All the reagents used in the study are listed in the Table 1 .

Human peripheral blood mononuclear cells (PBMC) were isolated from fresh cytapheresis ring from healthy donors obtained from the Etablissement Français du Sang (Nantes, France). Written informed consent was provided according to institutional guidelines. Human T cells were isolated by negative selection with the Miltenyi’s Pan T-cell isolation kit according to the manufacturer’s protocol. Jurkat T cells (ATCC, clone E6-1) were cultured at 10⁵ cells/ml in complete RPMI medium (10% GE Healthcare HyClone™ Fetal Bovine Serum (Chicago, IL, USA), 1% penicillin-streptomycin Gibco^® (Waltham, MA, USA), 1% glutamine, 1% sodium pyruvate Gibco^®, 1% Hepes Gibco^®, and 1% MEM NEAA Gibco^®) at 37°C, 5% CO₂.

The GeneArt CRISPR Nuclease Vector kit (Life Technologies, Carlsbad, CA, USA) was used. Guide RNAs for SIRPγ and CD47 were selected thanks to the CRISPOR website. The following were the sRNA selected: sgRNA anti-SIRPg #1 TTCCCGTGGGACCCGTCCTG TGG, sgRNA anti-SIRPg #2 TAGTATGTGCCGACATCTGC TGG, sgRNA anti-CD47#1 CTTGTTTAGAGCTCCATCAA AGG, and sgRNA anti-CD47#2 TCCATGCTTTGTTACTAATA TGG; PAM sequence is indicated in italic. Briefly, Jurkat cells suspended in Opti-MEM (Gibco) medium at 10⁶ cells/ml were electroporated with a NEPA21 (Nepalgene) and placed immediately in warm complete RPMI medium in six-well plates and incubated at 37°C, 5% CO₂. After amplification, cells were stained using anti-SIRPγ mAb and/or anti-CD47 mAb for FACS sort with the ARIA II (BD Biosciences, Franklin Lakes, NJ, USA) depending on the nonexpression of the corresponding epitopes: SIRPγ, CD47. Sorted cells were amplified for ulterior use. Genomic DNAs were extracted, and PCR amplified with the following primers SIRPγ F1 5′-GCCTCAGTGCCCTCAATTGT-3′; SIRPγ R1 5′-GGGATGAGGGAGGTCCATGT-3′; SIRPγ F2 5′-TGTGCACCCAGTCACTGAATA-3′; SIRPγ R2 5′-GGGGTGACAACAGGTCTTGA-3′; CD47 F1 5′-CTTCAAAGCTTCCAAAGCCAGA-3′; CD47 R1 5′-AAGAGGATCAGGTTGCACCA-3′; CD47 F2 5′-ACTACACCTGCATGTTCCAA-3′; and CD47 R2 5′-CAGGTTGCACCAGGACAAAT-3′.

Jurkat SIRPγ-KO cells were then transduced with lentivirus encoding OST-SIRPγ. SIRPγ expression on transduced cells was higher than in their WT counterpart. SIRPγ^high cells were FACS sorted and amplified for ulterior use.

For human SIRPα-binding assay, recombinant human SIRPα was immobilized on plastic at 0.5 µg/ml (SIRPα) in carbonate buffer (pH 9.2). After saturation, purified antibodies were added in range (from initial concentration at 10 µg/ml) to measure binding. After incubation and washing, peroxidase-labeled donkey antihuman IgG was added and revealed by conventional methods.

For human SIRPγ-binding assay, purified antibodies were captured in range (from initial concentration at 5 µg/ml) with a coated donkey antihuman IgG (H+L) immobilized at 2 µg/ml in borate buffer. After washing, biotinylated SIRPγ (#11828-H08H, SinoBiological, Beijing, China, biotinylation performed by OSE Immunotherapeutics, Nantes, France) was added at 1 µg/ml and detected by streptavidin peroxidase, then revealed by conventional methods.

PBMC, isolated by Ficoll from blood sample, were incubated with human Fc receptor-binding inhibitor diluted at 1/50. Then, antibodies were incubated for 30 min at 4°C and washed before being stained 30 min at 4°C with PE-labeled antihuman IgG Fc and with a mix of 50-fold diluted antibodies to determine cell subpopulations (CD3⁺ for T lymphocyte and CD14⁺ for monocyte). Samples were analyzed on CytoFlex cytofluorometer (Beckman Coulter France, Villepinte, France) after gating on different subpopulations.

For antagonist activity, enzyme-linked immunosorbent assay (ELISA) assay, recombinant human SIRPγ, or recombinant human SIRPα were immobilized on plastic at respectively 2 µg/ml (SIRPγ) and 0.5 µg/ml (SIRPα) in carbonate buffer (pH 9.2). During saturation, biotinylated human CD47 were preincubated at a unique concentration (final concentration at 3 µg/ml) with purified antibodies in range at room temperature for 15 min. Preincubated (CD47-biot/purified antibodies) mixes were then incubated on immobilized SIRPγ (O/N at room temperature) or on immobilized SIRPα (for 2 h at 37°C). After incubation and washing, streptavidin-peroxidase was added and revealed by conventional methods.

PBMC (10⁵ per well) were suspended in 200 μl of FACS buffer (phosphate-buffered saline 1×, 1% bovine serum albumin, Sigma-Aldrich, 0.1% Azide Sigma-Aldrich, St. Louis, MO, USA) and plated in a V-bottom 96-well plate prior to being centrifuged at 2,500 rpm for 1 min. For the extracellular staining, cells were labeled with a mix of antibodies for 30 min on ice. For the intracellular labeling, BD Cytofix/Cytoperm kit was used according to the manufacturer’s protocol with recommended volume of intracellular antibodies. Cells were washed twice before analysis on the LSRII (BD Biosciences). After the acquisition, data were analyzed using FlowJo software.

Purified T cells were stained with anti-CD4, anti-CD25, and anti-CD127 for 30 min at 4°C in the dark, cells were washed, and DAPI was added to discriminate dead cells. Cells were then sorted using the ARIA II (BD Biosciences). Tregs and effector T cells were further stained with two different cell proliferation dyes (CPD) for 10 min at 37°C and cultured either alone (control conditions) or together, in U-96-well costar plates previously coated or not with anti-CD3 (clone OKT3) at 2 µg/ml. When indicated, soluble anti-SIRPα/γ (KWAR23) antibody was added at 10 µg. After 5 days in culture, T-cell proliferation was assessed by flow cytometry using the LSRII (BD Biosciences).

T cells were stained with CPD prior to be activated in plates coated with 0.5 µg/ml of anti-CD3 (OKT3) and 2–3 µg/ml of soluble anti-CD28.2. Cells were incubated 3 or 5 days at 37°C, 5% CO₂, then assessed by flow cytometry. In some experiments, T cells were stimulated with 0.5–1 µg/ml of coated OKT3 with or without coated CD47-Ig (10 µg/ml).

PBMC at 7.5 × 10⁶ were stimulated in complete medium three times in six-well plates coated with 3 µg/ml of anti-CD3 (OKT3) and 3 µg/ml of soluble anti-CD28.2. Each stimulation is consist of a 48–72-h culture in six-well plates coated with 3 µg/ml of anti-CD3 (OKT3) and 3 µg/ml of soluble anti-CD28.2. Each time, cells were washed and counted prior to be restimulated. Chronically stimulated PBMC were then cultured for 48 h in plates coated with 0.5 µg/ml of anti-CD3 (OKT3) and 10 µg/ml of human CD47-Fc recombinant protein in the presence or not of mAbs targeting the SIRP/CD47 interactions. Supernatants were collected after 48 h of stimulation with OKT3 and CD47-Fc to measure IFN-γ secretion, and cell fitness was analyzed by Alamar Blue detection at 530 nm after 5 days stimulation.

Jurkat, resting, or activated T cells were stained for 30 min at 4°C in the dark with an anti-SIRPγ (LSB2.20) and an anti-CD47 mAb. Cells were fixed with PFA at 4% for 10 min at room temperature (RT), permeabilized with PBS + 0.1% Triton for 5 min at RT, and further stained with DAPI for 5 min at RT in the dark. ProLong was added to the cells and the solution carefully place between a glass slide and a 12-µM round coverslip and left for at least 48 h polymerization before being analyzed with confocal microscopy (Nikon Super Resolution SIM Confocal A1) using the NIS software. The images obtained were analyzed using ImageJ software.

SIRPγ and CD47 colocalization was analyzed using ImageJ software. Briefly, a region of interest (ROI) was drawn on the whole cell surface and analyzed with coloc2 plugin.

IBIDI (Gräfelfing, Germany) 8-well slides were coated with poly-l-lysine at 0.001%. Raji cells were primed with 10 ng/ml of SEE for 30 min at 37°C, and WT or SIRPγ^high Jurkat cells were stained with a cell tracker green for 15 min at 37°C, washed thoroughly then stained with an anti-SIRPγ mAb (clone LSB2.20) for 30 min at 4°C. Cells were then washed, and Raji and Jurkat cells were deposited in the IBIDI slide. Once the cells are stabilized, the time lapse video starts. To assess the role of SIRPγ in the synapse formation, SIRPγ/CD47 interaction was blocked on SIRPγ^high cells for 15 min at 37°C with the KWAR23 mAb at 10 µg/ml, then mixed with Raji for 15 min prior to be plated in IBIDI wells. SIRPγ polarization into the synapse was analyzed using ImageJ software. Briefly, a ROI was drawn at the cell/cell contact between Jurkat and Raji and the intensity of pixels for SIRPγ channel was analyzed. The same ROI was then moved at the opposite side of the synapse to measure the intensity of pixels for SIRPγ channel. For control condition, cells were divided randomly in half and the intensity of pixels for SIRPγ channel was measured on the two parts of the cells. The size of the ROI does not influence the intensity of pixels measured.

We used a xeno-GvHD model of immunodeficient mice to assess the role of SIRPγ in GvHD occurrence. NSG mice were purchased from the Jackson Laboratory (Bar Harbor, ME) and bred by the LabEx IGO humanized rodent platform. Mice (males and females) were used between 8 and 12 weeks old. All animals were housed under specific pathogen-free conditions, according to institutional guidelines. NSG mice were irradiated at 1.5 Gy on Day 0 prior to an i.v. injection of 10⁷ human PBMC from healthy volunteers on Day 0. Mice were treated 2 times/week with PBS or anti-SIRPα-γ (KWAR23 mAb) at 5 mg/kg from D1 to D42. Human cell engraftment and weight lost were monitored during the experiment. If losing more than 20% of its maximum body weight, the mice were sacrificed. Human chimerism analyzed by flow cytometry is calculated as follows: (% of hCD45)/(% of hCD45 + % of mCD45) * 100. The relative number of CD4/CD8 T cells in the spleen is calculated as follows: (% human chimerism in spleen) * (% human CD4/CD8 in spleen). This study was carried out according to authorization from the French Ministry of Research, APAFIS # 4678. Intraperitoneal residual macrophages were collected as previously described in {Ray:2010cp}. Fc block was added to the cells following manufacture recommendation prior the incubation with the antibodies.

KWAR23 mAb is a recombinant antibody which has been selected after immunization with a SIRPα recombinant molecule by Ring and collaborators (18). Given the homology of 79% when comparing the extracellular portions of the SIRPα, SIRPγ, and SIRPβ (15), we hypothesized that KWAR23 could also recognize other SIRP protein family members. We directly addressed this question by labelling human cells which are known to either uniquely express SIRPα, i.e., monocytes or described to express SIRPγ, i.e., T lymphocytes. KWAR23 efficiently binds 100% of monocytes when the concentration used is sufficient as does the anti-SIRPα-specific mAb ( Figures 1A, B , left panels); similar results were obtained when U937 (SIRPα⁺ cell line) were stained (data not shown). Interestingly, increased concentration of KWAR23 resulted in T-cell staining which reached a plateau when 60% of human T cells were stained. No binding was seen with the anti-SIRPα-specific mAb (clone 18D5), suggesting that KWAR23 recognizes a molecule other than SIRPα, presumably SIRPγ on T cells ( Figures 1A, B , right panels). Furthermore, Jurkat WT and Jurkat SIRPγ cells were stained with KWAR23 and LSB2.20, a specific anti-SIRPγ, developed by Piccio and colleagues (16). While both Abs similarly stained Jurkat WT cells, no staining was observed on Jurkat SIRPγKO cells with either Ab, identifying SIRPγ as the sole KWAR23 epitope on Jurkat cells ( Figure 1C ). To confirm these results, we setup two ELISA in which recombinant SIRP molecules were used. The anti-SIRPα-specific mAb recognized SIRPα but not SIRPγ-recombinant protein, while the KWAR23 recognized SIRPα, SIRPγ, and even SIRPβ ( Figure 1D and data not shown for SIRPβ). Thus, KWAR23 appears as a pan anti-SIRP antibody.

KWAR23 has been selected by Ring and collaborators for its ability to specifically block the SIRPα/CD47 interaction as does the anti-SIRPα Ab (19) ( Figure 1E , left panel). LSB2.20 inhibits the SIRPγ/CD47 (16). Thus, we evaluated LSB2.20, KWAR23, and the anti-SIRPα for their ability to interfere with SIRPγ/CD47 binding. Surprisingly, the LSB2.20 did not efficiently, block the SIRPγ/CD47 interaction at the concentration tested, neither did the anti-SIRPα. On the contrary, KWAR23 was found to efficiently abrogate SIRPγ/CD47 interaction ( Figure 1E , right panel).

Thus, we redefined the KWAR23 as a Pan anti-SIRP antibody able to specifically block SIRPα-γ/CD47 interactions.

SIRPγ is expressed on T cells (16), and this expression can be altered by the presence of an eQTL (rs2281808) (20). So far, SIRPγ expression on different T-cell subsets has not been described. Thus, we analyzed SIRPγ expression on PBMC by FACS analysis and showed that naïve (CD3⁺CD45RA⁺CD28⁺) and central memory (CM, CD3⁺CD45RA⁻CD28⁺) T cells highly express SIRPγ whereas effector memory (EM, CD3⁺CD45RA⁻CD28⁻) T cells express to a lesser extent SIRPγ on their surface. Interestingly, TEMRA CD8 T cells (TEMRA, CD3⁺CD8⁺CD45RA⁺CD28⁻) express SIRPγ at a lower level than EM T cells ( Figures 2A, B ). Since SIRPγ ligates CD47, a ubiquitously expressed molecule, we investigated CD47 expression on T-cell subsets. We show that it follows the same expression pattern as SIRPγ ( Figures 2A, C ). We then evaluated SIRPγ expression on T cells upon polyclonal stimulation. Proliferating T cells rapidly and significantly upregulates SIRPγ at their surface and reaches a plateau once T cells have divided more than twice ( Figures 2D, E ). This upregulation of SIRPγ is increasing from Days 3 to 5 of activation. Conversely, the expression of CD47 on proliferating T cells decreases upon T-cell divisions with a higher impact at Day 5 as compared with Day 3 ( Figures 2D, F ).

We then investigated the expression of SIRPγ and CD47 on Tregs by gating on CD3⁺CD4⁺CD25⁺CD127^low cells and demonstrated that both molecules are highly expressed on naïve (CD45RA⁺) and memory/activated (CD45RA⁻) Tregs while CD47 is significantly less expressed by memory/activated Tregs ( Figures 2G –I ). Prior to questioning the role of SIRPγ on Treg functions, we evaluated the consequences of SIRPγ blockade on T-cell proliferation upon CD3 and CD28 stimulations. As shown in Figure 2K , the specific blockade of SIRPγ by KWAR23 slightly reduces T-cell proliferation. We have previously shown that CD28 stimulation can inhibit Treg function (21), thus in an experimental set-up where T effector cells were only stimulated with coated OKT3, we analyzed the impact of SIRPγ blockade on Tregs suppressive function. After 5 days of culture in anti-CD3-coated wells, effector T cells (Teff) proliferated, while Tregs cultured in the same conditions did not ( Figure 2J ). When cocultured at a 1:1 Teff : Treg ratio, Tregs were able to inhibit Teff proliferation regardless of the presence or not of KWAR23 ( Figure 2L ), suggesting that SIRPγ is not involved in Tregs suppressive function, although the direct effect of KWAR23 on OKT3-stimulated Teff and T reg cell would fully comfort our observations.

We further investigated the expression of SIRPγ on other cell types and detected it on MAIT cells, NKT cells ( Supplementary Figures S1A –C ), and in more than 60% of ILC1 cells ( Supplementary Figures S1D, E ). SIRPγ was not expressed on B cells neither on NK cells (data not shown) as already reported by Piccio (16).

Altogether, our results show that SIRPγ expression varies upon T-cell differentiation and T-cell stimulation, suggesting that this molecule could impact T-cell functions.

Since SIRPγ and CD47 are both expressed on T cells with a similar expression pattern on the subpopulations, we hypothesized that CD47 may sequester SIRPγ at the cell surface by cis ligation on resting T cells. We first addressed this question using confocal microscopy by analyzing SIRPγ and CD47 expression patterns on wild-type (WT) Jurkat cells and on CRISPR-CAS9-modified Jurkat cells, i.e., Jurkat SIRPγ KO and Jurkat CD47 KO. On WT Jurkat cells, SIRPγ clusters in big punctuate patterns, whereas CD47 is expressed as smaller ones with a broad localization ( Figure 3A ); SIRPγ and CD47 therefore do not seem to colocalized on Jurkat cells. In the absence of SIRPγ, i.e., on SIRPγ KO Jurkat cells, CD47 expression is not altered and seems equivalent to that observed on WT Jurkat cells ( Figure 3A ). Surprisingly, the knockout of CD47 modifies the patterns of SIRPγ. SIRPγ is expressed on the whole cell surface instead of being in a big punctuate pattern at a specific localization of the cell surface as in WT Jurkat cells ( Figure 3A ). This might suggest that CD47 would impact SIRPγ distribution on the plasma membrane but not reciprocally. We also evaluated the expression of SIRPγ and CD47 on freshly isolated T cells; we identified a similar expression as on WT without any colocalization ( Figures 3B, C ). Given that SIRPγ and CD47 expression varies upon T-cell stimulation ( Figures 2D –F ), we analyzed their distribution on resting and on activated T cells. Upon T-cell stimulation, SIRPγ is upregulated and expressed on the whole T-cell surface as compared with resting T cells (i.e., freshly isolated T cells), in which SIRPγ is localized in big punctuate patterns ( Figure 3B ). However, CD47 distribution does not change upon T-cell activation ( Figure 3B ). The Pearson value clearly showed that there is no colocalization of SIRPγ and CD47 neither at steady state nor upon T-cell activation since the value obtained were not close to 1 ( Figure 3C ).

SIRPγ/CD47 interaction has been shown to enhance superantigen-mediated T-cell costimulation (16); we therefore hypothesized that SIRPγ might be localized at the immune synapse. Interestingly, we observed a polarization of SIRPγ by time-lapse microscopy when Jurkat and SEE-primed Raji cells are in close contact. Jurkat cells emit pseudopods when they are closed to Raji cells and SIRPγ clearly polarized at the cell-cell contact ( Figures 4A , B ; Supplementary Video S1 ). To ensure that this cell-cell contact was a synapse, in one experiment, cells were fixed, permeabilized, and stained with phalloidin. The staining showed a polarization of actine at the cell-cell contact indicating the synapse formation ( Figure 4C ). Interestingly, CD47 (stained only on Raji cells) was localized at the immune synapse ( Figure 4C ). We obtained similar results when using T cells (stained with an anti-SIRPγ Ab) from healthy volunteer (HV) rather than Jurkat ( Figure 4D ). We further quantified SIRPγ expression intensity at the synapse and on the opposite site of the cell as explained in Figure 4E in all acquired time-lapse microscopy videos and showed a clear SIRPγ accumulation at the immune synapse ( Figure 4F ). Interestingly, blocking the SIRPα-γ/CD47 interactions with KWAR23 mAb did not affect SIRPγ polarization at the synapse ( Figure 4F ), suggesting that SIRPγ spatial reorganization of the synapse does not depend on its interaction with CD47 on the Raji cells.

To further decipher the importance of the SIRPγ/CD47 interaction on T-cell function, we stimulated T cells with low doses of OKT3 (0.5 or 1 µg/ml) and CD47-Fc, both coated, to provide a costimulatory signal as shown by Piccio and colleagues (16). With an experiment setup different than the one used by Piccio, we showed that the addition of coated CD47-Ig during T-cell stimulation did not increase their proliferation ( Figure 5A ); however, coated CD47-Ig increases T-cell metabolism independently of its interaction with SIRPγ since the addition of KWAR23 has no impact ( Figure 5B ). Importantly, coated CD47-Fc significantly enhances IFN-γ secretion of OKT3-stimulated T cells; once again the addition of KWAR23 in the culture has no effect ( Figure 5C ). Our results show that T cells freshly stimulated with coated OKT3 and coated CD47-Fc benefited from CD47 in a SIRPγ-independent pathway.

CD47 is upregulated by different cells upon chronic infection, notably viral infection (22), and tumor cells. We therefore evaluated the impact of CD47-Fc stimulation on T cells chronically stimulated with three rounds of anti-CD3 anti-CD28 stimulations. Chronically activated T cells further stimulated with CD47-Fc kept their fitness as shown in the Figure 5D . However, their culture on a OKT3-CD47 coating increased their IFN-γ secretion ( Figure 5E ). To evaluate the role of the SIRPγ/CD47 interaction in this observation, the blocking anti-SIRPγ antibody KWAR23 or the blocking anti-CD47 antibody B6H12 were respectively added. As shown in Figure 5F , the addition of KWAR23 did not impair cell fitness, while B6H12 seriously impaired T-cell viability when used at 10 µg/ml ( Figure 5F ). This mAb has already been shown to induce T-cell apoptosis (23). KWAR23 significantly decreased IFN-γ secretion while a tendency was observed with the blocking anti-CD47 antibody B6H12 ( Figure 5G ). This observation suggests a role of the SIRPγ/CD47 interaction in chronically activated T cells.

Since SIRPγ is absent in rodents, we took advantage of a graft-versus-host disease (GvHD) model, in which human PBMC injected in NSG-recipient mice would be chronically stimulated by the xenogeneic environment. The role of SIRPγ in this experimental condition was evaluated by treating or not the irradiated recipient mice with 5 mg/kg of KWAR23 twice a week. In this situation, the xenogenic GvHD is human T cells driven due to their cross-reactivity with host MHCs (24). We first observed that mice survival was significantly extended when treated with KWAR23 ( Figure 6A ). At Day 6, mice treated with the KWAR23 showed a tendency of a lower human chimerism, although the frequency of human cells within the blood was quite low 1-week posthumanization. This observation was clearly significant at Day 14 ( Figure 6B ), suggesting that SIRPγ blockade impairs T-cell survival, activation, proliferation, or localization within the host. This chimerism mostly comprised human CD3⁺ cells in both groups as shown by blood phenotypic analysis at Day 14 ( Figure 6C ). Human CD8 T cells played a primary role in xeno-GvHD pathogenicity (24); however, the CD4/CD8 ratio analyzed at D14 did not show an accumulation of CD8 T cells in the blood ( Figure 6D ). At Day 14, lower absolute numbers of human CD4 and CD8 circulating T cells were detected in the KWAR23-treated group ( Figure 6E ) which could explain the delay of the observed xeno-GvHD onset. Mice with a NOD background such as NSG mice, are superior to other strains for human immune cell engraftment thanks to their SIRPα whose affinity for human CD47 is even higher than the one for their natural ligand (mCD47), ensuring a functional “don’t eat me” signal (25). NSG mice are known to have functional residual macrophages. Given the weak chimerism observed in the KWAR23-treated group and the specificity of the KWAR23 to block human SIRPα-γ/hCD47 interactions, we wondered whether the KWAR23 cross-reacted with mouse SIRPα leading to the disruption of mSIRPα/hCD47 don’t eat me signal and eventually the phagocytosis of human cells. Intraperitoneal macrophages collected from NSG mouse are all CD11b⁺ SIRPα⁺ and are not stained by the KWAR23 ( Supplementary Figure S2A ), ruling out our previously depicted hypothesis.

We evaluated the consequences of the KWAR23 treatment on T-cell activation. We analyzed PD1 expression on human circulating cells. All human T cells were PD1⁺ regardless of the treatment ( Figure 6F ). Therefore, the delay of the GvHD onset in the KWAR23-treated group was not due to a defect of human T-cell activation. In vitro, we have shown that chronically activated T cells secreted less IFN-γ when SIRPγ/CD47 interaction was blocked ( Figure 5G ). Thus, we measured IFN-γ concentration in mice’s sera collected at Day14. As expected, KWAR23-treated mice secreted significantly less IFN-γ than control mice ( Figure 6G ). This can be explained either by the lower amount of human T cells within the KWAR23-treated group, or by a direct effect of the treatment on chronically activated T cells (as shown in vitro in Figure 5G ). Because human T cells are fully activated in the xenogeneic environment, we wondered if the KWAR23 treatment would impact the CD47’s downmodulation observed in vitro following T-cell stimulation ( Figure 2F ). Indeed, the downmodulation of human CD47 might reduce the “don’t eat me” signal and increase their susceptibility to residual mouse macrophages. KWAR23 did not stress CD47 down-regulation ( Supplementary Figure S2B ) indicating that the treatment would not increase T-cell susceptibility to mouse macrophages.

We then evaluated SIRPγ on human T cells in both groups by using the anti-SIRPγ mAb clone LSB2.20. We first validated that the KWAR23 did not impair the staining using LSB2.20 ( Supplementary Figure S2C ). The frequency of human CD4 and CD8 SIRPγ⁺ T cells in the KWAR23-treated group was not different to that in the PBS-treated mice ( Figures 6H, I ). However, SIRPγ geometric mean was significantly lower in the KWAR23-treated group ( Figures 6H –J ).

Thus, blocking SIRPγ/CD47 interaction in vivo impaired human T-cell chimerism by specifically affecting human T-cell numbers leading to the delay of xeno-GvHD.

Because SIRPγ expression varies upon T-cell differentiation in the blood from HV ( Figures 2A –C ), we evaluated the impact of the treatment on T-cell differentiation in vivo. Three out of four HV whose PBMC were i.v. injected were phenotyped prior to their injection in NSG mice; naïve CD4, central memory CD4, and central memory CD8 T cells were the most abundant subpopulations ( Supplementary Figures S3A, B ). After i.v. hPBMC injection in untreated recipient mice, naïve T-cell compartment shrank in favor to central memory and effector memory cells regardless of the treatment. Whether or not this observation reflects naïve T-cell differentiation into central memory and effector memory cells, together with a memory T-cell compartment activation is difficult to evaluate. However, the inhibition of SIRPα-γ/CD47 interactions in vivo did not bias neither CD4 nor CD8 T-cell subpopulation frequencies ( Figures 7A, B ) while it clearly affected the absolute number of CD4 and CD8 T in all subpopulations except the TERMA CD8 T cells ( Figures 7C, D ). To further document the effect of KWAR23-treatment, some mice were sacked and their splenocytes were analyzed at Day 14. We confirmed that human cell engraftment was impaired in the spleen also upon KWAR23 treatment ( Figure 8A ). The CD4/CD8 ratio was significantly lower in the KWAR23-treated group ( Figure 8B ). A relative number of CD4 was significantly lower in the KWAR23-treated group ( Figure 8C ) without affecting the frequency of CD4 or CD8 T-cell subpopulations ( Figures 8D, E ) nor the relative number of those subpopulations ( Figures 8F, G ).

Altogether, our results suggest that KWAR23 treatment affects survival of all human T-cell subpopulations independently of mice macrophage implication.