Bladder mucosa samples from 15 cows clinically suffering from chronic enzootic haematuria were collected from public slaughterhouses after bladder neoplasms had been identified during mandatory post-mortem examination. These animals were categorised as “infected”. Bladder mucosa samples from 15 apparently healthy cows were also collected. Six of these apparently healthy bladders showed inflammatory cells composed of small foci of lymphocytes beneath the urothelium. These animals were categorised as “Non-infected” as they did not harbour any papillomavirus infection. The remaining nine animals were categorised as “healthy” since no inflammatory cells were seen in their bladder samples. Six of these apparently heathy bladders showed small foci of lymphocytes beneath the urothelium. Animals from both groups were 3-5 years old. All bladder samples were immediately subdivided and either fixed in 10% buffered formalin for microscopic investigation or frozen in liquid nitrogen and stored at –80°C for subsequent molecular biology analysis.

Rabbit antibodies against RIG-1, MDA5, IRF3, phospho-IRF3, TBK1, phospho-TBK1, and TRIM25, were obtained from Cell Signaling Technology (Leiden, Netherlands). Rabbit antibody anti-RNF135 (RIPLET) was purchased from Sigma-Aldrich (MO, USA). Mouse anti-MAVS, anti-Sec13, and b-actin antibodies were purchased from Santa Cruz Biotechnology (TX, USA). Rabbit polyclonal anti-E5 serum recognising the C-terminal 14 amino acids of the BPV E5 oncoprotein was kindly gifted provided by Prof. DiMaio (Yale University, New Haven USA).

Total RNA was extracted from bladder samples from 15 cows suffering from chronic enzootic haematuria and 10 healthy cows using the RNeasy Mini Kit (Qiagen, NW, DE), according to the manufacturer’s instructions. Genomic DNA was removed from the RNA preparations using RNase-free DNase Fermentas Life Sciences (Thermo Fisher Scientific, MA, USA). A total of 1 μg RNA was used to generate single-stranded cDNA, using the QuantiTect Reverse Transcription Kit (Qiagen NW, DE), according to the manufacturer’s instructions. PCR was performed with a specific primer set designed using Primer3, an online tool, for BPV-2 E5, BPV-13 E5, bovine RIG-I, MDA5, and TRIM25 genes. The following primers were used: BPV-2 E5 ORF forward 5′-CACTGCCATTTGTTTTTTTC-3′, reverse 5′-GGAGCACTCAAAATGATCCC-3′; BPV-13 E5 ORF forward 5′-CACTGCCATTTGGTGTTCTT-3′, reverse 5′- AGCAGTCAAAATGATCCCAA-3′; RIG-I forward 5’- AGGAAAAGATTCGCCAGATACAGA-3’; reverse 5’-ATGGCATTCCTCCACCACTC-3’; MDA5 forward 5’-TGAAGCAGGGGTAAGAGAGC-3’; reverse 5’-TCAGACTCTGTACTGCCTTCAC-3’: TRIM25 forward 5’- CGGAGCTCCTGGAGTATGTG-3’; reverse 5’- TAGTTCAGGGATGCGTCAGC -3’. IKKα forward: 5’-CTCAGAGTTCTGCTCGGTCC-3’; reverse: 5’-AGTCTCCCCATCTTGAGGAGTT-3’; IKKβ; forward 5’- CAGAAGAGCGAGATGGACATTG-3’; reverse 5’-CCAGGACGCTGTTGAGGTT-3’: IKKγ: forward 5’-GTGAGCGGAACCGAGGAC-3’; reverse: 5’- CTGGGCTTTTAGCACTGGGA-3’. IFN-β: forward 5’- TCGGCATTCTCACCAGAGAC-3’; reverse: 5’-GGAACGATCGTGTCTTCCGT-3’. Conditions for PCR were as follows: 94°C for 5 min, 40 cycles at 95°C for 30 s, 58°C for 30 s, and 72°C for 30 s.

Total RNA was extracted from 15 bovine urothelial tumour samples and 3 bladder samples from healthy cows (as negative control) as previously reported. 100ng of total RNA was used for One-Step RT-ddPCR Advanced Kit for Probes (Bio-Rad), according to the manufacturer’s instructions. The reaction was performed in a final volume of 20 μL containing: 10 μL of ddPCR Supermix for Probes, 0.9 μM primer for BPV2-E5, 0.25 μM probe, 2 ml Reverse transcriptase, 300nM DTT. The following primers were used: BPV-2 E5 Forward: 5’TACAGGTCTGCCCTTTTAAT 3’; Reverse: 5’AACAGTAAACAAATCAAATCCA3’; probe: 5’AACAACAAAGCCAGTAACC 3’ FAM.

A black hole quencher was used in combination with FAM fluorescent dye reporters (Bio-Rad Laboratories). The reaction mixture was placed into the sample well of a DG8 cartridge (Bio-Rad Laboratories). A volume of 70 μL of droplet generation oil was loaded into the oil well, and droplets were formed in the droplet generator (Bio-Rad Laboratories). After processing, the droplets were transferred to a 96-well PCR plate (Eppendorf, Hamburg, Germany). PCR amplification was carried out on a T100 Thermal Cycler (Bio-Rad Laboratories) with the following thermal profile: 50°C for 60min, 95 °C for 10 min, 40 cycles of 94°C for 30 s and 56°C for 1 min, 1 cycle at 98°C for 10 min, and ending at 4°C. After amplification, the plate was loaded onto a droplet reader (Bio-Rad Laboratories) and the droplets from each well of the plate were read automatically. QuantaSoft software was used to count the PCR-positive and PCR-negative droplets to provide absolute quantification of the target cDNA. Therefore, the ddPCR results could be directly converted into copies/µL in the initial samples simply by multiplying them by the total volume of the reaction mixture (20 µL) and then dividing that number by the volume of RNA sample added to the reaction mixture (5 µL) at the beginning of the assay. Each sample was analysed in quadruplicate.

To perform real-time RT-PCR analysis, total RNA and cDNA from diseased and healthy urinary bladder samples were generated, as described above. Real-time PCR was performed with a Bio-Rad CFX Connect™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA), using iTAq Universal SYBR^® Green Supermix (Bio-Rad). Each reaction was performed in triplicate, and the primers used for RIG-I, MDA5, TRIM 25, IKKα, IKKβ, IKKγ, and IFN-β were the same as those used for RT-PCR. The PCR thermal profile was as follows: 95°C for 10 min, 40 cycles of 94°C for 15 s, and 58°C for 30 s, followed by a melting curve. Relative quantification (RQ) was calculated using the CFX Manager™ software, based on the equation RQ=2−ΔΔCq, where Cq is the quantification cycle to detect fluorescence. Cq data were normalised to the bovine β-actin gene (forward: 5′- TAGCACAGGCCTCTCGCCTTCGT-3′, reverse 5′-GCACATGCCGGAGCCGTTGT-3′).

PCR products, obtained by RT-PCR, were purified using the QIAquick PCR Purification Kit 131 (Qiagen NW, DE) and were subjected to bidirectional sequencing using the Big Dye-Terminator v1.1 Cycle 132 Sequencing Kit (Applied Biosystems, CA, USA), according to the manufacturer’s recommendations. Dye terminators from 133 sequences were removed using a DyeEx-2.0 Spin Kit (Qiagen), and sequences were run on a SeqStudio 134 Genetic Analyzer (Thermo Fischer Scientific, CA, USA). Electropherograms were analysed using Sequencing Analysis v5.2 and Sequence Scanner v1.0 softwares (Thermo Fischer Scientific, CA, USA). The sequences were analysed using the BLAST program.

Healthy and diseased bovine urothelial samples were lysed in radioimmunoprecipitation assay (RIPA) buffer (50 mM Tris-HCl [pH 7.5], 1% Triton X-100, 400 mM NaCl, 1 mM 151 ethylenediaminetetraacetic acid, 2 mM phenylmethylsulfonyl fluoride, 1.7 mg/mL aprotinin, 50 mM 152 NaF, and 1 mM sodium orthovanadate). Protein concentration was measured using the Bradford assay (Bio-Rad). For western blotting, 50 μg protein lysate was heated at 90°C in 4X premixed Laemmli sample buffer (Bio-Rad), clarified by centrifugation, separated by sodium dodecyl sulphate–polyacrylamide gel electrophoresis, and transferred onto nitrocellulose membranes (GE Healthcare, UK). Membranes were blocked with Tris-buffered saline and 0.1% Tween 20 (TBST)- containing 5% bovine serum albumin (BSA) for 1 h at room temperature. The membranes were subsequently incubated overnight at 4°C with primary antibodies, washed three times with TBST, incubated for 1 h at room temperature with goat anti-rabbit or goat anti-mouse (Bio-Rad) HRP- conjugated secondary antibody, diluted at 1:5,000 in TBST containing 5% BSA, and washed three times with TBST. Immunoreactive bands were detected using Western Blotting Luminol Reagent (Santa Cruz Biotechnology) and ChemiDoc XRS Plus (Bio-Rad). Images were acquired using Image Lab Software version 2.0.1.

Total protein extracts from normal and pathological bladders, obtained as previously described, were immunoprecipitated. Protein samples (1mg) were incubated with anti-TRIM25 or anti-rabbit IgG (isotype), anti-Riplet or anti-rabbit IgG (isotype), and anti-MAVS or anti-mouse IgG antibodies (Bethyl Laboratories, Inc., TX, USA) for 1 h at 4°C with gentle shaking. Thereafter, the samples were centrifuged at 1,000 g for 5 min at 4°C and incubated with 30 μL of Protein A/G-Plus Agarose (sc-184 2003) (Santa Cruz Biotechnology) overnight at 4°C. The immunoprecipitates were washed four times in complete lysis buffer and separated on polyacrylamide gels. Subsequently, the proteins were transferred onto nitrocellulose membranes. The membranes were blocked for 1 h at room temperature (25°C) in TBST with 5% BSA, and then incubated with primary antibodies overnight at 4°C. After three washes in TBST, the membranes were incubated with secondary antibodies for 1 h at room temperature. Chemiluminescent signals were developed using the Western Blotting Luminol Reagent (Santa Cruz Biotechnology) and were detected using the ChemiDoc XRS gel documentation system (Bio-Rad).

Results are presented as the mean ± standard error (SE). Data were assessed by one-way analysis of variance (ANOVA), followed by Tukey’s test for multiple comparisons of means using the GraphPad PRISM software version 9 (GraphPad Software, San Diego, CA, USA). A p-value ≤ 0.05 indicated statistical significance. To analyse the relationship between protein or mRNA expression and BPV-2 E5 viral load, Spearman’s and Pearson’s correlation analyses were performed for protein or mRNA expression and BPV-2 E5 cDNA load in the same samples using GraphPad PRISM software version 9 (GraphPad Software, San Diego, CA, USA). A p-value ≤ 0.05 indicated statistical significance.

It is well known that bovine δPVs are the most important infectious agents involved in the etiopathogenesis of the majority of bovine urothelial tumours (18, 24). E5 oncoprotein expression is correlated with the transformation of both mesenchymal and epithelial cells to form benign and malignant tumours (25). Therefore, we attempted to verify whether the δPV E5 oncoprotein was expressed in the examined samples. First, we detected E5 oncoprotein transcripts by RT-PCR, the sequencing of which showed 100% identity with BPV-2 and BPV-13 sequences deposited in GenBank (Accession numbers M20219.1 and JQ798171.1, respectively) ( Supplemental Figure 1 ). Furthermore, Western blot analysis revealed the expression of E5 oncoprotein, which showed that abortive infection takes place (data not shown). We used One-Step reverse transcription (RT)-ddPCR tool to investigate the copy number of E5 oncoprotein mRNA in 15 cattle suffering from bladder cancer caused by persistent BPV infections (26). DdPCR method was able to detect and quantify E5 mRNA in cancer urothelial cells from all 15 cattle, however, no statistically significant differences in copy number of E5 mRNA were found ( Figure 1A ).

As many viruses, including human papillomavirus, have E3 ubiquitin ligases as their targets (27), we wondered whether the bovine δPV E5 oncoprotein might interact with some ligases involved in the antiviral innate immune response mediated by RLRs, the ubiquitination of which appears to be a key post-translational modification. However, the molecular mechanisms of ubiquitin-mediated RIG-I and MDA5 activation remain to be fully understood (28, 29).

Many studies have reported that TRIM25 and Riplet are two essential E3 ubiquitin ligases for RIG-I signalling as they are known to ubiquitinate and activate RLRs (6, 29).

Therefore, we investigated these two ligases by performing co-immunoprecipitation studies using anti-TRIM25 and anti-Riplet antibodies. The assay revealed the presence of E5 oncoprotein in anti-TRIM25 immunoprecipitates only, suggesting that the E5 oncoprotein of bovine δPVs interacts with TRIM25 but not with Riplet ( Figures 1B, C ). Our results are in line with in vitro studies performed on cells experimentally infected with HPV18, which showed that TRIM25 but not Riplet was a target of viral E6 oncoprotein (30). We then investigated the expression levels of these two ligases in 15 bladder samples from cattle cancer. Furthermore, we studied these two ligases in additional 15 bladder samples from uninfected, apparently healthy cattle, six of which showed small foci of lymphocytes beneath the normal urothelium. Western blot analysis of total extracts detected unmodified levels of Riplet expression ( Figures 2A, B ) and a statistically significant reduction in the expression of TRIM25 ( Figures 2C, D ) in neoplastic bladder cells in comparison with all apparently healthy bladder cells. To understand whether the marked reduction in TRIM25 expression levels could be attributed to transcriptional events and/or increased protein degradation, we investigated the presence of TRIM25 transcripts by RT-PCR. Sequencing of the obtained cDNA amplicons showed 100% identity with bovine TRIM25 sequences deposited in GenBank (Accession number: NM_001100336.1) ( Supplemental Figure 2 ). Then, we performed a real-time PCR analysis on cDNA using specific primers for bovine TRIM25. This molecular assay did not show any variation in transcript expression in cells infected with bovine δPVs compared with cells from clinically normal cattle ( Figure 2E ). These results suggest that bovine δPVs interfere at the protein level rather than at the transcriptional level in reducing TRIM25 expression.

Expression of RLRs is ubiquitous and is typically maintained at low levels in resting cells but is greatly increased after virus infection (3). Therefore, we decided to investigate RLR expression during spontaneous BPV infection.

We detected reduced expression levels of both RIG-I and MDA5 by Western blot analysis in urothelial cells infected by bovine δPVs compared with urothelial cells from clinically normal cattle including six animals showing foci of lymphocytes beneath the normal urothelium ( Figures 3A, B ). We assumed that the levels of these proteins could be due to transcriptional reduction. Using specific primers for bovine RIG-I and MDA5, we carried out a real-time PCR. Sequencing of the transcript amplicons revealed cDNA fragments showing 100% identity with bovine RIG-I and MDA5 sequences deposited in GenBank (Accession numbers: XM_002689480.6 and XM_010802053.2, respectively) ( Supplemental Figure 3 ). Real-time PCR of cDNA revealed a statistically significant reduction in both RIG-I and MDA5 transcripts in δPV-positive cells compared with all δPV-negative cells ( Figures 3C, D ). These results suggest that, like HPVs, bovine δPVs may interfere at the transcriptional level rather than at the protein level in reducing RIG-I and MDA5 expression to prevent their antiviral activities.

RIG-I and MDA5 interact with a mitochondrial adaptor, the mitochondrial antiviral signalling (MAVS) protein (4, 29). It remains unclear how MAVS acts as a scaffold to assemble the signalosome in RLR-mediated antiviral signalling (31). Western blot analysis of MAVS expression revealed unmodified protein expression levels in both δPV-infected and healthy cells (data not shown). Our results are in line with experimental data showing that the expression levels of MAVS did not significantly vary in cells in which the E6 oncoprotein of HPV18 was shown to act as a RIG-I transcriptional repressor (15). We then performed co-immunoprecipitation studies using an anti-MAVS antibody. Western blot analysis performed on the immunoprecipitates detected the presence of RIG-I and MDA5 as well as TRIM25, phosphorylated TANK-binding protease 1 (pTBK1), phosphorylated interferon regulatory factor 3 (IRF3), and Sec13, which is believed to be a positive regulator of MAVS (31) ( Figure 4 ). Western blot analysis performed on total extracts revealed a statistically significant reduction in the expression levels of Sec13 in δPV-infected cells compared with cells from clinically normal cattle ( Figures 5A, B ), which suggests that MAVS activation might be compromised in cells spontaneously infected with bovine δPVs. MAVS subsequently phosphorylates and activates TBK1 and IRF3, via an unknown mechanism, which results in the production of interferons as well as proinflammatory factors (32). Western blot analysis performed on anti-MAVS immunoprecipitates revealed the presence of pTBK1 and pIRF3, which suggests that MAVS forms a complex with pTBK1 and pIRF3 and plays a critical role in driving and coordinating synergistic functional activities of these downstream components. Moreover, we investigated the expression levels of TBK1 and IRF3 in total extracts of samples comprising three groups: 9 healthy bladders (BPV-negative, pTBK-low expression levels), 6 uninfected bladders containing small foci of lymphocytes in their wall (BPV-negative, pTBK-high expression levels) and 15 pathological BPV-infected bladders (BPV-positive, independently of pTBK levels). Immunoblotting revealed statistically significant reduced levels of both proteins in cells infected with bovine δPVs compared with uninfected cells ( Figures 5C, D ). Furthermore, western blot analysis revealed statistically significant reduced expression levels of pTBK1 ( Figures 5E, F ). TBK1 is activated via phosphorylation (33), which in turn phosphorylates and activates IRF3. Subsequently, IRF3 enters the nucleus to activate type 1 IFN (32, 34). Antiviral cytokines are also under control of nuclear factor kappa B (NF-kB), a family of transcription factors. It has been suggested that NF-kB is rendered inactive because virus infection results in reduced levels of inhibitor of kappa B kinase (IKK) complex, which is needed for NF-kB function (35). The canonical complex of IKK is composed of IKKα/IKKβ/IKKγ. Real time RT-PCR of mRNA of these IKKs showed significant reduced levels of mRNA of all three kinases in urothelial cells infected by BPVs compared to uninfected, heathy urothelial cells ( Figures 6A–C ). Then, we investigated the expression of downstream antiviral cytokines. In particular, we performed real time RT-PCR of mRNA of IFN-β, a cytokine essential for host antiviral responses. We detected a statistically significant reduced levels of INF-β mRNA by real time RT-PCR in urothelial cells infected by BPVs in comparison to uninfected urothelial cells of healthy cattle ( Figure 6D ).

Altogether, our results suggest that the transcriptional downregulation of RIG-I and MDA5 in cells infected with bovine δPVs is responsible for an aberrant downstream signalling pathway, including TBK1/IRF3, and IKKs which may lead to the impairment of the host antiviral response. Then, we asked whether there was a correlation between viral load and expression levels of investigated proteins. Our results showed a lack of a direct correlation ( Supplemental Figures 4 and 5 ).

In conclusion, RLR signalling pathway may be perturbed by BPV E5 oncoprotein, which allowed an adequate innate immune response to be not elicited against spontaneous bovine δPV infection, thus leading to persistent infection in the cells ( Figure 7 ).