TM3 cells (mouse Leydig cell line) were obtained from the Kunming Cell Bank, Kunming Institute of Zoology, Chinese Academy of Science. TM3 cells were cultured in Dulbecco’s Modified Eagle Medium and Ham’s F-12 medium (DMEM/F12) (Gibco, USA) supplemented with 5% fetal bovine serum (FBS) and, 2.5% horse serum, 100 U/ml penicillin and 100 μg/ml streptomycin in 5% CO₂ at 37°C. Male 6- to 8-week-old male C57/B6 mice were purchased from the Animal Resource Center at the Kunming Institute of Zoology. Institutional Review Board approval was obtained from our institute for this study. All mice were kept under specific pathogen-free conditions and all animal experiments were conducted in accordance with the guidelines and were approval of the Kunming Institute of Zoology, Chinese Academy of Sciences Animal Care and Use Committee (SMKX-2019031).

Urban particulate matter, PM (1648a, NIST, USA), lLipopolysaccharides from Escherichia coli O111:B4 (L2630, Sigma, USA) and Pyrrolidinedithiocarbamate ammonium, PDTC (PDTC, T3147, TargetMol, China) and aspirin (HY-14654, MCE, China) were used in this study. PM was suspended in PBS to make a final concentration of 10 mg/ml. 6- to 8-week-old male C57/B6 mice were intranasally inoculated with 400 μg of PM (40 μl) every day for 7 days. For drugs administration, mice were intraperitoneally injected with PDTC (30 mg/kg) or intragastrically administered with aspirin (20 mg/kg/day) 1 hour before PM exposure according to the instructions and established studies (25–27).

The lungs of mice were fixed in 10% formalin and the left side of testes were fixed in Bouin fix solution (SL1590, Coolaber, China). After fixation, 5-μm tissue sections were prepared and stained with H&E and examined.

Single-cell suspensions of the lung samples were prepared by mechanical pressing and filtering through 70-mm cell strainers. Cells were stained as per our previous study (28) and the following antibodies were used. Mouse Integrin alpha M/CD11b Alexa Fluor^® 405-conjugated antibody (FAB1124V, abcam); anti-mouse LY-6G (RB6-8C5)-APC (17-5931-81, eBioscience); and ICAM-1 monoclonal antibody (YN1/1.7.4)-Pacific Blue (A15404, eBioscience). Fluorescence Activated Cell Sorter (FACS) analysis was performed on a BD FACS Calibur flow cytometer. Data analysis was performed using Flowjo v10 software.

For PM exposure, the TM3 cells in free antibiotics medium were seeded into 12-well plates at ~1 × 10⁶ cells/well. Cells were exposed to PM with or without PDTC, and aspirin administration for indicated times. Cells were lysed in Radio-Immunoprecipitation Assay buffer (RIPA buffer) with protease (HY-K0010, MCE) and phosphatase inhibitors (HY-K0022, MCE) for immunoblot analysis and lysed in TRIzol reagent (Invitrogen) for RNA isolation.

TM3 cells were transiently transfected with pGFP-C-shLenti vector containing cGAS shRNA (GTTCAATCTATTCTCTCAAGAACTAATTG) or p65 shRNA (#1 GCATGCGATTCCGCTATAAAT, #2 GGAGTACCCTGAAGCTATAAC, #3 AGCGAATCCAGACCAACAATA) with lipofectamine 3000 transfection reagent (Thermo Fisher Scientific) according to manufacturer’s protocol. The transfected cells were incubated for 48–72 h at 37°C and the knockdown efficiency was analyzed by western blot before further experiments.

Total RNA was isolated from cells and tissues by using TRIzol reagent (Invitrogen). cDNA was reverse-transcribed by using M-MLV reverse transcriptase (M1705, Promega, USA). Real-time qRT-PCR was performed on the StepOnePlus Real-Time PCR Systems (Thermo, USA). All primer sequences are listed in Supplementary Table 1 .

RNA-seq and data analysis were performed by a commercial service (Novogene, China). A log₂ fold-change of 1 was set as the threshold for significantly differential expression. The heatmap was generated by using GraphPad v8.0 software to show the normalized gene expression.

Nuclear protein was isolated using a NE-PER™ Nuclear and Cytoplasmic Extraction kit (78833, Thermo Fisher Scientific) according to the manufacturer’s manual. Total proteins were extracted from cells or tissues for western blotting analysis. Primary antibodies included: anti-cGAS (sc-515803, Santa Cruz), anti-ICAM1 (ab179707, Abcam), anti-VCAM1 (ab134047, Abcam), anti-p-IκBα (2859L, CST), anti-IκBα (9242L, CST), anti-p-p65 (3033, CST), anti-p65 (8242, CST), anti-lamin B1 (13435S, CST), anti-GAPDH (T0004-50, Affinity Biosciences) and anti-β-actin (sc-81178, Santa Cruz). Secondary antibodies included horseradish peroxidase (HRP)-labeled anti-rabbit, anti-mouse, and anti-goat antibodies (KPL). Total proteins were separated by 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and electro-transferred onto a polyvinylidenedifluoride (PVDF) membranes (Roche, Germany). The PVDF membranes were blocked with TBST (2.42 g/L Tris base, 8 g/L NaCl, 0.1% Tween 20, pH 7.6) containing 5% non-fat dried milk (BD, USA) at room temperature for 2 h. After washing three times with TBST, the membrane was incubated overnight with primary antibodies at 4°C, then incubated with the secondary antibodies for 1 h at room temperature. After washing with TBST, the membrane were developed with an enhanced chemiluminescence kit (TIANGEN, China) on an ImageQuant LAS 4000 mini system (GE Healthcare Life Sciences).

Sperm were collected from the cauda epididymides of mice. Sperm morphology analysis and sperm count were determined according to previous studies (14, 15). Abnormal sperm morphology rates were calculated by counting all sperms with abnormal heads or tails. Sperm motility was analyzed using a computer-aided sperm analysis system with Hamilton Thorne IVOS II (Beverly, MA, USA).

Cells were fixed in 4% paraformaldehyde for 15 min at room temperature and were then permeabilized with 0.3% Triton X-100 (T0694, Amresco) for 20 min, washed with PBS, and blocked in 2% BSA for 1 h. Cells were stained with antibodies overnight at 4°C. After washing, cells were stained with a fluorescence-conjugated secondary antibody with FITC-Phallodidin (40735ES75, Yeasen) for 30 min, and mounted using ProLong Gold Antifade Reagent with DAPI (8961S, CST).

For cryosections, tissues were harvested and fixed as mentioned above. The 5-μm sections were washed with PBS and blocked with the blocking buffer. The sections were stained with primary antibodies anti-CD11c (AP-MAB0814) and anti-F4/80 (ab6640, Abcam) at 4°C overnight. After washing, slides were stained with secondary antibodies for 30 min, and mounted using ProLong Gold Antifade Reagent with DAPI (8961S, CST). Immunostaining was detected with an Olympus FluoView 1000 confocal microscope (Olympus, Melville, NY, USA). The intensity of signaling was quantified by ImageJ 1.8.0 software (National Institutes of Health, USA).

Mitochondria abundance was analyzed according to the previous study (29). ATP levels were determined by using a ATP detection kit according to the instruction (S0027, Beyotime, China).

The cGAMP extraction from cells was carried out according to the previous research (30). After PM stimulation, the cells were washed with PBS and lysed with 1 mL of cold extraction solvent (40:40:20 (v/v/v) methanol-acetonitrile-water). The cell lysates were stored at -20°C for 1 hour and then centrifuged at 16,000×g for 5 min. The supernatants were lyophilized on the lyophilizer and the pellets were resuspended in 200 μL of ammonium acetate buffer (10 mM ammonium acetate, 0.05% acetate in water). After centrifugation at 16,000×g for 10 min, the supernatants were quantified by liquid chromatography-MS/multiple reaction monitoring (LC-MS/MRM).

The LC-MS/MS system consisted of an Acquity H-Class UPLC system, coupled to a Xevo TQ-S Micro Tandem Mass Spectrometer (Waters, Manchester, UK). Chromatographic separation was performed by injecting 10 μL of supernatant onto a Waters Acquity UPLC HSS T3 column (2.1 × 50 mm, 1.8 μm particle size, Waters). The mass spectrometer was operated in electrospray positive ionization mode, with capillary was maintained at 2.5 kV and the source temperature of 150°C The desolvation gas flow and temperature were 600 L/h and 350°C, respectively. The cone voltage was 60 V for all analytes with a source offset of 30 V. Transitions were monitored in multiple reaction monitoring (MRM) mode with a dwell time of 0.091 s.

Two-way analysis of variance (ANOVA) and Fisher’s least significant difference (LSD) tests were used to analyze the bodyweight changes in mice. Statistical analysis was performed using two-tailed Student t-test and log-rank tests where applicable. A P-value ≤ 0.05 was considered significant. All data analyses were performed using GraphPad Prism 6 (GraphPad Software, USA).

A broad consensus is that inhaled PM with small particle size can enter the blood circulation and then consequently affect other organs. To determine the effects of PM on mice, 8-week-old male mice were exposed to 400 μg of PM per day. After 7 days, the PM-exposed mice developed severe pneumonia-like symptoms. Inflammatory cells in the lungs of mice were significantly increased after PM exposure ( Figure 1A ). FACS analysis showed that the percentages of neutrophils and ICAM-1⁺ cells in the lungs of mice were also increased after PM exposure ( Figure 1B ). Furthermore, inflammation of other tissues was observed ( Supplementary Figure 1 ). In the testes, the empty areas of seminiferous tubules were remarkably enlarged after PM exposure ( Figure 1C ). This type of lesion often occurs when the testis of mice become senile, inflamed or injured. Therefore, we examined the expression levels of certain inflammatory cytokines in the lungs and testes of these mice. As shown in Figure 1D , the expression levels of Il6 and Tnfa in the lungs and testes sample were up-regulated after PM exposure. These observations suggested that PM exposure in not only causes pulmonary inflammation, but also inflammatory injury of the testes.

To determine the role of PM in testicular inflammation, we performed genome-wide expression analysis to profile differentially expressed genes in mouse Leydig cells with or without PM administration. Among the genes significantly upregulated after PM treatment, most were involved in NF-κB signaling ( Supplementary Figure 2A ). This finding suggests that PM may induce testis inflammation via activation of NF-κB signaling in mouse Leydig cells. As predicted, levels of phosphorylated IκBα and p65, which are critical for NF-κB signaling activation, were significantly up-regulated in the mouse Leydig cells after PM treatment ( Figure 2A ). Moreover, the nuclear localization of p65 in TM3 cells was markedly induced after PM administration ( Figure 2A ). Consistently, confocal immunofluorescence analysis also revealed that PM-induced nuclear localization of p65 in TM3 cells ( Supplemetary Figure 2B ). As NF-κB signaling regulates the expression of many inflammatory genes, the expression levels of representative genes regulated by NF-κB signaling were analyzed in the presence of LPS, PM, or NF-κB specific inhibitor (PDTC). As shown in Supplementary Figure 2C , the expression levels of Mcp1, Il6, Cxcl1 and Cxcl9 were up-regulated after PM and LPS treatment but were reduced after co-administration of PDTC. This observation was further confirmed by using p65 knockdown cells ( Figure 2B ). At 3-days post-PM exposure, the phosphorylation levels of IκBα and p65 and the levels of ICAM-1 and VCAM-1 were increased in the mouse testes ( Supplementary Figure 2D ). Notably, PDTC administration dramatically diminished the phosphorylation levels of IκBα and p65 and the levels of ICAM-1 and VCAM-1 in the testes ( Supplementary Figure 2D ). At 7 days post-PM exposure, the enlarged empty areas of seminiferous tubules were substantially reduced after PDTC administration ( Figure 2C ). An earlier study suggested that PM may impair spermatogenesis and decrease sperm counts in mice (15). Here we found an increase in abnormal sperm morphology after 7 days of PM exposure, with PM-induced sperm abnormality was altered after PDTC administration ( Figure 2D ).

Mammalian testes are immunoprivileged sites where systemic immune responses are strictly controlled (31). Considerable effort has been made to understand testicular immunoregulation in mammalian testes and recent progress has been comprehensively reviewed (16, 32). The blood-testis barrier (BTB) is formed by tight junctions between Sertoli cells near the basal lamina of the seminiferous epithelium and is important for maintaining normal testis homeostasis (16). Disruption of the BTB or immune homeostasis by stimuli can lead to immune cell invasion in the testes and impaired male fertility (16). According to the above, it is quite clear that PM exposure activates NF-κB signaling and impairs the spermatogenesis in mice. Consistently, we found that more dendritic cells and macrophages invaded the lumen of seminiferous tubules after PM exposure, while PDTC pre-administration attenuated the invasion of these cells ( Figure 2E ). Collectively, these data indicate that inhibition of NF-κB signaling by PDTC reduces inflammation and immune cell invasion in testis and may in turn attenuates PM-induced asymptomatic orchitis in mice.

To understand the mechanism underlying the activated inflammatory responses after PM exposure, we considered that exposure may induce self-mtDNA release (33). As shown in Figure 3A , PM administration significantly affected the mitochondria abundance and ATP levels in mouse Leydig cells. Self-DNA can trigger powerful immune responses and regulate NF-κB signaling through the cGAS-cGAMP-STING axis (34). Therefore, we analyzed cGAMP levels and signaling transduction after PM administration in mice. Aspirin was set as a control as it can directly acetylate cGAS and suppress cGAS-mediated immune responses (30). Results showed that PM indeed induced higher level of cGAMP in mouse Leydig cells ( Figure 3B ). The phosphorylation levels of STING, IRF3 and TBK1 were increased after PM treatment, but were dramatically diminished after aspirin administration ( Figure 3C ). The expression levels of Il6, Tnfa, Ifnb and Cxcl10 were further analyzed post PM treatment with or without aspirin (20, 50, or 100 μg/ml) pre-treatment. As shown in Supplementary Figure 3 , the genes up-regulated after PM exposure were suppressed by aspirin administration. Consistently, the suppression effect was significantly reduced in cGAS knockdown TM3 cells ( Figures 3D, E ). These results indicate that PM exposure induces mitochondrial injury and mtDNA release, causing inflammation via cGAS-STING in vitro, which can be reduced by aspirin pre-treatment.

We next investigated whether aspirin can alleviate PM-induced orchitis and other adverse effects. As shown in Figures 4A, B , at 7 days post exposure, intragastric administration of aspirin greatly attenuated the PM-induced sperm abnormalities and mobility reduction. Aspirin-induced acetylation of cGAS inhibited inflammation in mice after PM exposure ( Supplementary Figure 4 ). In addition, we found that the protective effect of aspirin is retained for at least 3 days post stopping asipirin administration ( Supplementary Figure 5 ). Consistently, the invasion of dendritic cells and macrophages in the lumen of seminiferous tubules after PM exposure was also attenuated ( Figure 4C ). Furthermore, at 7 days post exposure, the enlarged empty areas of the seminiferous tubules found after PM exposure were remarkably reduced after aspirin pre-treatment ( Figure 4D ). At 7 days post-treatment, the PM-exposed and unexposed male mice were bred with healthy females. As low quality sperm may lead to dysontogenesis of their offsprings, We further explored the consequences of PM-induced orchitis and aspirin administration on the growth and development of the mouse offsprings. Notably, the offspring of PM-exposed paternal mice grew more slowly than that of the control group ( Figure 4E ). However, this PM-induced effect on offspring was significantly reduced for those mice taking aspirin ( Figure 4E ). It is known that long term aspirin intake may have hemorrhagic complications (35). According to Supplementary Figure 6 , we found that the hemorrhagic spot in the livers of mice emerged from day 11 post aspirin administration. Thus, these results indicate that pre-treatment of aspirin alleviates PM exposure induced orchitis in mice and rescues growth of their offspring.