsburgh Genomics Core, Sequencing Facility. ScRNA-seq data can be accessed at the Gene Expression Omnibus: GSE128033.

LDH assay was performed with the CyQuant LDH Cytotoxicity Assay (Invitrogen) according to manufacturer’s instructions.

HAMs were plated for 24h, removed from the plates using ice cold PBS and a cell scraper. Cell were then washed in PBS and resuspended in Fish Skin Gellatin (Fisher, NC0382999) buffer (1% FSG, 0.1% NaN3). Cells were then washed 1x and resuspended in primary antibody and incubated for 30 min at 4°C. After a 2^nd wash with FSG buffer, cells were fixed with 4% paraformaldehyde followed by flow cytometry analysis. Antibodies used are available in Table 2 .

To determine the induction of interferons after influenza infection in human airways, we exposed differentiated human airway epithelial cells to pandemic 2009 influenza virus (CA09). At 24 and 48 h post-infection, the predominant interferons induced in the primary airway cells at the mRNA level were IFNβ, IFNL1, and IFNL2/IFNL3 (qRT-PCR cannot distinguish these isoforms), with IFNL1 and IFNL2/3 being the most upregulated ( Figure 1A ). Consistent with the gene induction, we primarily detected the secreted interferon, IFNL1, in the supernatant of infected cells ( Figure 1B ). To further assess human lung responses, we infected human precision cut lung slices (PCLS) with PR8 and CA09 for 24-72h. Lung slices were viable over the course of the experiment as demonstrated by LDH release ( Figure 1C ). We confirmed that these lung slices were susceptible to infection by measuring the production of viral mRNA (M gene and NS gene) ( Figure 1D ). Infection of PCLS resulted in the robust secretion of IFNγ, followed by IFNL1, and IFNα2, while secreted IFNβ was unchanged (IFNγ>>IFNL1> IFNα2>> IFNβ) ( Figures 1E–H and S1A–D ). These findings indicate that IFNλ is highly induced in the infected human lung environment.

Because we observed significant IFNλ induction in the infected lung, we next examined the expression of its receptor, IFNLR1, via single-cell RNA sequencing. In human lung tissue, IFNLR1 is most highly expressed in the CD163 expressing macrophage population and to a lesser degree in the epithelium ( Figure 2A ). To examine the expression of IFNLR1 in alveolar macrophages in the infected lung, we isolated HAMs from transplant-rejected lungs for in vitro experiments and compared them to undifferentiated CD14 cells and M-CSF differentiated macrophages. We confirmed that HAMs expressed macrophage markers (CD68 and the MHC-II subunit HLA-DR) as well as the alveolar macrophage marker (CD206) ( Figure 2B ). We also observed IFNLR1 expression in GM-CSF macrophages and HAMs, but not in CD14 monocytes demonstrating that differentiation induced IFNLR1 expression, consistent with prior reports (23). Using an IFNLR1 specific antibody, we observed IFNLR1 expression in HAMs via flow cytometry. To confirm that this expression localized to CD206 positive macrophages, we co-stained with IFNLR1 and CD206. Approximately 2/3 of the CD206+ HAM population expressed IFNLR1 ( Figure 2C ). To confirm antibody specificity, we measured IFNLR1 expression in two monocyte cell lines THP-1 and HL-60. We did not observe any CD206 or IFNLR1 signal in these cells ( Figure S2A, B ).

To examine the regulation of IFNLR1 in macrophages, we measured the response of HAMs to exogenous interferons. HAMs displayed a robust ISG induction in response to IFNL1 comparable to IFNβ at 24h, except for ISG15, which was more induced with IFNL1 ( Figure 3A ). Both M-CSF and GM-CSF drive the differentiation of monocytes to macrophages. GM-CSF is also known to be essential for the differentiation of alveolar macrophages and has been implicated in the expression of IFNLR1 (23–25). We therefore examined the regulation of IFNLR1 expression and signaling in our system by both factors. Compared to nearly undetectable levels of IFNLR1 in monocytes, IFNLR1 was highly upregulated by differentiation with both M-CSF and GM-CSF ( Figure 3B ). We then treated differentiated macrophages with IFNL1 to measure the induction of ISGs and confirmed that GM-CSF treated macrophages showed a more robust ISG response to IFNL1 than M-CSF macrophages ( Figure 3C ). Treatment of GM-CSF macrophages with either IFNβ or IFNL1 led to a similar induction of ISGs ( Figure 3D ). We also determined that IFNL1-3 had a similar effect on the induction of ISGs at the same concentration ( Figure 3E ). To examine the role of viral infection in IFNLR1 expression, we differentiated macrophages with GM-CSF, followed by infection with influenza PR8. IFNLR1 mRNA was unchanged in these cells ( Figure S3A ). Murine macrophages have been reported to be unresponsive to IFNλ (26). To examine whether M-CSF or GM-CSF differentiated mouse macrophages responded to IFNλ treatment, we isolated bone marrow macrophages and incubated with either M-CSF or GM-CSF. Ifnlr1 expression was relatively similar with either differentiation protocol, and stimulation with interferons did not regulate the receptor ( Figure 3F ). Although both differentiation procedures led to robust responsiveness to murine IFNβ, there was little to no gene induction after treatment with murine IFNL3 ( Figures 3G, H ) or murine IFNL2 ( Figure S3B ) (mice do not express IFNL1).

We next examined anti-viral responses of M-CSF and GM-CSF differentiated macrophages to infection with influenza. We found that infection of primary macrophages with influenza PR8 ( Figure 4A ) or CA09 ( Figure S4A ) led to a robust increase in both IL-6 and TNFα. Other cytokines examined via multiplex ELISA were unchanged ( Figure S4B ). We next examined interferons produced in response to infection. At the gene level, a wide array of type I and type III interferons were highly induced after PR8 ( Figure 4B ) and CA09 ( Figure S4C ). In contrast to the airway epithelium, IFNα was highly upregulated in macrophages. Of note, when we measured interferons in the supernatant, we found that IFNL1 was the most abundant secreted interferon in both GM-CSF and M-CSF macrophages in response to PR8 ( Figure 4C ) and CA09 ( Figure S4D ). Interestingly, while M-CSF vs. GM-CSF differentiation did not appear to alter the pattern of the cytokine/chemokine response, the magnitude of induction was reduced in the GM-CSF differentiated macrophages compared to the M-CSF differentiated macrophages. Importantly, the levels of viral mRNAs were not significantly altered by the type of differentiation, suggesting that these cells were infected at a similar level but failed to mount a comparable immune response. This effect held true in experiments performed at the same time in identical cell populations ( Figures S5A, B ). Finally, we measured the interferon response in infected HAMs. Concordant with the in vitro differentiated macrophages, HAMs primarily produced IFNλ in response to influenza infection ( Figure 4D ). These results suggest that macrophages are susceptible to influenza infection and contribute to the production of lambda interferons in response to infection.

As both macrophages and epithelial cells produce primarily type III IFN in response to viral infection, we next asked whether IFNλ could inhibit the infection of macrophages. We pre-treated macrophages with IFNL1 for 24h prior to infection with influenza PR8 and assayed mRNA copy number of the two viral replication-dependent mRNAs (M and NS gene). Indeed, IFNλ pre-treatment was protective against PR8 ( Figure 5A ) and CA09 ( Figure 5B ) infection in GM-CSF differentiated macrophages. We also observed decreased production of the inflammatory cytokines TNFα, MIP1α, and MIP1β in cells pre-treated with IFNL1 ( Figures 5C, D ). All three of these cytokines have been demonstrated to contribute to the inflammatory response to influenza infection (27–29). To examine the inhibition of influenza infection in HAMs, we pre-treated with IFNL1 and IFNβ for 8 or 24 hours prior to influenza infection for 24 hours. As measured by the expression of the influenza viral protein M1 and M2, interferon beta led to a robust inhibition of infection, while IFNL1 led to more modest inhibition ( Figure 5E ). Due to its antiviral activity and the high amount of circulating interferon lambda in the lung, IFNLR1 likely plays a key role in the inhibition of macrophage infection.

The above data suggest a key role for IFNλ in conferring anti-viral immunity. We next assessed how the IFNλ receptor alters influenza virus infection. Thus, we knocked out IFNLR1 in the THP-1 myeloid cell line. As with CD14 monocytes, THP-1 monocytes do not express IFNLR1. However, after PMA mediated differentiation, IFNLR1 mRNA was significantly increased compared to untreated THP-1 ( Figure S6A ). Differentiation also increased IFNLR1 protein ( Figure S6B ). Treatment of differentiated THP-1 with IFNL1 led to the induction of the ISG IFIT3 ( Figure S6C ). We confirmed IFNLR1 knockout by genomic DNA sequencing ( Figure S6D ) and immunoblotting ( Figure 6A ). To measure IFNLR1 activity in knockout cells, we treated differentiated wild-type (Wt), sgRNA control (sgCon), and two clonal lines of IFNLR1-KO cells (sgIFNLR1 clone #1, sgIFNLR1 clone #2) with IFNL1 and measured the phosphorylation of STAT1. Knockout of IFNLR1 inhibited IFNλ signaling as expected ( Figure 6B ). To examine how IFNLR1 alters the response to influenza infection, we infected IFNLR1-KO macrophages with PR8 and measured the expression of ISGs. Multiple ISGs were significantly reduced in IFNLR1-KO cells vs. control lines despite expressing moderately higher levels of viral mRNA, suggesting an increased susceptibility to infection ( Figures 6C, D ). The inhibition of the ISG response was also confirmed in a second IFNLR1-KO clonal cell line ( Figure S6E ). In contrast to the decreased interferon response, and consistent with the increase in viral mRNA, we observed an increased in several secreted cytokines IL1-β, TNF-α, IL-6, and MIP1-α in infected IFNLR1-KO cells. Interestingly, MIP1-β and MCP-1 secretion was reduced in IFNLR1-KO THP-1, potentially because the interferon pathway is required for the transcription of these genes (28, 30) ( Figures 6E, F ). Alveolar macrophages are both the direct targets of infection, and respond to secreted interferons produced by neighboring airway epithelial cells. To assess cross-talk between human airway epithelia and macrophages, we incubated sgCon and sgIFNLR1 THP-1 cells with supernatants of CA09 infected or non-infected primary differentiated human airway epithelial cells (supernatants characterized in Figure 1B ). Treatment of control sgRNA THP-1 cells with virus-infected supernatant that (containing lambda interferons) resulted in the upregulation of a number of ISGs ( Figure 6G ). However, IFNLR1 depleted THP-1 had a significantly abrogated influenza media-stimulated ISG response compared to sgCon THP-1 treated with the same media. Collectively, these observations strongly suggest that IFNLR1, via engagement of its IFNλ ligands, is crucial for mediating anti-viral immunity.