<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Immunol.</journal-id>
<journal-title>Frontiers in Immunology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Immunol.</abbrev-journal-title>
<issn pub-type="epub">1664-3224</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fimmu.2021.676386</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Immunology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Identification and Characterization of a Germline Mutation in CARD11 From a Chinese Case of B Cell Expansion With NF-&#x3ba;B and T Cell Anergy</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Zhao</surname>
<given-names>Peiwei</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Meng</surname>
<given-names>Qingjie</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Huang</surname>
<given-names>Yufeng</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhang</surname>
<given-names>Lei</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Luo</surname>
<given-names>Sukun</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhang</surname>
<given-names>Xiankai</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Tan</surname>
<given-names>Li</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Zhou</surname>
<given-names>Aifen</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Xiong</surname>
<given-names>Hao</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>He</surname>
<given-names>Xuelian</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/912734"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Precision Medical Center, Wuhan Children&#x2019;s Hospital (Wuhan Maternal and Child Healthcare Hospital), Tongji Medical College, Huazhong University of Science &amp; Technology</institution>, <addr-line>Wuhan</addr-line>, <country>China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Department of Clinical Laboratory, Wuhan Children&#x2019;s Hospital (Wuhan Maternal and Child Healthcare Hospital), Tongji Medical College, Huazhong University of Science &amp; Technology</institution>, <addr-line>Wuhan</addr-line>, <country>China</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Department of Hematology &amp; Oncology, Wuhan Children&#x2019;s Hospital (Wuhan Maternal and Child Healthcare Hospital), Tongji Medical College, Huazhong University of Science &amp; Technology</institution>, <addr-line>Wuhan</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Daniela Bosisio, University of Brescia, Italy</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Batsukh Dorjbal, Uniformed Services University of the Health Sciences, United States; Fei Zhou, Hanshan Normal University, China; Stephen Robert Daley, Queensland University of Technology, Australia</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Xuelian He, <email xlink:href="mailto:hexuelian2013@hotmail.com">hexuelian2013@hotmail.com</email>; Aifen Zhou, <email xlink:href="mailto:937577332@qq.com">937577332@qq.com</email>; Hao Xiong, <email xlink:href="mailto:22587481@qq.com">22587481@qq.com</email> </p>
</fn>
<fn fn-type="equal" id="fn003">
<p>&#x2020;These authors have equally contributed to this work</p>
</fn>
<fn fn-type="other" id="fn002">
<p>This article was submitted to Inflammation, a section of the journal Frontiers in Immunology</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>07</day>
<month>09</month>
<year>2021</year>
</pub-date>
<pub-date pub-type="collection">
<year>2021</year>
</pub-date>
<volume>12</volume>
<elocation-id>676386</elocation-id>
<history>
<date date-type="received">
<day>05</day>
<month>03</month>
<year>2021</year>
</date>
<date date-type="accepted">
<day>23</day>
<month>08</month>
<year>2021</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2021 Zhao, Meng, Huang, Zhang, Luo, Zhang, Tan, Zhou, Xiong and He</copyright-statement>
<copyright-year>2021</copyright-year>
<copyright-holder>Zhao, Meng, Huang, Zhang, Luo, Zhang, Tan, Zhou, Xiong and He</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>B cell expansion with NF-&#x3ba;B and T cell anergy (BENTA) is a rare primary immunodeficiency disorder caused by gain-of-function (GOF) mutations in the <italic>CARD11</italic> gene. Affected patients present with persistent B cell lymphocytosis in early childhood paired with lymphadenopathy and splenomegaly. Until now only six activating mutations from 14 patients have been reported in <italic>CARD11</italic>. Here we report a patient from China with polyclonal B cell lymphocytosis and frequent infections in early life. A heterozygous mutation (c.377G&gt;A, G126D) in exon 5 of <italic>CARD11</italic> gene (NM_032415) was identified by whole exome sequencing. <italic>In vitro</italic> functional studies showed that the G126D mutation is associated with increased expression of CARD11 and NF-&#x3ba;B activation in Hela cells. Flow cytometry analysis indicated NK cell activity and CD107a degranulation of the patient were decreased. RNA sequencing analysis showed that a number of genes in NF-&#x3ba;B pathway increased while those involved in NK cell activity and degranulation were down-regulated. In summary, our work identified a <italic>de novo</italic> germline GOF mutation in <italic>CARD11</italic> with functional evidence of BENTA.</p>
</abstract>
<kwd-group>
<kwd>BENTA</kwd>
<kwd>gain-of-function</kwd>
<kwd>lymphocytosis</kwd>
<kwd>NF-&#x3ba;B</kwd>
<kwd>CARD11</kwd>
</kwd-group>
<contract-num rid="cn001">2017CFB322</contract-num>
<contract-sponsor id="cn001">Natural Science Foundation of Hubei Province<named-content content-type="fundref-id">10.13039/501100003819</named-content>
</contract-sponsor>
<counts>
<fig-count count="5"/>
<table-count count="2"/>
<equation-count count="0"/>
<ref-count count="30"/>
<page-count count="11"/>
<word-count count="4793"/>
</counts>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<title>Introduction</title>
<p>CARD11 (Caspase recruitment domain 11), a scaffolding protein, is highly expressed in hematopoietic tissue and lymphocytes and required for B-cell receptor (BCR) and T-cell receptor (TCR) signaling to activate Nuclear factor (NF)-&#x3ba;B, c-Jun N-terminal kinase (JNK), and mammalian target of rapamycin (mTOR) pathways (<xref ref-type="bibr" rid="B1">1</xref>, <xref ref-type="bibr" rid="B2">2</xref>). Particularly, NF-&#x3ba;B represents a family of transcription factors that governs cell survival, proliferation, and immune response in many cell types (<xref ref-type="bibr" rid="B3">3</xref>, <xref ref-type="bibr" rid="B4">4</xref>), wherein overactive NF-&#x3ba;B is often associated with B cell malignancy (<xref ref-type="bibr" rid="B5">5</xref>).</p>
<p>CARD11 is comprised of various defined domains, including N-terminal CARD (1-110), LATCH (112-130), coiled-coil (CC, 130-449), auto-inhibitory (ID, 450-666) domains, and a C-terminal MAGUK domain (667-1140), the last one of which has 3 subdomains: PSD95/ZO-1, SH3, and guanylate kinase (GUK) domains (<xref ref-type="bibr" rid="B6">6</xref>). Somatic CARD11 mutations were oncogenic and more than 2000 mutations had been reported in various cancers, especially in diffuse larger B cell lymphoma (<uri xlink:href="https://cancer.sanger.ac.uk/cosmic/search?q=CARD11">https://cancer.sanger.ac.uk/cosmic/search?q=CARD11</uri>). In addition, germline CARD11 mutations have been implicated in several primary immune disorders, including severe combined immunodeficiency (SCID) (OMIM 615206) caused by homozygous loss-of-function (LOF) mutations, B cell expansion with NF-&#x3ba;B and T cell Anergy (BENTA) (OMIM 616452) caused by heterozygous gain-of-function (GOF) mutations (<xref ref-type="bibr" rid="B7">7</xref>&#x2013;<xref ref-type="bibr" rid="B9">9</xref>), and severe atopic disease (OMIM 617638) caused by heterozygous dominant negative (DN) mutations. Up to date, 7 germline homozygous LOF mutations, 15 germline heterozygous DN mutations, and 6 germline GOF mutations (C49Y, G123S, G123D, E134G, K215del, and H234Ldel235-8) have been reported (<xref ref-type="bibr" rid="B8">8</xref>&#x2013;<xref ref-type="bibr" rid="B13">13</xref>). All 6 GOF mutations identified are located in the N-terminal CARD, LATCH, and CC domains.</p>
<p>BENTA, first reported in 2012, is a congenital lymphoproliferative and immunodeficiency disorder and patients usually present with persistent B cell lymphocytosis paired with lymphadenopathy and splenomegaly in early childhood (<xref ref-type="bibr" rid="B8">8</xref>). Impaired T cell proliferation is observed in these patients, increasing their susceptibility to recurrent sinopulmonary infections (<xref ref-type="bibr" rid="B14">14</xref>).</p>
<p>Herein, we report a Chinese patient with recurrent infection and B cell lymphoproliferative disorder, from whom a germline heterozygous mutation (G126D) in the <italic>CARD11</italic> gene was identified using whole exome sequencing (WES). We demonstrated that this mutation leads to increased NF-&#x3ba;B activation <italic>in vitro</italic> and decreased NK cell activity <italic>in vitro</italic>. To further investigate the underlying mechanisms, we performed RNA-seq to identify the differential gene expression patterns resulting from the disease causing mutation.</p>
</sec>
<sec id="s2">
<title>Material and Methods</title>
<sec id="s2_1">
<title>Study Subject</title>
<p>This study has been approved by the institutional review board of Wuhan Children&#x2019;s Hospital, Tongji Medical College, Huazhong University of Science &amp; Technology. A patient presented with persistent upper respiratory illness and fever was recruited in this study. Upon obtaining informed consent, peripheral venous blood was withdrawn from the patient and his parents. Genomic DNA was extracted from leukocytes of whole blood samples using the QIAamp Blood DNA mini kit (Qiagen, Hilden, Germany) according to the manufacturer&#x2019;s instructions. RNA was extracted using Trizol reagent (Invitrogen).</p>
</sec>
<sec id="s2_2">
<title>Whole Exome Sequencing</title>
<p>WES and subsequent data analysis were conducted with the help of the third party medical testing laboratory (Chigene Lab, Beijing China). Candidate variants were confirmed by Sanger sequencing using self-designed primers in the patient and his parents. A conservative analysis of mutation sites was conducted using MEGA software (<uri xlink:href="https://www.megasoftware.net/">https://www.megasoftware.net/</uri>).</p>
</sec>
<sec id="s2_3">
<title>CARD11 Gene Plasmid Construction and Cell Transfection</title>
<p>The wildtype <italic>CARD11</italic> plasmid (WT-<italic>CARD11)</italic> was a gift from Xin Lin (<uri xlink:href="http://n2t.net/addgene:44431">http://n2t.net/addgene:44431</uri>). To generate G126D-<italic>CARD11</italic> and C49Y-<italic>CARD11</italic> (included as a positive control), site-directed mutagenesis was performed with the oligonucleotides 5&#x2019;- GCC CTA CCT GCG TCA GTA TAA GGT CAT TGA TG -3&#x2019; and 5&#x2019;- GAA GGC CAC GAG GAC CTC ACG CAC TTC -3&#x2019; using overlap PCR. All positive clones were verified for the correct sequence by Sanger sequencing. Hela cells were grown in DMEM supplemented with 10% fetal bovine serum (Gibco, Thermo Fisher Scientific), and cells cultured in 6-well plate were transfected with 2 &#x3bc;g plasmids (pcDNA3.1, WT, WT+G126D, G126D and C49Y) using Lipofectamine 3000 (Invitrogen), respectively, according to the manufacturer&#x2019;s instructions.</p>
</sec>
<sec id="s2_4">
<title>Western Blot</title>
<p>Cells were lysed in 1% NP-40 lysis buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40, and 0.5% sodium deoxycholate) for 30 min on ice, and then centrifuged at 12000rpm for 15 min at 4&#xb0;C. Cell nucleoprotein was extracted using NE-PER&#x2122; Nuclear and Cytoplasmic Extraction Reagents (Thermo Fisher Scientific). Protein concentration was determined by BCA assay (Thermo Fisher Scientific), and 20 &#x3bc;g of total protein was separated by 12% SDS-PAGE and subsequently transferred to PVDF membrane. After blocking by 3% BSA, membranes were probed with the following antibodies: anti-CARD11(Proteintech, 21741-1-AP), anti-IKK&#x3b3; (Cell Signaling Technology, #2685), anti-phosphorylation IKK&#x3b3; (Cell Signaling Technology, #2689), anti-NF-&#x3ba;B p65(Cell Signaling Technology, #8242), anti-phosphorylation mTOR(Ser2448) (Cell Signaling Technology, #2971), anti-phosphorylation JNK(Tyr185) (Proteintech, 80024-1-RR). Bound antibodies were detected using appropriate HRP-conjugated secondary antibodies (Southern Biotech) and enhanced chemiluminescence (ECL, Thermo Fisher Scientific).</p>
</sec>
<sec id="s2_5">
<title>Immunofluorescence</title>
<p>Cells adhered to poly-L-lysine&#x2013;coated slides were fixed for 15 min with 3% paraformaldehyde, and then permeabilized for 15 min in 0.1% Triton X-100/PBS. After blocking for 60 min in 3% BSA/PBS, cells spots were incubated with the anti-CARD11 (Proteintech, 21741-1-AP) antibody for 60min. Cells were washed in PBS for 3 times and then incubated with goat anti&#x2013;rabbit secondary Ab conjugated to Alexa Fluor 488 (Invitrogen) After washing in PBS, coverlips were attached with Fluoromount (SouthernBiotech). Fluorescent images were acquired on a fluorescence microscope using a 100&#xd7; oil immersion objective.</p>
</sec>
<sec id="s2_6">
<title>IgH Rearrangement Analysis</title>
<p>DNA was extracted from peripheral blood using QIAamp Blood DNA mini kit (Qiagen, Hilden, Germany). PCR was performed using consensus fluorescent labeled primers to V<sub>H</sub> framework region (FR I and II) and joining region(J<sub>H</sub>) of the IgH gene. PCR products were separated by capillary electrophoresis on an ABI 3500DX Genetic Analyzer with electropherograms analyzed using GeneMapper software version 5.0 (Applied Biosystems).</p>
</sec>
<sec id="s2_7">
<title>Luciferase Reporter Assays</title>
<p>Hela cells were plated in 12-well tissue culture plates (3 &#xd7; 10<sup>5</sup> cells/well) and were maintained for 24 h. The cells were then co-transfected with 500 ng of pcDNA3.1+, CARD11-expression vector (CARD11-WT, -C49Y- and -G126D) as needed, 300 ng of pNF&#x3ba;B-luc (Bayotime, Shanghai, China) containing NF-&#x3ba;B binding motifs (GGGAATTTCC), and 100 ng of pRL-TK control plasmid (containing Renilla reniformis luciferase gene, Promega, Madison, WI). After 36-48h, the cells were harvested in lysis buffer and were analyzed for luciferase activity using the Dual-Luciferase reporter Assay System (Promega, Madison, WI). Three independent experiments were performed to assess luciferase activity.</p>
</sec>
<sec id="s2_8">
<title>Natural Killer Cell Activity and CD107a Degranulation Assay</title>
<p>This assay was performed in the Beijing Friendship Hospital. Briefly, whole blood samples (5 mL) were collected from the patient and three age-matched healthy controls in EDTA-containing vials, and PBMCs were isolated. K562 cells stably expressing enhanced green fluorescent protein (EGFP) were constructed as target cells (EGFP-K562), and the effector cells were from healthy controls. The cells were incubated for 4 hours according to the effector/target cell ratio of 10:1, with the density of effector cells of 5&#xd7;10<sup>6</sup>/ml. Meanwhile, EGFP-K562 cells only were included as the background control. After staining with Annexin V-PE and 7-ADD, NK cell activity was analyzed by evaluating the apoptosis ratio of targets cells after co-culture of effector with target cells. Detailed protocol was described previously (<xref ref-type="bibr" rid="B15">15</xref>).</p>
<p>CD107a degranulation assay was performed with the same target and effector cells. PBMCs were isolated and incubated overnight at 37&#xb0;C in medium. Step by step procedures were according to the articles (<xref ref-type="bibr" rid="B16">16</xref>), and data were acquired on a FACSCalibur (BD Biosciences). The ratio of NK cells expressing CD107a were compared between co-cultured with K562 cells and medium alone. The &#x394;CD107a was defined as the difference in the percentage of NK cells expressing CD107a incubated in different conditions.</p>
</sec>
<sec id="s2_9">
<title>RNA-Seq Analysis</title>
<p>RNA was isolated from Hela cells transfected with <italic>CARD11</italic>-G126D and <italic>CARD11</italic>-WT, respectively, and 1 mg RNA was used for constructing cDNA libraries. The standard Illumina Pipeline for RNA-Seq was used by using paired-end 108-bp runs with each sample run in one sequencing lane, and yielded 20 million reads per sample, and the raw data was submitted to the database (<uri xlink:href="https://submit.ncbi.nlm.nih.gov/subs/sra/SUB9299352/">https://submit.ncbi.nlm.nih.gov/subs/sra/SUB9299352/</uri>). Gene expression was calculated as transcripts per million (TPM) mapped reads by using the TopHat alignment program with redundant reads removed, and the expression values of reads were normalized using <inline-formula>
<mml:math display="inline" id="im1">
<mml:mrow>
<mml:mtext>Lo</mml:mtext>
<mml:msubsup>
<mml:mtext>g</mml:mtext>
<mml:mn>2</mml:mn>
<mml:mrow>
<mml:mtext>TPM</mml:mtext>
</mml:mrow>
</mml:msubsup>
</mml:mrow>
</mml:math>
</inline-formula>.</p>
</sec>
<sec id="s2_10">
<title>Quantitative Real-Time PCR</title>
<p>Total RNA was extracted from Hela cells and PBMCs isolated from the patient&#x2019;s and healthy controls by using Trizol Reagent (Invitrogen, USA), respectively. The first complementary DNA was synthesized from RNA using reverse transcriptase (TAKARA, Dalian). Real-time PCR was performed in 7500 instrument (Applied Biosystems) using SYBR Green PCR Kit (TaKaRa, Dalian) and <italic>ACTIN</italic> was included as an internal control. The primer sequences of the genes are shown in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>The primer sequence of the gene.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Gene</th>
<th valign="top" align="center">Forward primer</th>
<th valign="top" align="center">Reverse primer</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">CARD11</td>
<td valign="top" align="left">CCAGGACCAATGGTCAAGAAGC</td>
<td valign="top" align="left">TGATGTTCGCTTCAGGCTGATG</td>
</tr>
<tr>
<td valign="top" align="left">RELB</td>
<td valign="top" align="left">GATTGCCATTGTGTTCAAGAC</td>
<td valign="top" align="left">CTTCTTGTCCACGCCGTAGCTG</td>
</tr>
<tr>
<td valign="top" align="left">BCL2</td>
<td valign="top" align="left">TTTCTTGAAGGTTTCCTCGTCCC</td>
<td valign="top" align="left">ACAGGCCACGTAAAGCAACTCTC</td>
</tr>
<tr>
<td valign="top" align="left">NFKB2</td>
<td valign="top" align="left">CTCTGCCTTCCTTAGAGCCAG</td>
<td valign="top" align="left">CCGAACCTCAATGTCATCTTTC</td>
</tr>
<tr>
<td valign="top" align="left">TNFAIP3</td>
<td valign="top" align="left">CTCCTCCAGCCTCAGCACCAGC</td>
<td valign="top" align="left">CAGCCGGCTT TTCTGCACTT GCTC</td>
</tr>
<tr>
<td valign="top" align="left">CCND3</td>
<td valign="top" align="left">GCCTGCGGGCCTGTCAGGAGCAG</td>
<td valign="top" align="left">CTGTAGGAGTGCTGGTCTGGCTG</td>
</tr>
<tr>
<td valign="top" align="left">PRDX1</td>
<td valign="top" align="left">CCCAAGCTGATAGGAAGATGTCTTC</td>
<td valign="top" align="left">GCACACAAAGGTGAAGTCAAGAG</td>
</tr>
<tr>
<td valign="top" align="left">ACTIN</td>
<td valign="top" align="left">CACAGTGCTGTCTGGCGGCACCAC</td>
<td valign="top" align="left">GATGGAGCCGCCGATCCACACGGA</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_11">
<title>Statistics Methods</title>
<p>Statistical analyses were performed using Graphpad Prism 5 (Graphpad software, USA). Every experiment was repeated three times with duplicates, and data are reported as the mean &#xb1; SD. A Student&#x2019;s t-test was used to compare two groups, and a one-way analysis of variance (ANOVA) was used when comparing three or more groups and statistical significance is indicated by *P&lt;0.05; **P&lt;0.01, ***P&lt;0.001.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<title>Results</title>
<sec id="s3_1">
<title>Clinical Investigations</title>
<p>Our patient, an 8-month-old Chinese boy, is the only child from healthy nonconsanguineous parents without related personal or familial medical history (<xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>). He was born at 39 weeks of gestation by cesarean delivery without complications. When 6-month old, the patient first presented with a persistent upper respiratory tract infection, fever with splenomegaly, lymphadenopathy, and anemia. The highest temperature was 39.1&#xb0;C. As shown in <xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>, clinical laboratory examination showed lymphocytosis with normal morphological lymphocytes and normal total white blood cells, increased glutamic-pyruvic transaminase and aspartate aminotransferase, positive perforin, granzyme, and soluble CD25, and normal CD3-CD56+NK cells of lymphocytes, increased ferritin, lower fibrinogen, and elevated triglycerides. The diagnosis of hemophagocytic lymphohistiocytosis (HLH) was considered according to the clinical characteristics and laboratory examinations.</p>
<table-wrap id="T2" position="float">
<label>Table&#xa0;2</label>
<caption>
<p>Clinical characteristics of the patient.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Clinical manifestation</th>
<th valign="top" align="center">Detection result</th>
<th valign="top" align="center">Reference value</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">Age/sex</td>
<td valign="top" align="center">8 month/male</td>
<td valign="top" align="center"/>
</tr>
<tr>
<td valign="top" align="left">Age of onset</td>
<td valign="top" align="center">6 month</td>
<td valign="top" align="center"/>
</tr>
<tr>
<td valign="top" align="left">Clinical manifestation</td>
<td valign="top" align="center"> fever with splenomegaly, lymphadenopathy</td>
<td valign="top" align="center"/>
</tr>
<tr>
<td valign="top" align="left">Glutamic-pyruvic transaminase (U/L)</td>
<td valign="top" align="center">96.1</td>
<td valign="top" align="center">9-60</td>
</tr>
<tr>
<td valign="top" align="left">Aspartate aminotransferase (U/L)</td>
<td valign="top" align="center">196.6</td>
<td valign="top" align="center">10-50</td>
</tr>
<tr>
<td valign="top" align="left">Ferritin (ng/ml)</td>
<td valign="top" align="center">2478</td>
<td valign="top" align="center">22-322</td>
</tr>
<tr>
<td valign="top" align="left">Lymphocytes (%)</td>
<td valign="top" align="center">85.9</td>
<td valign="top" align="center">40-70</td>
</tr>
<tr>
<td valign="top" align="left">CD3+ T lymphocytes (n/ul)</td>
<td valign="top" align="center">1624</td>
<td valign="top" align="center">805-4459</td>
</tr>
<tr>
<td valign="top" align="left">CD3+%</td>
<td valign="top" align="center">32.99</td>
<td valign="top" align="center">38.56-70.06</td>
</tr>
<tr>
<td valign="top" align="left">CD4+ T lymphocytes (n/ul)</td>
<td valign="top" align="center">648</td>
<td valign="top" align="center">345-2350</td>
</tr>
<tr>
<td valign="top" align="left">CD4+%</td>
<td valign="top" align="center">12.67</td>
<td valign="top" align="center">14.21-36.99</td>
</tr>
<tr>
<td valign="top" align="left">CD8+ T lymphocytes (n/ul)</td>
<td valign="top" align="center">932</td>
<td valign="top" align="center">314-2080</td>
</tr>
<tr>
<td valign="top" align="left">CD8+%</td>
<td valign="top" align="center">18.22</td>
<td valign="top" align="center">13.24-38.53</td>
</tr>
<tr>
<td valign="top" align="left">CD 19+ B lymphocytes (n/ul)</td>
<td valign="top" align="center">2882</td>
<td valign="top" align="center">240-1317</td>
</tr>
<tr>
<td valign="top" align="left">CD 19+ %</td>
<td valign="top" align="center">60.78</td>
<td valign="top" align="center">10.86-28.03</td>
</tr>
<tr>
<td valign="top" align="left">CD 16 + 56+ NK cells (n/ul)</td>
<td valign="top" align="center">372</td>
<td valign="top" align="center">210-1514</td>
</tr>
<tr>
<td valign="top" align="left">CD 16 + 56+ %</td>
<td valign="top" align="center">4.17</td>
<td valign="top" align="center">7.92-33.99</td>
</tr>
<tr>
<td valign="top" align="left">CD 3 + 56+ %</td>
<td valign="top" align="center">6.11</td>
<td valign="top" align="center">5-26</td>
</tr>
<tr>
<td valign="top" align="left">s.IgG (g/L)</td>
<td valign="top" align="center">18.6</td>
<td valign="top" align="center">3.48-7.01</td>
</tr>
<tr>
<td valign="top" align="left">s.IgA (g/L)</td>
<td valign="top" align="center">0.11</td>
<td valign="top" align="center">0.06-0.84</td>
</tr>
<tr>
<td valign="top" align="left">s.IgM (g/L)</td>
<td valign="top" align="center">0.52</td>
<td valign="top" align="center">0.26-0.90</td>
</tr>
<tr>
<td valign="top" align="left">s.CD25 (pg/ml)</td>
<td valign="top" align="center">8730.98</td>
<td valign="top" align="center">410-2623</td>
</tr>
<tr>
<td valign="top" align="left">Perforin (%)</td>
<td valign="top" align="center">96.81</td>
<td valign="top" align="center">&gt;84</td>
</tr>
<tr>
<td valign="top" align="left">Granzyme (%)</td>
<td valign="top" align="center">87.53</td>
<td valign="top" align="center">&gt;78</td>
</tr>
<tr>
<td valign="top" align="left">Triglycerides (mmol/L)</td>
<td valign="top" align="center">1.61</td>
<td valign="top" align="center">0.32-1.46</td>
</tr>
<tr>
<td valign="top" align="left">Fibrogen (g/L)</td>
<td valign="top" align="center">1.55</td>
<td valign="top" align="center">2-4</td>
</tr>
<tr>
<td valign="top" align="left">IL-6 (pg/ml)</td>
<td valign="top" align="center">12.6</td>
<td valign="top" align="center">0-3.4</td>
</tr>
<tr>
<td valign="top" align="left">IL-8 (pg/ml)</td>
<td valign="top" align="center">494</td>
<td valign="top" align="center">0-62</td>
</tr>
<tr>
<td valign="top" align="left">IL-10 (pg/ml)</td>
<td valign="top" align="center">122</td>
<td valign="top" align="center">0-9.1</td>
</tr>
<tr>
<td valign="top" align="left">Bone marrow cell morphology</td>
<td valign="top" align="center">increased lymphocytes and decreased granulocytes</td>
<td valign="top" align="center"/>
</tr>
<tr>
<td valign="top" align="left">Karyotype</td>
<td valign="top" align="center">46,XY</td>
<td valign="top" align="center"/>
</tr>
</tbody>
</table>
</table-wrap>
<p>In addition, he had a hypergammaglobulinemia, decreased serum IgA levels, and normal IgM levels. Bone marrow smear showed increased lymphocytes (40.5%) and decreased granulocytes (15.5%) (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>). Lymphocyte proliferation in response to phytohemagglutinin (PHA) was poor, and IgH rearrangement indicated that patient B cells are polyclonal (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref>).</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Characterization of our patient with mutated <italic>CARD11</italic> gene and conserved features of CARD11 protein. <bold>(A)</bold> Bone marrow smear from the patient, showed increased lymphocytes and decreased granulocytes; <bold>(B)</bold> Result of IgH rearrangement of our patient, it shows polyclonal rearrangement in FR1-JH region (above) and FR2-JH region (below); <bold>(C)</bold> Sanger sequencing of <italic>CARD11</italic> mutation in the family; <bold>(D)</bold> Conservation analysis of CARD11 protein among different species. The position of the mutations at residue 126 is indicated by a gray bar and highly conserved throughout all indicated species; <bold>(E)</bold> Scheme of the distribution of GOF CARD11 mutations, and the mutation in red was reported in our patient.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-12-676386-g001.tif"/>
</fig>
</sec>
<sec id="s3_2">
<title>WES Analysis and Putative Pathogenic Mutation Screening</title>
<p>In order to identify the pathogenic gene and verify the diagnosis of HLH, trios WES was conducted. Bioinformatic analysis was performed to identify candidate pathogenic gene according to filtering strategy based on variant classification, population frequency, and variant functional damaging prediction, including Sorting Intolerant From Tolerant (SIFT), Polymorphism Phenotyping v2 (PolyPhen-2), and Combined Annotation Dependent Depletion (CADD). Surprisingly, we did not find any pathogenic variant in HLH-associated genes after filtration, but instead one germline heterozygous missense mutation in exon 5 of <italic>CARD11</italic> (NM_032415), c.377G&gt;A (p.G126D) was identified. Sanger sequencing showed that this mutation was <italic>de novo</italic> in the patient and his parents did not carry this mutation (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1C</bold>
</xref>). The mutated site is conserved among different species (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1D</bold>
</xref>), located within the LATCH domain (Residues 112-130) of CARD11 protein (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1E</bold>
</xref>) in human, and has not previously been reported. The novel germline mutation was submitted to the database(<uri xlink:href="https://submit.ncbi.nlm.nih.gov/subs/variation_clinvar/SUB9923934/">https://submit.ncbi.nlm.nih.gov/subs/variation_clinvar/SUB9923934/</uri>). The diagnosis of BENTA was made, based on the patient&#x2019;s clinical presentation: polyclonal B cell lymphocytosis, splenomegaly, lymphadenopathy, and recurrent infection.</p>
</sec>
<sec id="s3_3">
<title>Effects of G126D on CARD11 Cellular Distribution and Activation of NF-&#x3ba;B, JNK, and mTOR Signaling Pathways</title>
<p>In order to establish the G126D as a pathogenic variant, <italic>in vitro</italic> functional study was performed. WT-CARD11, G126D-CARD11, C49Y-CARD11 (positive control) pcDNA3.1 empty plasmids alone, were transfected into Hela cells, respectively (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2A, B</bold>
</xref>). Protein aggregates were observed in cells ectopically expressing C49Y- or G126D-CARD11 proteins, whereas the proteins dispersed throughout cytoplasm in the cells transfected with WT-CARD11 (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2C</bold>
</xref>), suggesting that both C49Y and G126D mutations result in aggregation of CARD11 proteins.</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Functional study of G126D mutation in Hela cells. The expression levels of wild-type and mutant CARD11 gene in Hela cells were detected by Real-time PCR <bold>(A)</bold> and western blot <bold>(B)</bold>. <bold>(C)</bold> Distribution of CARD11-WT, -C49Y, and -G126D, respectively, investigated by immunofluorescence. <bold>(D)</bold> The expression levels of CARD11, IKK&#x3b3;, p-IKK&#x3b3; anti-NF-&#x3ba;B p65, p-MTOR, p-JNK in Hela cells transfected with wildtype or mutant <italic>CARD11</italic>, respectively, in whole cell lysates. GAPDH serves as a loading control; <bold>(E)</bold> Phosphorylated p65 increased in nuclear lysate of cells with mutant <italic>CARD11</italic>, and lamin B serves as a loading control. <bold>(F)</bold> Activity of NF-&#x3ba;B-dependent luciferase of cell extracts from each sample was measured and recorded as a fold increase compared to control cells with empty pcDNA3.1 plasmid. The results from three independent experiments are expressed as the mean + standard deviation (*P &lt; 0.05; **P &lt; 0.01; ***P &lt; 0.001).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-12-676386-g002.tif"/>
</fig>
<p>As reported previously, CARD11 plays an essential role in NF-&#x3ba;B activation (<xref ref-type="bibr" rid="B3">3</xref>). To investigate the effects of G126D mutation, we measured the levels of IKK&#x3b3; and phosphorylated IKK&#x3b3; in whole cell protein extracts, as well as NF-&#x3ba;B p65 in the nuclear fraction. We noticed that all of them were significantly increased in mutant CARD11 compared to WT CARD11 (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2D, E</bold>
</xref>). In addition, increased soluble CD25 was detected in our patient (<xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>).</p>
<p>NF-&#x3ba;B activation was determined by measuring pNF-&#x3ba;B-luc-reporter gene expression in Hela cells transiently transfected with pcDNA3.1, <italic>CARD11</italic>-WT, -G126D, or -C49Y plasmids. As shown in <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2F</bold>
</xref>, the luciferase activity in cells with mutated CARD11 was significantly higher than that in cells with CARD11-WT.</p>
<p>Taken together, these data indicated that G126D mutation is a GOF mutation and could spontaneously signal and promote NF-&#x3ba;B activation independently of antigen receptor stimulation.</p>
<p>As CARD11 serves as a bridge linking cell surface antigen receptor signaling with the activation of the NF-&#x3ba;B, JNK, and mTORC1 signaling, we also investigated the contribution of CARD11 mutation to the activation of JNK and mTOR pathways by assessing their extent of phosphorylation in Hela cells. As expected, phosphorylation of both JNK and mTOR substantially increased in cells with mutant CARD11compared to that in control cells (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2D</bold>
</xref>).</p>
<p>All these results suggest that G126D is a GOF mutation, and could enhance the expression of downstream effectors such as NF-&#x3ba;B, JNK, and mTORC1. To further examine the effect of G126D on downstream genes, RNA-seq was performed. KEGG pathway analysis showed that some genes involved in NF-&#x3ba;B pathway, were up-regulated in cells with G126D mutation, such as <italic>CCND3</italic>, <italic>RELB</italic> (encoding an NF-&#x3ba;B Subunit), <italic>NFKB2</italic>, and <italic>TNFAIP3</italic> (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3A, B</bold>
</xref>), which is consistent with constitutive activation of NF-&#x3ba;B signaling.</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>G126D leads to upregulation of some downstream targets of NF-&#x3ba;B signal pathway. <bold>(A)</bold> Heat map of differentially expressed genes involved in NF-&#x3ba;B signal pathway between CARD11-WT and CARD11-G126D by RNA-seq analysis in Hela cells. The color scales of heatmap refer to <inline-formula>
<mml:math display="inline" id="im2">
<mml:mrow>
<mml:mtext>Lo</mml:mtext>
<mml:msubsup>
<mml:mtext>g</mml:mtext>
<mml:mn>2</mml:mn>
<mml:mrow>
<mml:mtext>TPM</mml:mtext>
</mml:mrow>
</mml:msubsup>
</mml:mrow>
</mml:math>
</inline-formula>. <bold>(B)</bold> Realtime PCR was performed to measure the expression level of <italic>RELB, BCL2</italic>, <italic>NFKB2</italic>, <italic>TNFAIP3</italic> and <italic>CCND3</italic> gene in Hela cells. WT, wild type; M126, G126D mutation; TPM, Transcripts per million in RNA seq. The results of three independent experiments are expressed as the mean + standard deviation (*P &lt; 0.05; **P &lt; 0.01).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-12-676386-g003.tif"/>
</fig>
</sec>
<sec id="s3_4">
<title>Impact of CARD11 G126D on Natural Killer Cell Activity</title>
<p>Natural Killer (NK) cells are important effector lymphocytes that are best characterized for their antiviral and anticancer activities. NK cells can directly kill target cells through cytotoxic mechanism. Previous study revealed that constitutive activation of NF-&#x3ba;B driven by mutant CARD11 may be stimulatory in B cells, which contributes to polyclonal B cell lymphocytosis, but partially inhibitory in T cells, which render normal T cells hyporesponsive to antigen receptor stimulation (<xref ref-type="bibr" rid="B8">8</xref>). However, it is unclear whether G126D mutation of <italic>CARD11</italic> exerts effects on NK cells, particularly their killing activity. To answer this question, we assayed NK cell activity by measuring the proportion of apoptosis in target cells (EGFP-K562) incubated with NK cells isolated from our patient or WT controls, respectively. Our results showed that NK cell activity in the blood sample from the patient was obviously lower than those from three controls (P&lt;0.001) (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4A, B</bold>
</xref>). Furthermore, we evaluated NK activity by measuring the expressions of CD107a, a sensitive marker of NK cell activity, by performing degranulation assays using flow cytometry. Our results showed that the degranulation was dramatically decreased in the patient (P&lt;0.001) (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4C, D</bold>
</xref>). Collectively, the G126D mutation of CARD11 is associated with decreased NK cell activity.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Decreased NK cell activity and degranulation in our patient. <bold>(A)</bold> NK cell activity was measured as the proportion of apoptosis in target cells (EGFP-K562) incubated with NK cells isolated from our patient or normal control, and bivariate distribution was set, with Annexin V-PE and 7-AAD on the horizontal and vertical axes. <bold>(B)</bold> The proportion of apoptosis in EGFP-K562 cells was decreased when incubated with NK cells of this patient compared with that of control. The results showed that the activity of NK cells decreased significantly. <bold>(C)</bold> The NK cells expressing CD107a were compared between these co-cultured with K562 cells and those incubated with medium alone. The &#x394;CD107a was defined as the difference in the percentage of NK cells expressing CD107a incubated under different conditions. <bold>(D)</bold> &#x394;CD107a was decreased after stimulation and abnormal degranulation was observed in this patient compared with control, The results suggested degranulation function of NK cells decreased significantly. (***P &lt; 0.001). HD, Healthy donor.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-12-676386-g004.tif"/>
</fig>
<p>To identify potential mechanisms through which G126D mutation impaired NK cell activity, we analyzed the expression of genes involved in NK cell activity and degranulation by Gene Ontology (GO) enrichment analysis. We found significant differences in several genes, such as <italic>PRDX1</italic> (peroxiredoxins), <italic>BAG6</italic>, <italic>IL18</italic>, and <italic>ITGB2</italic> (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5A</bold>
</xref>). The expression of <italic>PRDX1</italic>, a gene positively regulating the activation and functions of NK cells, had the most significant decrease. Further, real-time PCR confirmed the decreased expression of <italic>PRDX1</italic> gene in peripheral blood of this patient (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5B</bold>
</xref>) and in mutant Hela cells (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5C</bold>
</xref>) compared to their respective controls.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Impact of CARD11 G126D on Natural Killer cell activity. <bold>(A)</bold> Heat map of differentially expressed genes involved in NK cell activation between CARD11-WT and CARD11-G126D, as measured by RNA-seq analysis in Hela cells. The color scales of heatmap refer to <inline-formula>
<mml:math display="inline" id="im3">
<mml:mrow>
<mml:mtext>Lo</mml:mtext>
<mml:msubsup>
<mml:mtext>g</mml:mtext>
<mml:mn>2</mml:mn>
<mml:mrow>
<mml:mtext>TPM</mml:mtext>
</mml:mrow>
</mml:msubsup>
</mml:mrow>
</mml:math>
</inline-formula>. <bold>(B)</bold> Expression level of <italic>PRDX1</italic> gene in peripheral blood by Realtime PCR. <bold>(C)</bold> The mRNA level of <italic>PRDX1</italic> in Hela cells by Realtime PCR and protein level by western blot. P, patient; N, normal controls; WT, wild type; M126, G126D mutation; TPM, Transcripts per million in RNA seq; H, Healthy donor. The results of three independent experiments are expressed as the mean + standard deviation (*P &lt; 0.05; **P &lt; 0.01).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fimmu-12-676386-g005.tif"/>
</fig>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<title>Discussion</title>
<p>In this study, we reported an 8-month-old patient with B cell lymphocytosis, fever, splenomegaly, lymphadenopathy, and recurrent infection, who was initially diagnosed as HLH. However, WES revealed a <italic>de novo</italic> germline missense mutation, G126D in <italic>CARD11</italic> gene, which was associated SCID, BENTA, and severe atopic disease. Based on his clinical manifestations and the genetic findings, a diagnosis of BENTA was considered and HLH could be secondary to BENTA. This is the first report of BENTA disease in Chinese population.</p>
<p>One previous study reported that a patient with BENTA showed HLH presentations at the terminal stage of illness and received treatment following the HLH-2004 protocol (<xref ref-type="bibr" rid="B9">9</xref>), but the patient did not respond to the treatment and died at the age of 3.5 years. The patient in our study only received intravenous antibiotics for recurrent respiratory tract infections and blood transfusion due to severe anemia. His clinical symptoms were mild and did not practice a formal HLH treatment, but dexamethasone was taken orally for maintenance therapy.</p>
<p>Ever since the first case of gain-of-function <italic>CARD11</italic> mutation was described in 2012 (<xref ref-type="bibr" rid="B8">8</xref>), a total of 14 BENTA disease patients with six different germline heterozygous mutations (C49Y,G123S, G123D, E134G, K215del, and H234Ldel235-8) have been reported (<xref ref-type="bibr" rid="B8">8</xref>&#x2013;<xref ref-type="bibr" rid="B13">13</xref>) and all of the <italic>CARD11</italic> GOF mutations are heterozygous missense mutations within the N-terminal CARD, LATCH, and CC domains. No GOF mutation was detected in the C-terminal domains.</p>
<p>CARD11 protein is required for BCR- and TCR-mediated activation of IKK complex, which in turn phosphorylates IkB (inhibitor of NF-&#x3ba;B), and leads to the activation of NF-&#x3ba;B (<xref ref-type="bibr" rid="B14">14</xref>, <xref ref-type="bibr" rid="B17">17</xref>). Following BCR or TCR engagement, CARD11 undergoes a conformational change from an inactive state to an active scaffold, and the latent state is controlled by ID domain, the domain between CC and PDZ domains (<xref ref-type="bibr" rid="B18">18</xref>, <xref ref-type="bibr" rid="B19">19</xref>). In addition, LATCH domain not only interacts with the CARD to promote CARD11 autoinhibition, but also plays a critical role in controlling the interaction of CARD11 with the adapter, Bcl10 (<xref ref-type="bibr" rid="B7">7</xref>, <xref ref-type="bibr" rid="B20">20</xref>). Therefore, mutations in these domains may bypass common controls and induce NF-&#x3ba;B activation by disrupting CARD11 autoinhibition.</p>
<p>The CARD11 G126D mutation promotes the activation of JNK and mTOR as CARD11 is also a multidomain signaling scaffold protein required for antigen receptor signaling to c-Jun and mTOR (<xref ref-type="bibr" rid="B19">19</xref>).</p>
<p>Somatic G126D mutation was reported in two patients with diffuse large B-cell lymphoma (DLBCL) (<xref ref-type="bibr" rid="B21">21</xref>, <xref ref-type="bibr" rid="B22">22</xref>). Moreover somatic G126D mutation also was a GOF mutation by using the library of murine CARD11 variants containing random mutations (<xref ref-type="bibr" rid="B21">21</xref>). However, to our knowledge, this variant has not been reported in germline cells. In order to further clarify the function of G126D and to make a definitive diagnosis, we performed <italic>in vitro</italic> experiments to evaluate its possible effects and underlying mechanisms. Our findings suggested that G126D changes the distribution pattern of CARD11 from dispersion to aggregation and increases activation of NF-&#x3ba;B, which is consistent with previous studies on GOF mutations within CARD, LATCH, and CC domains at the N terminus (<xref ref-type="bibr" rid="B13">13</xref>).</p>
<p>Significant B cell lymphocytosis and impaired T cell proliferation were reported in BENTA patients, which are associated with B cell malignancy and recurrent infection (<xref ref-type="bibr" rid="B19">19</xref>). Previous study has showed that a DN CARD11 mutation (R30W) impaired inflammatory cytokine (e.g. IFN-&#x3b3;) production by NK cells, but not affecting NK cell cytotoxicity (<xref ref-type="bibr" rid="B23">23</xref>). However, the impacts of GOF CARD11 mutations on NK cell functions are unknown.</p>
<p>Therefore, we attempted to investigate NK cell activity by examining the apoptosis of EGFP-K562 target cells incubated with NK cells from the patient, and the surface expression of CD107a (<xref ref-type="bibr" rid="B24">24</xref>). Our study showed decreased NK cell activity in our patient compared to control. However, the absolute number of NK cells in our patient was not increased compensatory but remained at normal range (in our patient) or slightly lower level (<xref ref-type="bibr" rid="B9">9</xref>, <xref ref-type="bibr" rid="B17">17</xref>). Therefore, the whole NK cell activity in BENTA patient was declined. It is well known that NK cells have a critical role in innate and adaptive immune against malignant transformation and viral infection (<xref ref-type="bibr" rid="B25">25</xref>, <xref ref-type="bibr" rid="B26">26</xref>), so impaired NK cell activity might enhance the risk of cancer and infection.</p>
<p>Amongst the differently expressed genes, <italic>PRDX1</italic> was the most significantly decreased. PRDX1 enhances the cytotoxicity of NK cells by balancing redox in the NK cells (<xref ref-type="bibr" rid="B27">27</xref>, <xref ref-type="bibr" rid="B28">28</xref>). It was reported that dysfunction of PRDX-related antioxidant chain led to profound alterations in spontaneous and antibody-dependent NK cell cytotoxicity, impaired degranulation, and decreased activation (<xref ref-type="bibr" rid="B29">29</xref>). Prdx1-null mice have abnormalities in the total number, relevant phenotypes, and function of natural killer cells (<xref ref-type="bibr" rid="B30">30</xref>). Therefore, PRDX11 could play a critical role in total NK cell activity in BENTA patient with CARD11 G126D mutation, and the detailed mechanism warrants further study.</p>
<p>In conclusion, we identified and characterized a <italic>de novo</italic> germline heterozygous GOF variant in <italic>CARD11</italic> gene from a patient with B cell lymphocytosis and constitutive NF-&#x3ba;B activation. Our study emphasizes the importance of WES in assisting with the diagnosis of rare immune diseases and repeated infectious diseases, and also provides functional evidence of pathogenicity of G126D mutation in <italic>CARD11</italic> gene.</p>
</sec>
<sec id="s5" sec-type="data-availability">
<title>Data Availability Statement</title>
<p>The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: SRA PRJNA743711, ClinVar SCV001739273.</p>
</sec>
<sec id="s6">
<title>Ethics Statement</title>
<p>The studies involving human participants were reviewed and approved by The institutional review board of Wuhan Children&#x2019;s Hospital, Tongji Medical College, Huazhong University of Science &amp; Technology. Written informed consent to participate in this study was provided by the participants&#x2019; legal guardian/next of kin. Written informed consent was obtained from the minor(s)&#x2019; legal guardian/next of kin for the publication of any potentially identifiable images or data included in this article.</p>
</sec>
<sec id="s7">
<title>Author Contributions</title>
<p>Study concepts: XH, HX, and AZ. Study design: PZ, QM, AZ, and HX. Literature research: YH, QM, and PZ. Clinical information collection: YH, HX, and QM. Data acquisition: QM, YH, LZ, and SL. Data analysis/interpretation: YH, QM, XZ, and LT. Manuscript preparation: XH and PZ. Manuscript editing: XH. Manuscript revision/review: AZ and HX. Manuscript final version approval: HX and AZ. All authors contributed to the article and approved the submitted version.</p>
</sec>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>This work was supported by the grants of Wuhan Municipal Health Commission (NO. WX19C19, WX14A06); Youth Program of National Natural Science Foundation of China (NO.81700302); Natural Science Foundation of Hubei Province (2017CFB322).</p>
</sec>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of Interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s10" sec-type="disclaimer">
<title>Publisher&#x2019;s Note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
</body>
<back>
<ack>
<title>Acknowledgments</title>
<p>We thank the index BENTA case family and all matched controls for participating in this study.</p>
</ack>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hara</surname> <given-names>H</given-names>
</name>
<name>
<surname>Wada</surname> <given-names>T</given-names>
</name>
<name>
<surname>Bakal</surname> <given-names>C</given-names>
</name>
<name>
<surname>Kozieradzki</surname> <given-names>I</given-names>
</name>
<name>
<surname>Suzuki</surname> <given-names>S</given-names>
</name>
<name>
<surname>Suzuki</surname> <given-names>N</given-names>
</name>
<etal/>
</person-group>. <article-title>The MAGUK Family Protein CARD11 Is Essential for Lymphocyte Activation</article-title>. <source>Immunity</source> (<year>2003</year>) <volume>18</volume>:<page-range>763&#x2013;75</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/s1074-7613(03)00148-1</pub-id>
</citation>
</ref>
<ref id="B2">
<label>2</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rawlings</surname> <given-names>DJ</given-names>
</name>
<name>
<surname>Sommer</surname> <given-names>K</given-names>
</name>
<name>
<surname>Moreno-Garcia</surname> <given-names>ME</given-names>
</name>
</person-group>. <article-title>The CARMA1 Signalosome Links the Signalling Machinery of Adaptive and Innate Immunity in Lymphocytes</article-title>. <source>Nat Rev Immunol</source> (<year>2006</year>) <volume>6</volume>:<fpage>799</fpage>&#x2013;<lpage>812</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nri1944</pub-id>
</citation>
</ref>
<ref id="B3">
<label>3</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vallabhapurapu</surname> <given-names>S</given-names>
</name>
<name>
<surname>Karin</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Regulation and Function of NF-kappaB Transcription Factors in the Immune System</article-title>. <source>Annu Rev Immunol</source> (<year>2009</year>) <volume>27</volume>:<fpage>693</fpage>&#x2013;<lpage>733</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1146/annurev.immunol.021908.132641</pub-id>
</citation>
</ref>
<ref id="B4">
<label>4</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zeligs</surname> <given-names>KP</given-names>
</name>
<name>
<surname>Neuman</surname> <given-names>MK</given-names>
</name>
<name>
<surname>Annunziata</surname> <given-names>CM</given-names>
</name>
</person-group>. <article-title>Molecular Pathways: The Balance Between Cancer and the Immune System Challenges the Therapeutic Specificity of Targeting Nuclear Factor-&#x3ba;b Signaling for Cancer Treatment</article-title>. <source>Clin Cancer Res</source> (<year>2016</year>) <volume>22</volume>:<page-range>4302&#x2013;8</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1158/1078-0432.CCR-15-1374</pub-id>
</citation>
</ref>
<ref id="B5">
<label>5</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Staudt</surname> <given-names>LM</given-names>
</name>
</person-group>. <article-title>Oncogenic Activation of NF-&#x3ba;b</article-title>. <source>Cold Spring Harb Perspect Biol</source> (<year>2010</year>) <volume>2</volume>:<elocation-id>a000109</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1101/cshperspect.a000109</pub-id>
</citation>
</ref>
<ref id="B6">
<label>6</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lu</surname> <given-names>HY</given-names>
</name>
<name>
<surname>Biggs</surname> <given-names>CM</given-names>
</name>
<name>
<surname>Blanchard-Rohner</surname> <given-names>G</given-names>
</name>
<name>
<surname>Fung</surname> <given-names>SY</given-names>
</name>
<name>
<surname>Sharma</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Turvey SE.The CBM-Opathies-A Rapidly Expanding Spectrum of Human Inborn Errors of Immunity Caused by Mutations in the CARD11-BCL10-MALT1 Complex</article-title>. <source>Front Immunol</source> (<year>2018</year>) <volume>9</volume>:<elocation-id>2078</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2018.02078</pub-id>
</citation>
</ref>
<ref id="B7">
<label>7</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Turvey</surname> <given-names>SE</given-names>
</name>
<name>
<surname>Durandy</surname> <given-names>A</given-names>
</name>
<name>
<surname>Fischer</surname> <given-names>A</given-names>
</name>
<name>
<surname>Fung</surname> <given-names>SY</given-names>
</name>
<name>
<surname>Geha</surname> <given-names>RS</given-names>
</name>
<name>
<surname>Gewies</surname> <given-names>A</given-names>
</name>
<etal/>
</person-group>. <article-title>The CARD11-BCL10-MALT1 (CBM) Signalosome Complex: Stepping Into the Limelight of Human Primary Immunodeficiency</article-title>. <source>J Allergy Clin Immunol</source> (<year>2014</year>) <volume>134</volume>:<page-range>276&#x2013;84</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jaci.2014.06.015</pub-id>
</citation>
</ref>
<ref id="B8">
<label>8</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Snow</surname> <given-names>AL</given-names>
</name>
<name>
<surname>Xiao</surname> <given-names>W</given-names>
</name>
<name>
<surname>Stinson</surname> <given-names>JR</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>W</given-names>
</name>
<name>
<surname>Chaigne-Delalande</surname> <given-names>B</given-names>
</name>
<name>
<surname>Zheng</surname> <given-names>L</given-names>
</name>
<etal/>
</person-group>. <article-title>Congenital B Cell Lymphocytosis Explained by Novel Germline CARD11 Mutations</article-title>. <source>J Exp Med</source> (<year>2012</year>) <volume>209</volume>:<page-range>2247&#x2013;61</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1084/jem.20120831</pub-id>
</citation>
</ref>
<ref id="B9">
<label>9</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gupta</surname> <given-names>M</given-names>
</name>
<name>
<surname>Aluri</surname> <given-names>J</given-names>
</name>
<name>
<surname>Desai</surname> <given-names>M</given-names>
</name>
<name>
<surname>Lokeshwar</surname> <given-names>M</given-names>
</name>
<name>
<surname>Taur</surname> <given-names>P</given-names>
</name>
<name>
<surname>Lenardo</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Clinical, Immunological, and Molecular Findings in Four Cases of B Cell Expansion With NF-&#x3ba;b and T Cell Anergy Disease for the First Time From India</article-title>. <source>Front Immunol</source> (<year>2018</year>) <volume>9</volume>:<elocation-id>1049</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2018.01049</pub-id>
</citation>
</ref>
<ref id="B10">
<label>10</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>B&#xe9;ziat</surname> <given-names>V</given-names>
</name>
<name>
<surname>Jouanguy</surname> <given-names>E</given-names>
</name>
<name>
<surname>Puel</surname> <given-names>A</given-names>
</name>
</person-group>. <article-title>Dominant Negative CARD11 Mutations: Beyond Atopy</article-title>. <source>J Allergy Clin Immunol</source> (<year>2019</year>) <volume>143</volume>:<page-range>1345&#x2013;7</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jaci.2018.12.1006</pub-id>
</citation>
</ref>
<ref id="B11">
<label>11</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Buchbinder</surname> <given-names>D</given-names>
</name>
<name>
<surname>Stinson</surname> <given-names>JR</given-names>
</name>
<name>
<surname>Nugent</surname> <given-names>DJ</given-names>
</name>
<name>
<surname>Heurtier</surname> <given-names>L</given-names>
</name>
<name>
<surname>Suarez</surname> <given-names>F</given-names>
</name>
<name>
<surname>Sukumar</surname> <given-names>G</given-names>
</name>
<etal/>
</person-group>. <article-title>Mild B-Cell Lymphocytosis in Patients With a CARD11 C49Y Mutation</article-title>. <source>J Allergy Clin Immunol</source> (<year>2015</year>) <volume>136</volume>:<page-range>819&#x2013;21</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jaci.2015.03.008</pub-id>
</citation>
</ref>
<ref id="B12">
<label>12</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Outinen</surname> <given-names>T</given-names>
</name>
<name>
<surname>Syrj&#xe4;nen</surname> <given-names>J</given-names>
</name>
<name>
<surname>Rounioja</surname> <given-names>S</given-names>
</name>
<name>
<surname>Saarela</surname> <given-names>J</given-names>
</name>
<name>
<surname>Kaustio</surname> <given-names>M</given-names>
</name>
<name>
<surname>Helminen</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Constant B Cell Lymphocytosis Since Early Age in a Patient With CARD11 Mutation: A 20-Year Follow-Up</article-title>. <source>Clin Immunol</source> (<year>2016</year>) <volume>165</volume>:<fpage>19</fpage>&#x2013;<lpage>20</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.clim.2016.02.002</pub-id>
</citation>
</ref>
<ref id="B13">
<label>13</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shields</surname> <given-names>AM</given-names>
</name>
<name>
<surname>Bauman</surname> <given-names>BM</given-names>
</name>
<name>
<surname>Hargreaves</surname> <given-names>CE</given-names>
</name>
<name>
<surname>Pollard</surname> <given-names>AJ</given-names>
</name>
<name>
<surname>Snow</surname> <given-names>AL</given-names>
</name>
<name>
<surname>Patel</surname> <given-names>SY</given-names>
</name>
</person-group>. <article-title>A Novel, Heterozygous Three Base-Pair Deletion in CARD11 Results in B Cell Expansion With NF-&#x3ba;b and T Cell Anergy Disease</article-title>. <source>J Clin Immunol</source> (<year>2020</year>) <volume>40</volume>:<page-range>406&#x2013;11</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s10875-019-00729-x</pub-id>
</citation>
</ref>
<ref id="B14">
<label>14</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Brohl</surname> <given-names>AS</given-names>
</name>
<name>
<surname>Stinson</surname> <given-names>JR</given-names>
</name>
<name>
<surname>Su</surname> <given-names>HC</given-names>
</name>
<name>
<surname>Badgett</surname> <given-names>T</given-names>
</name>
<name>
<surname>Jennings</surname> <given-names>CD</given-names>
</name>
<name>
<surname>Sukumar</surname> <given-names>G</given-names>
</name>
<etal/>
</person-group>. <article-title>Germline CARD11 Mutation in a Patient With Severe Congenital B Cell Lymphocytosis</article-title>. <source>J Clin Immunol</source> (<year>2015</year>) <volume>35</volume>:<fpage>32</fpage>&#x2013;<lpage>46</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s10875-014-0106-4</pub-id>
</citation>
</ref>
<ref id="B15">
<label>15</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>L</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Tang</surname> <given-names>R</given-names>
</name>
<name>
<surname>Li</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>Application of an Improved Flow Cytometry-Based NK Cell Activity Assay in Adult Hemophagocytic Lymphohistiocytosis</article-title>. <source>Int J Hematol</source> (<year>2017</year>) <volume>105</volume>:<page-range>828&#x2013;34</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s12185-017-2195-3</pub-id>
</citation>
</ref>
<ref id="B16">
<label>16</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bryceson</surname> <given-names>YT</given-names>
</name>
<name>
<surname>Pende</surname> <given-names>D</given-names>
</name>
<name>
<surname>Maul-Pavicic</surname> <given-names>A</given-names>
</name>
<name>
<surname>Gilmour</surname> <given-names>KC</given-names>
</name>
<name>
<surname>Ufheil</surname> <given-names>H</given-names>
</name>
<name>
<surname>Vraetz</surname> <given-names>T</given-names>
</name>
<etal/>
</person-group>. <article-title>A Prospective Evaluation of Degranulation Assays in the Rapid Diagnosis of Familial Hemophagocytic Syndromes</article-title>. <source>Blood</source> (<year>2012</year>) <volume>119</volume>:<page-range>2754&#x2013;63</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1182/blood-2011-08-374199</pub-id>
</citation>
</ref>
<ref id="B17">
<label>17</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Greil</surname> <given-names>J</given-names>
</name>
<name>
<surname>Rausch</surname> <given-names>T</given-names>
</name>
<name>
<surname>Giese</surname> <given-names>T</given-names>
</name>
<name>
<surname>Bandapalli</surname> <given-names>OR</given-names>
</name>
<name>
<surname>Daniel</surname> <given-names>V</given-names>
</name>
<name>
<surname>Bekeredjian-Ding</surname> <given-names>I</given-names>
</name>
<etal/>
</person-group>. <article-title>Whole-Exome Sequencing Links Caspase Recruitment Domain 11 (CARD11) Inactivation to Severe Combined Immunodeficiency</article-title>. <source>J Allergy Clin Immunol</source> (<year>2013</year>) <volume>131</volume>:<page-range>1376&#x2013;83</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jaci.2013.02.012</pub-id>
</citation>
</ref>
<ref id="B18">
<label>18</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dorjbal</surname> <given-names>B</given-names>
</name>
<name>
<surname>Stinson</surname> <given-names>JR</given-names>
</name>
<name>
<surname>Ma</surname> <given-names>CA</given-names>
</name>
<name>
<surname>Weinreich</surname> <given-names>MA</given-names>
</name>
<name>
<surname>Miraghazadeh</surname> <given-names>B</given-names>
</name>
<name>
<surname>Hartberger</surname> <given-names>JM</given-names>
</name>
<etal/>
</person-group>. <article-title>Hypomorphic Caspase Activation and Recruitment Domain 11 (CARD11) Mutations Associated With Diverse Immunologic Phenotypes With or Without Atopic Disease</article-title>. <source>J Allergy Clin Immunol</source> (<year>2019</year>) <volume>143</volume>:<page-range>1482&#x2013;95</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jaci.2018.08.013</pub-id>
</citation>
</ref>
<ref id="B19">
<label>19</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bedsaul</surname> <given-names>JR</given-names>
</name>
<name>
<surname>Carter</surname> <given-names>NM</given-names>
</name>
<name>
<surname>Deibel</surname> <given-names>KE</given-names>
</name>
<name>
<surname>Hutcherson</surname> <given-names>SM</given-names>
</name>
<name>
<surname>Jones</surname> <given-names>TA</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Z</given-names>
</name>
<etal/>
</person-group>. <article-title>Mechanisms of Regulated and Dysregulated CARD11 Signaling in Adaptive Immunity and Disease</article-title>. <source>Front Immunol</source> (<year>2018</year>) <volume>9</volume>:<elocation-id>2105</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2018.02105</pub-id>
</citation>
</ref>
<ref id="B20">
<label>20</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>McCully</surname> <given-names>RR</given-names>
</name>
<name>
<surname>Pomerantz</surname> <given-names>JL</given-names>
</name>
</person-group>. <article-title>The Protein Kinase C-Responsive Inhibitory Domain of CARD11 Functions in NF-kappaB Activation to Regulate the Association of Multiple Signaling Cofactors That Differentially Depend on Bcl10 and MALT1 for Association</article-title>. <source>Mol Cell Biol</source> (<year>2008</year>) <volume>28</volume>:<page-range>5668&#x2013;86</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/MCB.00418-08</pub-id>
</citation>
</ref>
<ref id="B21">
<label>21</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chan</surname> <given-names>W</given-names>
</name>
<name>
<surname>Schaffer</surname> <given-names>TB</given-names>
</name>
<name>
<surname>Pomerantz</surname> <given-names>JL</given-names>
</name>
</person-group>. <article-title>A Quantitative Signaling Screen Identifies CARD11 Mutations in the CARD and LATCH Domains That Induce Bcl10 Ubiquitination and Human Lymphoma Cell Survival</article-title>. <source>Mol Cell Biol</source> (<year>2013</year>) <volume>33</volume>:<page-range>429&#x2013;43</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/MCB.00850-12</pub-id>
</citation>
</ref>
<ref id="B22">
<label>22</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dong</surname> <given-names>G</given-names>
</name>
<name>
<surname>Chanudet</surname> <given-names>E</given-names>
</name>
<name>
<surname>Zeng</surname> <given-names>N</given-names>
</name>
<name>
<surname>Appert</surname> <given-names>A</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>YW</given-names>
</name>
<name>
<surname>Au</surname> <given-names>WY</given-names>
</name>
<etal/>
</person-group>. <article-title>A20, ABIN-1/2, and CARD11 Mutations and Their Prognostic Value in Gastrointestinal Diffuse Large B-Cell Lymphoma</article-title>. <source>Clin Cancer Res</source> (<year>2011</year>) <volume>17</volume>:<page-range>1440&#x2013;51</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1158/1078-0432.CCR-10-1859</pub-id>
</citation>
</ref>
<ref id="B23">
<label>23</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hutcherson</surname> <given-names>SM</given-names>
</name>
<name>
<surname>Bedsaul</surname> <given-names>JR</given-names>
</name>
<name>
<surname>Pomerantz</surname> <given-names>JL</given-names>
</name>
</person-group>. <article-title>Pathway-Specific Defects in T, B, and NK Cells and Age-Dependent Development of High IgE in Mice Heterozygous for a CADINS-Associated Dominant NegativeCARD11 Allele</article-title>. <source>J Immunol</source> (<year>2021</year>) <volume>207</volume>:<page-range>1150&#x2013;64</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.4049/jimmunol.2001233</pub-id>
</citation>
</ref>
<ref id="B24">
<label>24</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vivier</surname> <given-names>E</given-names>
</name>
<name>
<surname>Tomasello</surname> <given-names>E</given-names>
</name>
<name>
<surname>Baratin</surname> <given-names>M</given-names>
</name>
<name>
<surname>Walzer</surname> <given-names>T</given-names>
</name>
<name>
<surname>Ugolini</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>Functions of Natural Killer Cells</article-title>. <source>Nat Immunol</source> (<year>2008</year>) <volume>9</volume>:<page-range>503&#x2013;10</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/ni1582</pub-id>
</citation>
</ref>
<ref id="B25">
<label>25</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>O&#x2019;Brien</surname> <given-names>KL</given-names>
</name>
<name>
<surname>Finlay</surname> <given-names>DK</given-names>
</name>
</person-group>. <article-title>Immunometabolism and Natural Killer Cell Responses</article-title>. <source>Nat Rev Immunol</source> (<year>2019</year>) <volume>19</volume>:<page-range>282&#x2013;90</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41577-019-0139-2</pub-id>
</citation>
</ref>
<ref id="B26">
<label>26</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sciezynska</surname> <given-names>A</given-names>
</name>
<name>
<surname>Komorowski</surname> <given-names>M</given-names>
</name>
<name>
<surname>Soszy&#x144;ska</surname> <given-names>M</given-names>
</name>
<name>
<surname>Malejczyk</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>NK Cells as Potential Targets for Immunotherapy in Endometriosis</article-title>. <source>J Clin Med</source> (<year>2019</year>) <volume>8</volume>:<fpage>E1468</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/jcm8091468</pub-id>
</citation>
</ref>
<ref id="B27">
<label>27</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mimura</surname> <given-names>K</given-names>
</name>
<name>
<surname>Kua</surname> <given-names>LF</given-names>
</name>
<name>
<surname>Shimasaki</surname> <given-names>N</given-names>
</name>
<name>
<surname>Shiraishi</surname> <given-names>K</given-names>
</name>
<name>
<surname>Nakajima</surname> <given-names>S</given-names>
</name>
<name>
<surname>Siang</surname> <given-names>LK</given-names>
</name>
<etal/>
</person-group>. <article-title>Upregulation of Thioredoxin-1 in Activated Human NK Cells Confers Increased Tolerance to Oxidative Stress</article-title>. <source>Cancer Immunol Immunother</source> (<year>2017</year>) <volume>66</volume>:<page-range>605&#x2013;13</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00262-017-1969-z</pub-id>
</citation>
</ref>
<ref id="B28">
<label>28</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shau</surname> <given-names>H</given-names>
</name>
<name>
<surname>Gupta</surname> <given-names>RK</given-names>
</name>
<name>
<surname>Golub</surname> <given-names>SH</given-names>
</name>
</person-group>. <article-title>Identification of a Natural Killer Enhancing Factor (NKEF) From Human Erythroid Cells</article-title>. <source>Cell Immunol</source> (<year>1993</year>) <volume>147</volume>:<fpage>1</fpage>&#x2013;<lpage>11</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1006/cimm.1993.1043</pub-id>
</citation>
</ref>
<ref id="B29">
<label>29</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Siernicka</surname> <given-names>M</given-names>
</name>
<name>
<surname>Winiarska</surname> <given-names>M</given-names>
</name>
<name>
<surname>Bajor</surname> <given-names>M</given-names>
</name>
<name>
<surname>Firczuk</surname> <given-names>M</given-names>
</name>
<name>
<surname>Muchowicz</surname> <given-names>A</given-names>
</name>
<name>
<surname>Bobrowicz</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Adenanthin, a New Inhibitor of Thiol-Dependent Antioxidant Enzymes, Impairs the Effector Functions of Human Natural Killer Cells</article-title>. <source>Immunology</source> (<year>2015</year>) <volume>146</volume>:<page-range>173&#x2013;83</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/imm.12494</pub-id>
</citation>
</ref>
<ref id="B30">
<label>30</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Neumann</surname> <given-names>CA</given-names>
</name>
<name>
<surname>Krause</surname> <given-names>DS</given-names>
</name>
<name>
<surname>Carman</surname> <given-names>CV</given-names>
</name>
<name>
<surname>Das</surname> <given-names>S</given-names>
</name>
<name>
<surname>Dubey</surname> <given-names>DP</given-names>
</name>
<name>
<surname>Abraham</surname> <given-names>JL</given-names>
</name>
<etal/>
</person-group>. <article-title>Essential Role for the Peroxiredoxin Prdx1 in Erythrocyte Antioxidant Defence and Tumour Suppression</article-title>. <source>Nature</source> (<year>2003</year>) <volume>424</volume>:<page-range>561&#x2013;5</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nature01819</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>