We generated RNF90-deficient mice as described previously (34). The sequences of sgRNA were: K1 (GGCGGAGTTCCAAGCGCTGCGGG), K2 (GGGTCGGCTTCTAAGCCGACTGG) and K3 (CTGGATCTGGCCGCTGAGTTTGG). No RNF90 mRNA or truncated proteins were detected in the RNF90-deficient mice. Mice were housed in a facility with access to food and water and were maintained under a 12-h light/12-h dark cycle. All animal procedures were performed according to guidelines approved by the committee on animal care at Xinxiang Medical University, China. The age- and sex-matched wildtype (WT) and RNF90-deficient mice were used in the experiments.

Plasmids encoding human RNF90 or its deletion mutants were constructed as described previously (34). HA-Ubi, HA-K48-Ubi, HA-K63-Ubi, HA-K48R-Ubi, HA-K63R-Ubi, pIFN-β-Luc, HA/Flag-MAVS were obtained as described previously (26). HA-K6-Ubi (22900), HA-K11-Ubi (22901), HA-K27-Ubi (22902), HA-K29-Ubi (22903), HA-K33-Ubi (17607) were purchased from Addgene.

The antibodies for immunoblot analysis or immunoprecipitation were listed as follows: anti-Flag (F3165, Sigma-Aldrich), anti-HA (901515, Biolend), anti-Myc (66004-1-Ig, Proteintech), anti-RNF90 (sc-109107, Santa Cruz; ab170538, Abcam), anti-MAVS (14341-1-AP, Proteintech), anti-p-TBK1 (5483T, Cell Signaling Technology), anti-TBK1 (CSB-PA024154LA01HU, Flarbio), anti-p-IRF3 (4947, Cell Signaling Technology), anti-IRF3 (sc-9082, Santa Cruz), anti-p-p65 (3033, Cell Signaling Technology), anti-p65 (10745-1-AP, Proteintech), anti-STING (19851-1-AP, Proteintech), anti-Ubi (sc-8017, Santa Cruz), anti-Ubi-K48 (05-1307, Millipore), anti-Ubi-K63 (05-1313, Millipore), anti-VSVg (YM3006, Immunoway), anti-H3 (CSB-PA010109LA01HU, Flarbio), anti-β-tubulin(10068-1-AP, Proteintech), and anti-β-actin (60008-1, Proteintech). The poly(I:C) (tlrl-picw), HSV60 (tlrl-hsv60n) and cGAMP (tlrl-nacga23) were obtained from InvivoGen. The PMA (S1819) was obtained from Beyotime Biotechnology. MG132 (474790) was purchased from Millipore. 3-MA (M9281) and NH4Cl (A9434) were purchased from Sigma-Aldrich.

HaCaT keratinocytes were obtained from Procell Life Science & Technology Co., Ltd., (Wuhan, China). HEK293T and THP1 cells were purchased from Stem Cell Bank, Chinese Academy of Sciences. The procedures for the generation of BMDMs and MEFs have been described previously (36, 37). THP1 STING-KO cells (thpd-kostg) were purchased from InvivoGen. RNF90-deficient HaCaT cells were generated by the Laboratory of Genetic Regulators in the Immune System in Xinxiang Medical University through CRISPR/Cas9-mediated gene editing. THP1 cells were cultured in RPMI 1640, whereas HaCaT and HEK293T cells were grown in Dulbecco’s modified Eagle's medium (DMEM). Phorbol-12-myristate-13-acetate (PMA)-differentiated THP1 (PMA-THP1, a human macrophage-like cell line) cells referred to THP1 cells that were pretreated with 100ng/ml PMA for 24 h. All cells were supplemented with 10% FBS (Gibco), 4 mM L-glutamine, 100μg/ml penicillin, and 100U/ml streptomycin under humidified conditions with 5% CO₂ at 37°C. Transfection of HaCaT, HEK293T, THP1, MEFs, and BMDMs was performed with Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions.

Immunoprecipitation and immunoblot analysis were performed as described previously (38). Briefly, cells were lysed in lysis buffer (1.0% Nonidet P-40, 20 mM Tris-HCl, 10% glycerol, 150 mM NaCl, 0.2 mM Na₃VO₄, 1mM NaF, 0.1 mM sodium pyrophosphate with a protease inhibitor ‘cocktail’ (Roche), pH 8.0). After centrifugation for 20 min at 14,000g, supernatants were collected and incubated with the indicated antibodies together with protein A/G Plus-agarose immunoprecipitation reagent (sc-2003, Santa Cruz) at 4°C for 3 h or overnight. After three washes, the immunoprecipitates were boiled in an SDS sample buffer for 10 min and analyzed by immunoblot.

The nuclear extracts were prepared as described previously (39). In short, cells were lysed with fresh buffer A (10 mM HEPES, 1.5 mM MgCl2 · 6 H2O, 10 mM KCl, 0.5 mM DTT, 0.1% Nonidet P-40, with a protease inhibitor ‘cocktail’ (Roche), pH 7.9). The lysate was placed on ice for 10 min and centrifuged at 10,000 rpm for 5 min at 4°C to remove cytoplasmic proteins. Nuclear proteins were extracted from the pellet in ice-cold fresh buffer C (20 mM HEPES, 1.5 mM MgCl2 · 6 H2O, 0.42 M NaCl, 0.2 mM EDTA, 25% glycerol, 0.5 mM DTT, with a protease inhibitor ‘cocktail’ (Roche), pH 7.9). Insoluble material was removed by centrifugation at 10,000 rpm for 5 min at 4°C. Protein concentration was measured by BCA protein assay reagent kit.

Total RNA was extracted from the cultured cells with TRIzol reagent (Invitrogen). All gene transcripts were quantified by real-time PCR with SYBR Green qPCR Master Mix using a 7500 Fast real-time PCR system (Applied Biosystems). The relative fold induction was calculated using the 2^-△△Ct method. The primers used for real-time PCR were as follows:

The culture media of BMDMs and MEFs or the serum of mice were collected for measurement of IFN-β (PBL) and TNF-α (Thermo Fisher Scientific) by ELISA according to the manufacturer’s instructions.

RNF90 Stealth-RNAi siRNA was designed by the Invitrogen BLOCKiT RNAi Designer. The small interfering RNA (siRNA) sequences used were as follows:

The Silencer Select negative control siRNA was obtained from Invitrogen (Catalog no.4390843). Lipofectamine 2000 was used for the transfection of PMA-THP1 or HaCaT cells with siRNA.

Cells were infected with VSV (MOI=1) for 1.5 h. Then the cells were washed with PBS and cultured in fresh media. For the in vivo study, age- and sex-matched mice were intravenously or intraperitoneally infected with VSV. VSV viral titer was determined by the plaque-forming assay on Vero cells.

MAVS, RNF90, and RNF90 mutants were expressed with a TNT Quick-coupled Transcription/Translation Systems kit (L1171, Promega). In vitro ubiquitination assay was performed with a ubiquitination kit (BML-UW9920, Enzo Life Science) following the manufacturer’s instructions.

Luciferase reporter gene assays were performed as described previously (38). In short, HEK293T cells were transfected with indicated plasmids. 24 h after transfection, cells were lysed, and reporter activity was analyzed with the Dual-Luciferase Reporter Assay System (Promega).

After treatment, HEK293T cells were fixed with 4% PFA in PBS, permeabilized with Triton X-100, and then blocked with 1% BSA in PBS. Nuclei were stained with 4, 6-diamidino-2-phenylindole (DAPI).

The data are presented as the means ± SD from at least three independent experiments. The statistical comparisons between the different treatments were performed using the unpaired Student t-test, and P < 0.05 was considered statistically significant.

Our previous work indicated that RNF90 negatively regulated DNA virus- or cytosolic DNA-triggered antiviral innate immune responses (34). We wondered whether RNF90 has a role in RNA virus-triggered signaling pathways. To address this issue, firstly, we examined the expression pattern of RNF90 upon poly (I:C) transfection or RNA virus infection. As shown in Figures 1A, B , immunoblot results indicated that RNF90 expression was induced in PMA-THP1 cells upon VSV infection ( Figure 1A ) or poly (I:C) transfection ( Figure 1B ). Then, we evaluated the effect of RNF90 on RNA virus-induced immune responses. Induction of IFN-β, CXCL10, and RANTES upon poly (I:C) transfection or VSV infection was inhibited by RNF90 overexpression in mRNA levels ( Figures 1C, D ). Next, we used the knockdown approach to further address endogenous RNF90 in RNA virus-triggered innate immune responses. PMA-THP1 cells were transfected with control siRNA (SC) or two pairs of siRNA oligonucleotides specific for RNF90 RNA (R2, R3). As shown in Figure 2A , both R2 and R3 inhibited endogenous RNF90 expression. In PMA-THP1 cells, real-time PCR results indicated the production of IFN-β and CXCL10 was increased in RNF90-silenced PMA-THP1 cells compared to SC-transfected cells upon poly (I:C) transfection ( Figure 2B ). Consistently, RNF90 knockdown promoted VSV-induced antiviral immune responses, including the production of IFN-β, CXCL10, and RANTES ( Figure 2C ) and the phosphorylation of TBK1, IRF3, and p65 ( Figure 2D ). In addition, standard plaque assay was performed to analyze virus titers in the cell supernatants. The results indicated RNF90 knockdown decreased VSV titers ( Figure 2E ), suggesting the VSV-triggered antiviral immune responses was inhibited by RNF90. Altogether, our results suggested a negative regulatory role of RNF90 in RNA virus-induced innate immune responses.

To further investigate the role of RNF90 in RNA virus infection, we generated the RNF90-deficient HaCaT cell line by CRISPR/Cas9 strategy. As shown in Figure 3A , the expression of RNF90 could not be detected in RNF90-deficient HaCaT cells by immunoblot assays. Then we stimulated the RNF90-deficient HaCaT cells and WT HaCaT cells with poly (I:C) transfection or VSV infection and evaluated the effects of RNF90 on RNA virus-triggered immune responses. Real-time PCR assays indicated that, compared to WT HaCaT cells, RNF90-deficient HaCaT cells exhibited higher IFN-β and CXCL10 production upon poly (I:C) transfection or VSV infection ( Figures 3B, C ). In addition, in RNF90-deficient HaCaT cells, the phosphorylation of TBK1, IRF3, and p65 was higher than that in WT HaCaT cells ( Figure 3D ). Finally, immunoblot results demonstrated decreased virus protein VSVg in RNF90-deficient HaCaT cells ( Figure 3E ). Altogether, our findings suggested RNF90 deficiency in HaCaT cells enhanced RNA virus-triggered innate immune responses, suggesting the inhibitory role of RNF90 in RNA virus-induced signaling pathways.

Next, we isolated and cultured the primary MEFs and BMDMs from RNF90-deficient mice and examined the effects of RNF90 deficiency on RNA virus-triggered antiviral immune responses in primary non-immune and immune cells. As shown in Figures 4A, B , RNF90 deficiency enhanced the production of IFN-β, CXCL10, ISG56, and TNF-α in mRNA levels in MEFs upon the treatment of poly (I:C) transfection or VSV infection. Similar results were obtained from BMDMs isolated from RNF90-deficient mice ( Figures 5A, B ). The increase of IFN-β and ISG56 in RNF90-deficient MEFs upon VSV infection could be blocked by RNF90 transfection ( Figure S1 ). Additionally, ELISA assays confirmed the increase of IFN-β, and TNF-α production in protein levels in RNF90-deficient MEFs, compared to WT MEFs, upon the treatment of poly (I:C) transfection ( Figure 4C ). Consistently, compared to the cells isolated from WT mice, RNF90-deficient MEFs and BMDMs exhibited a higher IFN-β and TNF-α production after VSV infection ( Figures 4D , 5C ). Furthermore, in MEFs and BMDMs isolated from WT mice, the impairment of RNF90 resulted in enhanced phosphorylation of TBK1, IRF3, and p65 upon poly (I:C) transfection or VSV infection ( Figures 4E , 5D ). VSV triggered the nuclear accumulation of IRF3, and p65 was observed in BMDMs ( Figure 5E ). In BMDMs isolated from RNF-deficient mice, the VSV-triggered nuclear accumulation of IRF3 and p65 was enhanced ( Figure 5E ). VSV infection was also suppressed by RNF90 deficiency as suggested by VSV titers using plaque assays in MEFs and VSV protein VSVg expression using immunoblot assays in BMDMs ( Figures 4F , 5F ). Altogether, our findings in RNF90-deficient primary non-immune and immune cells confirmed that RNF90 inhibited RNA virus-triggered innate immune responses.

Next, WT and RNF90-deficient mice were used to investigate the role of RNF90 in antiviral immune responses against VSV infection in vivo. RNF90-deficient mice exhibited prolonged survival after VSV infection, suggesting the protective role of RNF90 impairment during VSV infection in mice ( Figure 6A ). Additionally, less lung destruction was observed in the lungs from RNF90-deficient mice than that from WT mice after VSV infection ( Figure 6B ). Compared to WT mice, higher IFN-β and TNF-α expression levels were observed in the serum of RNF90-deficient mice upon VSV infection ( Figure 6C ). Next, we evaluated the antiviral immune responses in different organs of mice. As shown in Figures 6D–F , in lung, liver, and spleen, RNF90 impairment significantly promoted VSV-triggered antiviral immune responses, as suggested by the increased production of IFN-β, CXCL10, ISG56, and TNF-α. Altogether, our findings suggested that RNF90 deficiency protected mice from RNA virus infection.

STING has been reported to play a very important role in both RNA viruses- and DNA viruses-induced antiviral immune responses (40–43). Our previous study clarified that RNF90 negatively regulated DNA virus- or cytosolic DNA-triggered antiviral immune responses by targeting STING for degradation (34). Therefore, we wondered whether the effect of RNF90 on RNA virus-induced signaling pathways is independent of STING. To address this question, we constructed STING-deficient THP1 cells and examined the role of RNF90 in RNA virus-triggered immune responses in the absence of STING. As is shown in Figures 7A , S2 , STING-deficient THP1 cells showed undetectable STING expression and impaired IFN-β production upon poly(dA:dT) or HSV60 transfection. Then, control siRNA (SC) or RNF90-specific siRNA (R3) were transfected into STING-deficient PMA-THP1 cells ( Figure 7B ). Real-time PCR assays indicated RNF90 knockdown promoted the production of IFN-β, CXCL10, and ISG56 upon poly (I:C) transfection or VSV infection in the absence of STING, suggesting RNF90 negatively regulated RNA virus-triggered immune responses targeting other proteins involved in the RLR signaling pathway. Altogether, our findings suggested that the effect of RNF90 on RNA virus-triggered antiviral immune response is independent of STING.

To explore the molecular mechanisms underlying the negative regulatory role of RNF90 in RNA virus-triggered anti-viral immune responses, we first identified the target protein of RNF90 by luciferase assay. RIG-I, MAVS, TBK1, and IRF3-5D (the constitutively active mutant of IRF3) are essential to the VSV-induced antiviral signaling pathways. Thus, we examined the effects of RNF90 overexpression on IFN-β reporter activation induced by these molecules. As shown in Figure 8A , RNF90 overexpression inhibited IFN-β reporter activation induced by RIG-I, and MAVS, but not by TBK1 and IRF3-5D. Thus, we hypothesized that RNF90 might target MAVS to inhibit RIG-I signaling. To address this hypothesis, we investigated whether RNF90 interacted with MAVS. HA-RNF90 and Flag-MAVS were co-transfected into HEK293T cells, and co-immunoprecipitation assays revealed that RNF90 interacted with MAVS ( Figure 8B ). Additionally, confocal microscopy indicated that Flag-RNF90 colocalized with endogenous MAVS in mitochondria in HEK293T cells with or without poly (I:C) stimulation ( Figure 8C ). We further performed endogenous co-immunoprecipitation experiments, which indicated that RNF90 interacted with MAVS in untreated PMA-THP1 cells, and VSV infection enhanced the interaction at 4 h after infection ( Figure 8D ). Similar results were observed in VSV-infected HaCaT cells ( Figure 8E ). Next, we tried to figure out the region of MAVS responsible for its interaction with RNF90. As shown in Figures 8F, G , the residues aa180-360 of MAVS have the strongest association with RNF90, whereas aa 360-540 of MAVS lost the ability to interact with RNF90, suggesting the N-terminal of MAVS is responsible for interaction with RNF90. Finally, we mapped the binding regions on RNF90 for MAVS association. As shown in Figures 8H, I , the aa 1-166 and aa 324-511 of RNF90 exhibited no association with MAVS, whereas aa 167-511, aa 1-323, and aa 85-511 of RNF90 maintained the association with MAVS, suggesting aa 167-323 containing the coiled-coil structure might contribute to its interaction with MAVS. Altogether, our findings suggested RNF90 interacted with MAVS.

Given that RNF90 interacted with MAVS, we next explored how RNF90 regulated the MAVS-mediated signaling pathway. The stability of MAVS was examined and the immunoblot analysis indicated that RNF90 overexpression inhibited MAVS expression in protein levels in cycloheximide (CHX) chase assay ( Figure S3 ). This inhibition could be reversed by the proteasome inhibitor MG132, but not by NH4Cl or 3-MA ( Figure 9A ), suggesting RNF90 promoted MAVS degradation in a proteasome-dependent mechanism. Consistently, compared to WT cells, RNF90-deficient HaCaT cells exhibited a higher expression of MAVS upon VSV infection ( Figure 9B ).

Next, we investigated the effect of RNF90 on the ubiquitination of MAVS. RNF90 was co-transfected with MAVS and ubiquitin, and the immunoprecipitation and immunoblot analysis indicated that RNF90 overexpression increased the ubiquitination of MAVS in a dose-dependent manner ( Figure 9C ). RING-domain containing conserved cysteine and histidine residues is essential for the activity of RING-type ubiquitin-protein ligases (22). The C29, 32A mutant of RNF90, in which the integrity of the RING domain was destroyed (30), lost the ability to promote the ubiquitination of MAVS, suggesting the important role of the RING domain in the function of RNF90 ( Figure 9D ). Additionally, in vitro ubiquitination assays indicated that RNF90 enhanced the ubiquitination of STING directly ( Figure 9E ). Consistently, C29, 32A mutant of RNF90, or the RNF90 mutant lacking RING domain (ΔR) could not increase the ubiquitination of STING directly ( Figure 9F ). In addition, compared to WT RNF90, C29, 32A, and ΔR mutants exhibited less inhibition on the activation of TBK1, IRF3, and p65 upon VSV infection ( Figure 9G ).

Ubiquitin contains seven Lys residues (K6, K11, K27, K29, K33, K48, and K63) and seven different polyubiquitin chains can be generated (19). Ubiquitin mutants retaining only a single lysine residue were used to determine the type of linkage enhanced by RNF90 in the ubiquitination of MAVS ( Figure 10A ). As shown in Figure 10B , RNF90 promoted K48 mutants (only the Lys residue 48 was retained) mediated ubiquitination of MAVS, whereas showed no detectable effect on the ubiquitination mediated by the other six types of mutants, suggesting RNF90 promoted the K48-linked ubiquitination of MAVS. To further confirm the phenomenon, two mutants of ubiquitin, K48R (only the Lys residue 48 was mutated to Arg) and K63R (only the Lys residue 63 was mutated to Arg), were transfected into HEK293T cells with MAVS and RNF90. Immunoprecipitation and immunoblot analysis indicated that RNF90 promoted K63R mediated ubiquitination of STING, but not K48R, indicating the Lys residue 48 was essential to the RNF90-triggered linkage of MAVS with ubiquitin ( Figure 10C ). Furthermore, RNF90-deficiency in HaCaT cells inhibited poly(I:C) transfection induced K48-linked ubiquitination of MAVS, but no significant effect of RNF90 was observed on K63-linked ubiquitination of MAVS ( Figure 10D ). Additionally, RNF90-deficient MEF cells exhibited weaker K48-linked ubiquitination of MAVS upon VSV infection ( Figure 10E ) than WT cells. Altogether, our data indicated that RNF90 promoted the K48-linked ubiquitination of MAVS and its subsequent proteasome-dependent degradation.