C57BL/6 mice were purchased from Janvier (LeGenest, France). TNFR2-deficient mice (C57BL/6-Tnfrsf1btm1Mwm) (23) were purchased from The Jackson Laboratory (Bar Harbor, ME, USA). C57BL/6N Ly5.1 (CD45.1) (24) mice were kindly provided by Petra Hoffmann, University of Regensburg. Mice carrying the conditional TNFR2^flox/flox allele (TNFR2^fl/fl) were generated by breeding Tnfrsf1b/tm1a(EUCOMM)Wtsi mice to FLPe delete mice (25). Location and orientation of both loxP sites and deletion of the beta-galactosidase reporter gene and the neomycin resistance cassette were verified by cloning of the corresponding PCR products and subsequent sequence analysis. For genotyping the following primers were used: 5′ TGTGAGTGCAAGGACACACGGTGC 3′ and 5′ GGCCAGGAAGTGGGTTACTTTAGGGC 3′. Cell-specific ablation of TNFR2 on T cells (CD4cre/TNFR2^fl/fl) was achieved by breeding TNFR2^fl/fl mice to CD4-Cre mice (26). CD4cre/TNFR2^fl/fl lack the expression of TNFR2 on T cells while the expression on myeloid cells is not changed. To generate macrophage- and neutrophil-specific TNFR2-deficient mice (LysMcre/TNFR2^fl/fl), TNFR2^fl/fl mice were crossed with LysM-Cre mice (27). Fewer myeloid cells express TNFR2 in these mice and the expression is mainly seen on immature myeloid cells of the MO-MDSC subtype. Mice were bred and housed in an animal facility with barrier conditions at the University of Regensburg. This study was carried out in accordance with institutional guidelines. The protocol was approved by the district government of Lower Franconia, Würzburg (Az: 54-2532.1-27/10, AZ: 54-2532.1-37/13).

Generation of tenascin-trimerized single-chain mouse TNF receptor p80 (TNFR2)-specific TNF (TNCscTNF80) as a TNFR2-specific agonist has been described recently as STAR2 (13). The TNCscTNF80 expression cassette was subcloned into pT2/SV-Neo and transfected into HEK293 cells together with the Sleeping Beauty Transposon plasmid pCMV(CAT)T7-SB100 [Addgene, Cambridge, MA, USA (28)] to produce TNCscTNF80 from HEK293 transfectants. TNCscTNF80 contains a Flag epitope and was purified from cell supernatants by affinity chromatography on anti-FlagM2 Agarose and eluted with Flag-peptide (Sigma, Deisenhofen, Germany). After dialysis (Spectra/Por, Serva, Heidelberg, Germany), the protein concentration was determined by scanning (Typhoon 9200, GE Health Care, Solingen, Germany) a SyproRed (Invitrogen, Carlsbad, CA, USA)-stained polyacrylamide gel (10% SDS-PAGE) and comparing the intensity of the TNCscTNF80 band with that of a BSA protein standard (Invitrogen, Life Technologies, Darmstadt, Germany) using the Image Quant TL 7.0 Analysis software (GE Health Care). Biological activity and specificity was routinely tested in a T cell proliferation costimulator test: carboxyfluorescein succinimidyl ester (CFSE, eBioscience, Frankfurt, Germany)-labeled spleen cells (2 × 10⁶/ml) were cultured with anti-CD3 (0.1 µg/ml) with or without TNCscTNF80 (50 and 5 ng/ml) for 72 h. Proliferation of CD4 and CD8 T cells was quantified by FACS analysis. Lipopolysaccharide contamination was excluded in control experiments with heat-inactivated TNCscTNF80. TNCscTNF80 exclusively and specifically binds to and activates TNFR2 but not TNFR1 (13).

Cell separation out of cell suspensions was performed with magnetic beads following the instructions of the manufacturer (Miltenyi Biotec GmbH, Bergisch Gladbach). Bone marrow-derived myeloid cells were generated from bone marrow as described (29). For evaluation of NO production capacity, these cells were stimulated with LPS (E. coli O127:B8, 0.1 µg/ml, Sigma) and IFNγ (120–240 IU/ml, PeproTech GmbH, Hamburg) for 48 h.

Single cell suspensions were prepared from spleens, and pooled lymph nodes and red blood cells were lysed, or cells were harvested from cell culture. Unspecific antibody binding was blocked by anti-FcRII/III-antibody (BD Biosciences, Heidelberg, Germany) and cells stained with fluorochrome-labeled antibodies. Antibodies for flow cytometric analyses were purchased from either eBiosciences (Frankfurt, Germany) or BD Bioscience. Fluorescence was measured on a BD LSR-II cytometer and analyzed using FACSDiva software (BD Biosciences). Living single cells were gated based on forward/sideward scatter properties.

Single cell suspensions from spleens were prepared, and red blood cells lysed. For proliferation assays, splenocytes were labeled with 1 µM CFSE (Invitrogen). CFSE-labeled splenocytes (2 × 10⁵) or purified T cells (5 × 10⁴) were activated with 0.1 µg/ml anti-CD3ε antibody (clone 145.2C11, purified from hybridoma supernatant) with or without additional stimulation as indicated for 72 h. In an experiment to test the requirements for CD28, T cells were purified from splenocytes before CFSE-labeling. CFSE-labeled T cells were then stimulated with 0.5 µg/ml anti-CD3ε antibody, with or without 2.5 µg/ml anti-CD28 (clone 37.51), with or without blocking anti-CD80 (clone 16-10A1, 10 µg/ml) + anti-CD86 (clone GL-1, 10 µg/ml) antibodies. Cell proliferation was analyzed after 72 h by assaying CFSE dilution by flow cytometry.

Treg cells with a purity of more than 98% CD4⁺CD25^highCD62L⁺ from wild-type as well as TNFR2^−/− mice were cultured in the presence of anti-CD3ε and anti-CD28 antibodies (MACSiBead particles, Miltenyi Biotec) and recombinant human IL-2 (Proleukin S, Novartis Pharma, Basel, Switzerland) with or without TNCscTNF80 according to the instructions of the manufacturer of the Treg cell expansion kit (mouse, Miltenyi Biotec) for 7 days.

Carboxyfluorescein succinimidyl ester-labeled effector spleen cells (0.5–1.5 × 10⁵) were cultured with or without Treg cells for 72 h as described (10, 30). Labeled effector cells from TNFR2-deficient mice were used to avoid interferences by activation of the TNFR2 on effector cells in the cultures. Duplicate or triplicate cultures were stimulated with soluble anti-CD3ε antibodies (0.5 µg/ml, BD Bioscience) for 72 h. Interleukin 10 (IL-10) was quantified using the Duo Set ELISA (R&D Systems, Minneapolis, MN, USA) according to the manufacturer’s instructions. To determine the suppressive activity of myeloid suppressor cells, CFSE-labeled spleen cells (2 × 10⁵) were stimulated with anti-CD3ε (0.25 µg/ml, BD Bioscience) and anti-CD28 (0.125 µg/ml, BD Bioscience) and cultured with or without different numbers of bone marrow-derived myeloid cells. Proliferation of CD4 or CD8 T cells was determined by flow cytometry. Nitrite concentrations in the supernatants were determined using Griess reagent measuring the optical density at 540 nm.

Naïve TNFR2^fl/fl, CD4cre/TNFR2^fl/fl, LysMcre/TNFR2^fl/fl, and TNFR2^−/− mice were injected six times (ip) with either TNCscTNF80 (75 µg/mouse) or PBS every other day. Two days after treatment cessation, between 1.5 × 10⁶ and 1 × 10⁷ CFSE-labeled T cells from untreated wild-type mice were adoptively transferred and in vivo activated with anti-CD3ε antibody (10 µg/mouse, purified from hybridoma supernatant of clone 145.2C11, iv) the next day. Three days later, splenocytes and the axial, brachial, and inguinal lymph node cells were analyzed by flow cytometry for T cell proliferation.

To induce chronic inflammation in mice, the model described by Sade-Feldman was used (20). In brief, mice were immunized three times with Mycobacterium tuberculosis-BCG (231141, 50 µg, Difco Laboratories, Detroit) in incomplete Freund’s adjuvant (Sigma) every 7 days with the last injection without Freund’s adjuvant. Two days later, mice were analyzed.

GraphPad Prism 5 was used as statistical software for the data analyses. For comparing two groups, Student’s t-test was used. For comparing multiple groups, one-way ANOVA with Tukey post hoc test, or two-ANOVA with Bonferroni post hoc test were used. For analysis of experiments with several dilutions of anti-CD3-antibody, the area-under-the-curve was calculated and used for the statistical analysis. Statistical significant results (p < 0.05) are indicated with asterisks (*) in the figures.

Treatment with a recombinant agonistic fusion protein (TNCscTNF80) with selective activity for mouse TNFR2 induced expansion of Treg cells in mice as reported recently (13). To analyze the effect in more detail on a cellular and molecular level, we tested TNCscTNF80 for costimulation of T cell activation. The costimulatory effect of TNF can be measured as facilitated induction of T cell proliferation and has been described to be TNFR2-specific (31, 32). Mouse spleen cells were cultured with limiting concentrations of anti-CD3ε agonistic antibody (to activate the TCR) in the presence or absence of recombinant human TNF, mouse TNF, or TNCscTNF80, and the proliferation of CD4 and CD8 T cells was analyzed. Figure 1 shows data of CD4 T cells; CD8 T cells responded in a similar way (data not shown). Consistent with the concept of TNFR2 as a costimulatory receptor, TNCscTNF80 induced proliferation of T cells (Figure 1A) only in combination with parallel activation of the TCR. Such requirement of TCR activation for the effect of TNCscTNF80 on T cells has already been described recently (13). Costimulation by TNCscTNF80 was superior over mouse TNF at low protein concentrations. Human TNF, known not to activate the mouse TNFR2 (31, 33), did not affect T cell proliferation. TNCscTNF80 improved the proliferation of CD4 as well as CD8 T cells from wild-type mice in a dose-dependent fashion (Figure 1B). CD8 T cells reacted at about four times lower anti-CD3 concentrations than CD4 T cells to the TNFR2 costimulation. TNCscTNF80 had no costimulatory effect on T cells from TNFR2-deficient mice confirming the TNFR2-specificity of the agonistic agent (Figure 1C). TNCscTNF80 in the presence of 0.5 µg/ml anti-CD3ε also strongly enhanced the IFNγ release in spleen cell cultures from 28.8 pg/ml in controls without TNCscTNF80 to 1,165.2 pg/ml in cultures with TNCscTNF80 (10 ng/ml).

Similar to T cells from TNFR2-deficient mice, T cells from CD4cre/TNFR2^fl/fl mice, lacking TNFR2 on all T cells (Figure 2A), did not react to TNCscTNF80 costimulation (Figure 1C). By contrast, T cells from LysMcre/TNFR2^fl/fl mice—with reduced TNFR2 expression on myeloid cells and in particular on immature myeloid cells of the MO-MDSC subtype (Figures 2B,C)—showed a proliferative pattern similar to wild-type T cells upon TNCscTNF80 application.

The costimulatory effect of TNCscTNF80 for T cell proliferation was prevented by blocking the activation of CD28 by using anti-CD80 antibodies, demonstrating that TNCscTNF80 was not able to compensate for lack of CD28 activation (Figure 1D).

The requirement for direct activation of TNFR2 on T cells for costimulation by TNCscTNF80 was validated further using mixed cultures of splenocytes from wild-type and TNFR2-deficient mice. The proliferation of TNFR2-deficient T cells was not enhanced by TNCscTNF80 even in cultures also containing T cells from wild-type mice (Figure 1E).

To test the influence of the TNFR2 agonist on the suppressive function of Treg cells, TNCscTNF80 was added to Treg cell-containing cultures of proliferating T cells. Cells from TNFR2-deficient mice were used as CFSE-labeled effector T cells to avoid any costimulatory effect by the activation of the TNFR2 on the effector T cells. Added to such suppression cultures, TNCscTNF80 diminished the Treg-induced suppression of CD4 T cells (Figure 3A). In this experimental setup, CD8 T cells were not suppressed by Treg cells. Hence, a possible reduction of CD8 T cell suppression was not assessed.

To further study the impact of TNCscTNF80 on Treg cells, total splenocytes were cultured in the presence of agonistic anti-CD3ε antibody. Interestingly, phenotypic analysis demonstrated that TNCscTNF80 increased the expression levels of CD25 and Foxp3 of Treg cells after 72 h in these cultures (Figure 3B). However, TNCscTNF80 downregulated the percentages of Treg cells positive for CD39, GITR, or CD25 within 48 h, while CD73, OX40L, and CTLA-4 were not affected. No effects were observed at 3 h of culture (Figure 3C). Furthermore, we did not observe an impact on TNFR2 levels of Treg in such cultures (data not shown). The TNFR2 agonist had marginal effects on the IL-2-induced activation of STAT5 and did not affect pZAP70 in Treg cells during T cell activation (data not shown). This is in full agreement with results of Kim et al. suggesting discrete effects of TNFR2 on the signaling pathways of T cells (2, 34, 35).

Since the presence of TNCscTNF80 seemed to improve viability and expansion of Treg cells, highly purified Treg cells were stimulated and cultured in the presence of IL-2 with or without TNFR2 agonist. As CD8 T cells would overgrow costimulated T cell cultures, single contaminating CD8 T cells were avoided by very careful sorting of purified Treg cells. Treg cells with a purity of more than 98% of CD4⁺CD25^highCD62L⁺ cells from wild-type as well as TNFR2^−/− mice were cultured in the presence of anti-CD3ε and anti-CD28 antibodies and recombinant human IL-2 with or without TNCscTNF80 for 7 days. By the end of the expansion period, Treg cells had expanded 23.9-fold without TNCscTNF80. This expansion was increased to 29.4-fold by the presence of the TNFR2 agonist (Figure 3D). As expected, TNFR2-deficient Treg cells did not profit from the enhancing effect of TNCscTNF80 in the same experiment (yield 24.1 and 24.7-fold, respectively; similar effects were observed in a second experiment). The expanded cells of both groups consisted of at least 97% Treg cells and expressed similar levels of various Treg signature markers, e.g., CD25, FoxP3, and GITR (data not shown).

TNFR2 also plays a role during the differentiation of myeloid precursor cells from the bone marrow to mature myeloid cells as has been shown previously (21). Lack of TNFR2 retarded differentiation of bone marrow cells from TNFR2-deficient mice and led to reduced suppressor activity of TNFR2-deficient immature myeloid cells for T cells. To test the influence of direct TNFR2 activation during myeloid cell differentiation, bone marrow cell cultures from wild-type mice containing GM-CSF with or without TNCscTNF80 were analyzed. Intriguingly, activation of TNFR2 by the TNFR2 agonist reduced the cellular yield and retarded the maturation of cells from such cultures in a similar way as seen with cells of TNFR2-deficient mice (Figures 4A,B). TNCscTNF80 also reduced their T cell suppressive activity (Figure 4C) and their capacity to produce nitrite (Figure 4D).

Furthermore, reduced nitrite production capacity following activation by LPS and IFNγ was found for bone marrow-derived myeloid cells from LysMcre/TNFR2^fl/fl compared with wild-type mice (Figure 4E). Thus, suppressive activity of myeloid suppressor cells seems to depend on TNFR2 expression on myeloid cells since bone marrow-derived suppressor cells from TNFR2-deficient mice have also been described to be less suppressive (21).

In the in vitro experiments described earlier, we have observed that TNFR2 activation has different effects on the functions of Treg cells and myeloid cells. To evaluate the in vivo impact of the TNFR2 on these cell populations on Treg cell function, Treg cells were isolated from wild-type (TNFR2^fl/fl) and TNFR2-deficient mice as well as from CD4cre/TNFR2^fl/fl and LysMcre/TNFR2^fl/fl mice, and their suppressive activity was compared in a T cell suppression assay. Treg cells from TNFR2-deficient mice clearly suppressed the T cell proliferation to a lower degree compared with Treg cells derived from wild-type mice as previously shown (21). Surprisingly, TNFR2-deficient Treg cells from CD4cre/TNFR2^fl/fl mice suppressed T cell proliferation as good as wild-type Treg cells. By contrast, Treg cells from the LysMcre/TNFR2^fl/fl mice, with TNFR2-deficient myeloid cells, seemed to be less suppressive than wild-type Treg cells (data not shown). These experiments were not repeated since the in vitro suppression test might not reflect the in vivo situation.

To further analyze the impact of TNFR2 on leukocyte function, naïve mice were treated with TNCscTNF80. A single injection had no measurable effect on the spleen; two injections of TNFR2 agonist given within 24 h induced mild splenomegaly (Figure 5A). After two or three injections of TNCscTNF80, no change in the composition of splenocytes was observed while changes were observed in the bone marrow: mice developed first signs of increased numbers of myeloid cells after two injections, thus, indicating only a very mild peripheral inflammatory reaction to specific TNFR2 activation. A mild transient myelopoiesis was observed in the bone marrow, with an increase of CD11b⁺ myeloid cells from 42.4% in untreated mice to 62.0% in TNCscTNF80-treated mice, of CD11b⁺Ly6G⁺ immature myeloid cells from 26.2 to 43.2%, and of CD11b⁺Ly6C^high from 4.1 to 7.1%, respectively, after three injections of TNFR2 agonist.

When TNCscTNF80 was injected six times every other day into naïve mice, significantly enhanced spleen weight and increased myelopoiesis in the bone marrow were observed. In addition, repeated TNFR2 activation expanded Treg cells in the spleen and lymph nodes in a TNFR2-dependent manner (Figure 5B and data not shown). To test whether such mice after repeated TNCscTNF80 treatment are immune suppressed, wild-type T cells were adoptively transferred into different mouse lines that do not express TNFR2 on specific cell types. Proliferation of T cells was only reduced in wild-type (TNFR2^fl/fl) and in LysMcre/TNFR2^fl/fl recipient mice. TNCscTNF80 treatment did not lead to a reduction of T cell proliferation in case of ablated systemic TNFR2 expression in TNFR2^−/− mice or T cell-specific TNFR2 deficiency in CD4cre/TNFR2^fl/fl mice (Figure 5C). These findings indicate that TNFR2 on host T cells but not host myeloid cells is required for immune suppression.

To test the in vivo effects of TNFR2 stimulation in mice with ongoing inflammation, the model of chronic inflammation by Sade-Feldman was used (20). In this model, a challenge with BCG induces a strong splenomegaly in BCG-pretreated mice. The expansion of the myeloid cell fraction in bone marrow (data not shown) and spleen (Figure 6A) was paralleled by a compression of the lymphocyte compartment (Figure 6B) documenting ongoing myelopoiesis. BCG pretreatment of mice did not change the frequency of Treg cells in the CD4 T cell population compared with untreated mice (Figure 6C). Similar effects of BCG immunization were found in TNFR2-deficient mice and in mice from the CD4cre/TNFR2^fl/fl and LysMcre/TNFR2^fl/fl mouse lines indicating a TNFR2-independent inflammatory reaction upon BCG immunization (data not shown).

In contrast to injections of the TNFR2 agonist into naïve mice, already a single or two injections of TNCscTNF80 given before the last BCG challenge significantly enhanced the frequency of Treg cells in the splenic CD4 T cell population of BCG-immunized mice (Figure 6C). In addition, the activation of TNFR2 enhanced the suppressive activity of Treg cells for CD4 T cell proliferation (Figure 6D). The immune regulatory cytokine IL-10 was also markedly increased in the suppression cultures containing Treg cells from TNCscTNF80 pretreated animals (Figure 6E). However, the frequency of Treg cells in BCG-immunized mice was not altered by two injections of the agonist when given 1 or 3 days after the BCG challenge (data not shown).