B6.lpr mice were purchased from Jackson Laboratory (Bar Harbor, ME, USA). The B6.Sle2c1rec1c.lpr strain was previously described (7). All available polymorphic genetic markers were used to refine the rec1c interval and define its ends. The B6.ΔsNASP mouse with the mutated bases of the rec1c sNASP allele introduced into the B6 genome was created by Cyagen Biosciences Inc. with the targeting strategy presented in Figure 6A. The mutated bases of the rec1c sNASP allele are in exon 12 of Nasp-001 ENSMUST00000030456. To construct the targeting vector, two homology arms were generated by PCR using BAC clone RP24-384F21 and RP24-72F14 from the C57BL/6J library as template. The CTGTACTCCATGAGC sequence in exon 12 of the NASP gene, corresponding to exon 10 of the sNASP isoform, was mutated to CTATATTCCATGAGC in the 5′ homology arm. In the targeting vector, a Neo cassette was flanked by Frt sites and DTA was used for negative selection. The constructed targeting vector was electroporated into C57BL/6 mouse embryonic stem (ES) cells, and then selected positive ES clones were microinjected into blastocysts. Chimeric mice were screened by genotyping and then bred with an Flp-deleter mouse to generate F1 mouse with constitutive knockin (KI) rec1c sNASP allele through Flp-mediated recombination. Finally, F1 mice were intercrossed to obtain a homozygous transgenic B6.ΔsNASP model. Following the previously described protocol (6), the lpr mutation was bred into the B6.ΔsNASP mouse to generate a B6.ΔsNASP.lpr strain. Both male and female mice were used in this study, without difference between genders. The protocols for mice used in this research were approved by the Institute Animal Care and Use Committees of the University of Florida, USA and Weifang Medical University, China.

Genomic DNA of the lupus-prone strains MRL/MpJ-Fas^lpr/J, NZM2410/J, BXSB/MpJ, NZB/B1NJ, and NZW/Lac/J was purchased from Jackson Laboratory. The Agilent SureSelect XT Mouse All Exon Capture Kit (Agilent Technologies, Inc., Santa Clara, CA, USA) used in this project has 50 Mb capture, covering the complete mouse exome and spanning over 221,784 exons and 24,306 genes. Mouse whole exome sequencing was performed by the Beijing Genomics Institute (Shenzhen, China), including DNA fragmentation, adapter ligation, hybridization with capture library, next-generation Illumina sequencing with an average 30x coverage, and bioinformatics analysis according to mouse genome assembly NCBIm37 (strain C57BL/6J). We selected the homozygous SNPs corresponding to non-synonymous mutations, frameshifts, deletions, insertions, stop loss or gain in coding regions. Total RNA was purified from tissues using the Qiagen RNeasy kit (Qiagen, Valencia, CA, USA) and converted into cDNA by reverse transcription using the SuperScript III First-Strand Synthesis System (Thermo Fisher Scientific, Waltham, MA). The Sanger method was used to sequence cDNA or specific exons. RT-PCR was utilized to semi-quantitatively detect sNASP mRNA expression (Forward primer: 5′ ACAAGCCCATCTTAAACTTGGAG3′; Reverse primer: 5′ CTGAGATTCCTTTGCGTCTTCTA 3′).

The full-length mouse sNASP cDNA (encoding 448 amino acids) was prepared from B6.lpr mouse using RT-PCR and then inserted into the pET30a expression vector to obtain a pET30a-WT sNASP protein expression vector. The mutated bases of the rec1c sNASP allele were introduced into the WT sNASP protein expression vector using the Q5® Site-Directed Mutagenesis Kit (NEB, Ipswich, MA) to generate a pET30a-rec1c sNASP allele protein expression vector. All sNASP constructs were confirmed by DNA sequencing. WT and mutated expression vectors were transformed into E. coli BL21(DE3)and protein expression was induced by Isopropyl β-D-1-thiogalactopyranoside (IPTG). Ion-exchange chromatography and size exclusion chromatography were used to purify proteins from the bacterial lysate. The protein purity was verified using SDS-PAGE electrophoresis. Western-blotting was used to identify mouse sNASP protein using anti-mouse NASP mAb (A-7, Santa Cruz Biotechnology, Inc., Dallas, TX).

Mouse histones H1a, H3.1, H4 were purchased from Lifespan Biosciences (Seattle, WA). The H3.1/H4 tetramer complex was prepared by incubating a mixture of mouse H3.1 and H4 overnight at room temperature followed by purification with size exclusion chromatography. The binding affinity of sNASP for histones was determined using biolayer interferometer Octet K2 system (Pall Fortebio Corp., Menlo Park, CA) at 30′C, following the instrument user guide. Briefly, aminopropylsilane (APS) biosensors were rinsed in assay buffer for 120 s to obtain an initial baseline. Next, mouse sNASP WT and mutant proteins were immobilized on the APS biosensors for 110 s to get a loading curve. Third, the sNASP-immobilized-APS biosensors were dipped into assay buffer for 120 s to acquire another baseline. Fourthly, the sNASP-immobilized-APS biosensors were exposed to various concentrations of histone H1a, H3.1, H4, and H3.1/H4 tetramer complex in assay buffer for 240 s to obtain association curves (K_on/M⁻¹s⁻1). Finally, the sNASP-immobilized-APS biosensors were again dipped into assay buffer without histones to get disassociation curves (K_off/s⁻¹). The interaction of mouse sNASP and mouse histones was expressed as layer thickness (nm) over time (second). The binding affinity (K_D) was calculated by dividing K_on by K_off. The protein expression, purification and measurements of binding kinetics were performed by Detai Biologics Company (Nanjing, China).

IgG anti-dsDNA and anti-chromatin IgG were measured by ELISA as previously described (6). Briefly, mBSA-coated plates were coated overnight with 50 mg/ml dsDNA for anti-dsDNA autoantibody detection. 10 mg/ml of histone H1, H2A, H2B, H3, and H4 were added to the dsDNA-coated plate for anti-chromatin autoantibody measurement. Test sera at 1:100 dilution was added to the plates and bound autoantibodies were detected using alkaline phosphatase-conjugated goat anti-mouse IgG and pNPP substrate. Raw optical densities were converted to units per milliliter, using a standard curve derived from pooled MRL/lpr serum, arbitrarily setting the reactivity of a 1:100 dilution of this serum to 100 U/ ml.

Cell subsets and activation status in spleen and lymph nodes were determined by flow cytometry as previously described (8). In brief, single-cell suspensions were prepared and depleted of red blood cells with 0.83% NH₄Cl Tris-buffer. Cells were blocked with saturating amounts of anti-CD16/CD32 (2.4G2) and stained with fluorochrome-conjugated antibodies against CD3e (145-2C11), CD4 (RM4-5), CD69 (H1.2F3), CD44 (IM7). All antibodies were purchased from BD Pharmingen (San Jose, CA, USA) or eBioscience (San Diego, CA, USA). At least 50,000 events were acquired per sample using a FACSCalibur cytometer (BD Biosciences, San Jose, CA, USA).

Tissues from 4 to 5-months-old mice were fixed and stained with hematoxylin and eosin (H&E). In addition, kidneys were also stained with periodic acid Schiff (PAS). Renal lesions were scored in a blinded manner following the previous report (7), and briefly speaking: grade 0, normal glomeruli, and evident capillary loops and unexpanded mesangium; grade 1, evident capillary loops, and widened mesangium with mild hypercellularity; grade 2, evident capillary loops, and expanded mesangium with more than moderate hypercellularity; grade 3, diminished capillary loops, swollen glomeruli, and more than 50% of all glomeruli with diffuse endocapillary proliferation; grade 4, no capillary loops, and basement membrane thickening and significant mesangial proliferation, more than 90% of all glomeruli with diffuse endocapillary proliferation. Lung pathology alterations were evaluated semi-quantitatively following the protocols in our publication (15), to briefly summarize: grade 0, normal lung architecture; grade 1, 1–10% of alveolar in lung has the pathological alterations of exudates, atelectasis and increased inflammatory cell number; grade 2, 10–25% of alveolar in lung shows the above pathological alterations and mild infiltrate of inflammatory cells around arteries and veins; grade 3, 25–50% alveolar in lung displays the above pathological alterations and moderate infiltrate of inflammatory cells around arteries and veins; grade 4, >50% alveolar in lung demonstrates the above pathological alterations and heavy infiltrate of inflammatory cells around arteries and veins.

The presence of immune complexes in the kidneys were evaluated on 5 μm frozen sections stained with FITC-conjugated rat anti-mouse C3 (SC-58926, Santa Cruz Biotechnology, Dallas, TX) and IgGκ BP-CFL 488 (SC-516176, Santa Cruz Biotechnology, Dallas, TX). Staining intensity was evaluated by examining sections with Olympus BX53 fluorescence microscope and DP80 camera (Diagnostic Instruments). Average 20 glomeruli for each sample was recorded as semi quantitative 0–4 scale using Image J software (NIH).

Data were analyzed with GraphPad Prism 5.0 software with the statistical tests indicated in the text. Non-parametric tests were used when data were not distributed normally.

Since the rec1c interval is of NZB origin (8), we refined its map and defined its ends by genotyping all available markers that are polymorphic between the NZB and B6 genomes (Figure 1), including microsatellite Mit and single-nucleotide polymorphisms (SNPs) markers collected from the Mouse Genome Informatics (MGI), the National Center for Biotechnology Information (NCBI) or identified through our own genomic sequencing. The rec1c interval includes D4Mit278 at the centromeric end and rs27480282 at the telomeric end, but excludes the Novel5 marker and rs27513842, defining rec1c as a 1.39–2.99 Mb interval (Figure 1). The rec1c and rec1d1 subloci do not overlap, but together cover the entire rec1d sublocus. The rec1c is in a gene-rich region, which contains 44 protein-coding genes, including those in the intersection area of B6 and NZB genomes (Figure 1).

We analyzed the autoimmune pathology of the rec1c.lpr strain by comparing with control B6.lpr mice at the age of 4–6 months. The spleen sizes of rec1c.lpr mice were similar as that of B6.lpr mice, but the rec1c.lpr mice presented larger pooled lymph nodes (469 ± 46 mg), about 2 times larger than that of B6.lpr mice (292 ± 16 mg) (Figure 2A). The rec1c.lpr mice showed the same percentage of CD3⁺ T cells in spleen and lymph nodes (Figure 2B) and similar frequencies of CD4⁺ T cell expressing the early activation marker CD69 (Figure 2C) as B6.lpr mice. A small but significant increased frequency of CD44⁺CD4⁺ effector T cells was however observed in rec1c.lpr mice (Figure 2D).

The rec1c.lpr mice produced the same amount of serum anti-dsDNA and anti-chromatin IgG as the B6.lpr mice (Figure 3A). As the rec1c.lpr mice displayed a milder lymphadenopathy than rec1a.lpr or rec1d.lpr mice, the pathology of their kidneys and lungs was not examined in our previous report (7). Unexpectedly, we found that rec1c.lpr mice developed significantly more severe renal and lung inflammation than age-matched B6.lpr mice (Figures 3B,C). B6.lpr mice showed a mild mesangial expansion, but the rec1c.lpr mice displayed a markedly proliferative kidney pathology with glomerular cell proliferation and inflammatory cell infiltrates in addition to mesangial expansion (Figure 3B). Most of B6.lpr mice exhibited normal blood vessels in their lungs, thin inter-alveolar septum, or a low degree of inflammatory infiltrates. In contrast, the rec1c.lpr lungs showed obvious histopathological alterations, including the presence of numerous congested blood vessels, large peribronchiolar and perivascular inflammatory cell infiltrates (Figure 3C). We also examined liver tissues and skin appearance. Most of B6.lpr or rec1.lpr mice displayed normal liver histology, although a few of them had perivascular inflammatory cell infiltrations without a difference between strains. Neither rec1c.lpr nor B6.lpr mice develop skin disease. These results indicated that the rec1c sublocus contains some potential disease-causing allele(s), which promotes inflammation of end organs.

To uncover potentially pathogenic genetic variants in the rec1c interval, we sequenced all exons of its 44 protein-coding genes using whole exome sequencing (WES). As a result, we identified a variant of somatic nuclear autoantigenic sperm protein gene (sNASP) with two mutations in exon 10: Chr4:g116,276,661 G>A and Chr4:g116,276,664 C>T (NCBI m37 assembly), which correspond to 841G>A and 844C>T, respectively, in the sNASP cDNA sequence (Figure 4A). Consequently, the rec1c allele of the sNASP protein has a substitution of two consecutive amino acid residues, V281I and L282F, in its putative histone-binding motif (19). We therefore anticipate that the rec1c sNASP protein may have an altered binding to histones. Sequencing of sNASP exon 10 in the NZB, NZW, NZM2410, MRL/lpr, and BXSB lupus-prone mice showed the rec1c mutations in the NZB and NZM2410 genomes, as expected, also in the NZW and MRL/lpr strains, but not in the BXSB strain (Figure 4B). B6.lpr and rec1c.lpr mice produced comparable amount of sNASP mRNA in their skin, thymus, bone marrow, and spleen (Figure 4C). Overall, these results identify the sNSAP allele as a candidate gene for the rec1c interval through its possibly altered binding to histones, and show that this allele is shared among several lupus-prone mouse genomes.

We next investigated the histone-binding function of the rec1c sNASP protein function. WT sNASP and rec1c sNASP proteins were expressed in E. coli and purified by ion-exchange chromatography and size exclusion chromatography with more than 90% purity (Figure 5A). Quantitative binding studies of the sNASP protein interacting with mouse histones H1a, H3.1, H4, and the H3.1/H4 tetramer were measured using biolayer interferometry (BLI). A representative BLI assay graph in Figure 5B shows the interaction of WT sNASP binding H4 histone as expressed by layer thickness (nm) over time (second). Table 1 lists the binding constants of the WT sNASP and rec1c sNASP proteins interacting with histones H1a, H3.1, H4, and H3.1/H4 tetramer. Both WT and rec1c sNASP proteins showed a stronger binding affinity for H3.1 than for H1a histone, with almost a 40-fold difference. However, the WT and rec1c sNASP proteins did not show any different affinity in binding these two histones. sNASP also showed a strong binding affinity for H4 histone or H3.1/H4 tetramer in comparison with its binding to H1a histone (Table 1). The rec1c sNASP showed significantly lower K_d values for binding to H4 histone or H3.1/H4 tetramer than WT sNASP. This indicated that the rec1c sNASP protein has a significantly stronger affinity for binding H4 histone or H3.1/H4 tetramer than WT sNASP protein. These data demonstrate that the substitution of two consecutive amino acid residues in the rec1 sNASP protein leads to an increased affinity of binding mouse H4 histone or H3.1/H4 tetramer.

To test the hypothesis that the rec1c sNASP protein, which displays an increased affinity for H4 histone and H3.1/H4 tetramer, is involved in autoimmune diseases, the most reliable approach is to construct a transgenic model with the mutated bases of the rec1c sNASP allele on the B6 background. Following the targeting strategy shown in Figure 6A, we used DNA homologous recombination to substitute the guanine at 4:116276661 and cytosine at 4:116276664 in the B6 genome with the corresponding adenine and thymine present in the rec1c sNASP allele. This transgenic model was called B6.ΔsNASP. DNA sequencing confirmed that B6.ΔsNASP mouse has the mutated bases of the rec1c allele in sNASP cDNA sequence (Figure 6B), which indicates that the rec1c sNASP allele was correctly introduced into B6 genome. Western blotting revealed that both B6 and B6.ΔsNASP strains express similar amounts of sNASP protein in the skin, spleen, and thymus (Figure 6C), indicating that the sNASP protein expression was not affected in the B6.ΔsNASP model. Moreover, similar to B6.rec1c mouse, the B6.ΔsNASP mouse displayed a normal growth and procreation, and did not develop any detectable autoimmune phenotypes (data not shown). Adopting the same strategy as we used with B6.rec1c.lpr, we introduced the lpr mutation into the B6.ΔsNASP model to generate B6.ΔsNASP.lpr (ΔsNASP.lpr) mice.

We comprehensively evaluated the autoimmune phenotypes and organ pathology of the ΔsNASP.lpr as compared to B6.lpr mice at the age of 4–6 months. The ΔsNASP.lpr mice developed an enhanced lymphadenopathy with an average weight of the spleen or lymph nodes about twice and triple that of B6.lpr mice, respectively (Figure 7A). Total cell numbers in spleen and lymph node of ΔsNASP.lpr mice significantly increased in comparison with B6.lpr mice (Figure 7B). The percentages of CD3⁺ T cells (Figure 7C) and CD19⁺ B cells (Figure 7D) in spleen and lymph nodes were comparable between B6.lpr and ΔsNASP.lpr mice. However, ΔsNASP.lpr mice have more absolute numbers of splenic and LN T cells (Figure 7E) as well as splenic B cells (Figure 7F) than B6.lpr mice. In addition, ΔsNASP.lpr mice showed higher percentages of activated CD69⁺CD4⁺ T cells (Figure 7G) and effector CD44⁺CD4⁺ T cells (Figure 7H) than B6.lpr mice in spleen and lymph nodes.

The ΔsNASP.lpr mice produced modestly elevated levels of serum anti-chromatin and anti-dsDNA IgG as compared with B6.lpr mice (Figure 8A). The immune complexes in kidney were detected using the indirect immunofluorescence technique. Although a small amount of mouse IgG was present in glomeruli, ΔsNASP.lpr mice showed significantly more IgG deposits in glomeruli than B6.lpr mice (Figure 8B). The ΔsNASP.lpr mice showed trace C3 deposit in glomeruli (Figure 8C). B6.lpr mice seemed to have less C3 accumulation in glumeruli than ΔsNASP.lpr mice. However, there were no statistical difference for C3 deposit in glomeruli between ΔsNASP.lpr and B6.lpr mice (Figure 8C). Pathological examination showed that the ΔsNASP.lpr mice, in addition to mild mesangial expansion, develop an enhanced proliferative renal pathology with an increased glomerular cell number and an infiltration of inflammatory cells in comparison with B6.lpr mice (Figure 8D). The renal pathology scores of the ΔsNASP.lpr mice were significantly higher than that of B6.lpr mice. However, both sNASP.lpr and B6.lpr mice at age of 4–6 months have trace proteinuria, without a significant difference between these two strains. Moreover, the ΔsNASP.lpr mice also showed significantly a more severe lung inflammation than B6.lpr mice (Figure 8E). The lung pathological characteristics of ΔsNASP.lpr mice were similar to what we observed in the rec1c.lpr mice. On the other hand, the ΔsNASP.lpr mice did not develop liver inflammation and dermatitis. In summary, the ΔsNASP.lpr mice not only reproduced all autoimmune phenotypes and organ pathology alterations of rec1c.lpr mice, but also developed additional autoimmune phenotypes, including increased sizes of spleen and lymph nodes, lymphocyte increase, expansion of activated or effector CD4⁺ T cells, IgG autoantibody elevation, and more IgG deposit in glomeruli. The characterization of the ΔsNASP.lpr model demonstrates that the sNASP allele is responsible for pathogenic contribution of the rec1c sublocus to mouse lupus.

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.