Chloroquine diphosphate salt, dl-sulforaphane (SFN), phorbol-12 myristate-13 acetate (PMA), N-acetyl-l-cysteine (NAC), Wortmannin, and LY294002 hydrochloride were purchased from Sigma-Aldrich (St. Louis, MO, USA). AKTi (AKT inhibitor VIII, Akt1/2) was purchased from Santa Cruz Biotechnology (Dallas, TX, USA). Poly (cytidylic-inosic) acid potassium salt (PolyI:C) and the PKR inhibitor CAS 608512-97-6 were purchase from Calbiochem-Millipore (Darmstadt, Germany). Human recombinant interferon-alpha 2b was obtained from Blausiegel (Cotia, SP, Brazil).

The mouse macrophage leukemia cell line RAW 264.7 (TIB-71; American Type Culture Collection (ATCC), Manassas, VA, USA), the human monocytic leukemia cell line THP-1 (ATCC:TIB202TM) and the human embryonic kidney cell line HEK-293T (ATCC:CRL-11268) were maintained in DMEM medium with high glucose (Vitrocell Embriolife, Campinas, SP, Brazil) supplemented with 10% heat-inactivated fetal bovine serum (Sigma-Aldrich, St. Louis, MO, USA). THP-1 cells were differentiated to macrophages with 40 ng/mL of PMA for 3 days. Afterward, the cells were washed three times with PBS and incubated with fresh medium for an additional 3 days. RAW 264.7 cells expressing either empty vector (RAW-Bla cells) or a dominant-negative PKR K296R (RAW-DN-PKR cells) were donated by Dr. Aristóbolo Silva, Federal University of Minas Gerais, Brazil.

Ten-week-old male 129/SvEv PKR^−/− (PKR-ko) and their respective wild-type littermates (WT) were used for experiments. Briefly, 4 days before peritoneal lavage, 2 mL of 3% thioglycolate were intra-peritoneally injected in each mouse. Thioglycolate-elicited peritoneal macrophages from wild-type or PKR-knockout 129Sv/Ev were obtained by injecting 8 mL of serum-free DMEM into the peritoneal cavity. After 1 h, the cells were washed once in PBS and then plated in in DMEM medium supplemented with 10% FBS on glass coverslips at 2 × 10⁵/well in 6-well or 24-well polystyrene plates for subsequent Leishmania infection assays.

To induce the activation of Nrf2, 10 mM SFN were used as positive controls. For the inhibition of PKR activity, we pretreated the cells for 1 h with 300 nM of the PKR inhibitor (PKRi). To induce PKR activation, poly(inosinic-cytidylic-) acid potassium salt (PolyI:C) at a final concentration of 25 µg/mL or recombinant IFNα-2b at 1,000 U/mL were used. PI3K/Akt inhibition was accomplished by cell treatment with 10 µM LY294002, 10 mM Wortmannin or 5 mM AKTI (AKT inhibitor VIII Akt1/2). To inhibit autophagy, we used 40 µM chloroquine. N-acetylcysteine (NAC) was used at a concentration of 10 mM.

Leishmania (Leishmania) amazonensis (WHOM/BR/75/Josefa) and Leishmania (Viannia) braziliensis (BA788) were used in this study. The L. (L.) amazonensis strains obtained from biopsies of patients with diffuse cutaneous leishmaniasis (DCL) (Ba276, Ba336, and Ba760) or localized cutaneous leishmaniasis (Ba69, Ba73, and Ba125) were also used in vitro assays. The promastigote forms were grown at 26°C in Schneider’s Insect Medium (Sigma-Aldrich) with 10% fetal bovine serum, and metacyclic promastigotes were collected from stationary cultures and used for cell infections. Macrophages were infected with Leishmania promastigotes at a parasite:cell ratio of 10:1 at 37°C. Infected macrophages were counted in a Neubauer Chamber by light microscopy to assess the infection index, which was calculated by multiplying the percentage of infected macrophages by the average number of parasites per macrophage in Giemsa-stained slides.

THP-1 cells (1 × 10⁶ cells) were washed twice with ice-cold PBS and then lysed in 100 µL of lysis buffer (50 mM Tris-HCl, pH 7.5, 5 mM EDTA, 10 mM EGTA, 50 mM NaF, 20 mM β-glycerophosphate, 250 mM NaCl, 0.1% Triton X-100, 1 µg/mL BSA, and a 1:100 dilution of protease inhibitor cocktail, Sigma-Aldrich, St. Louis, MO, USA) for total protein extraction. For nuclear protein extraction, after infection and/or treatment, the cells were washed twice with 1x PBS and then lysed with 100 µL of buffer A (HEPES 10 mM pH 7.9. 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, NP-40 0,25% (v/v); cocktail of protease inhibitors) for 10 min on ice. The lysed cells were centrifuged at 14,000 g for 1 min at 4°C, and the pellet was resuspended in 60 µL of buffer C (20 mM HEPES pH 7.9, 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 20% glycerol, protease inhibitor cocktail) and incubated on ice for 20 min. The lysate was centrifuged at 14,000 g for 5 min, and the supernatant containing nuclear proteins was collected in a new tube. The protein extracts were subjected to electrophoresis on 10% SDS-polyacrylamide gels and transferred to nitrocellulose membranes (Amersham Biosciences, Piscataway, NJ, USA). After blocking with 5% non-fat dry milk in TBS with 0.1% Tween-20 (TBS-T), the blots were incubated over-night with antibodies against PKR (12297), Nrf2 (12721), GSK3 (9369), Sqstm1/p62 (5114), LC3B (2775), phospho-GSK3β-Ser9 (9336), phospho-Akt-Ser473 (9271), phospho-eIF2α-Ser51 (9721), α-Tubulin (2144), β-Tubulin (2146), and Lamin A/C (2032) from Cell Signaling Technology; phospho-PKR Th451 (07-886) from Millipore; keap1 (150654) from Abcam; and β-actin (47778), Sod1 (8637), followed by anti-rabbit (2004) or anti-mouse (2005) horseradish peroxidase-conjugated IgG (1:4,000) from Santa Cruz Biotechnology. The membranes were then submitted to three washes with 0.1% TBS-T after each incubation, and the proteins were detected using the ECL chemiluminescent detection system (Amersham Biosciences).

To validate the differential expression of Nrf2 (C20—Santa Cruz Biotechnology) and keap1 (150654—Abcam) in DCL and LCL samples, immunohistochemistry was performed on formalin-fixed, paraffin-embedded (FFPE) sections. Briefly, after deparaffinization, rehydration and target retrieval (DAKO Corporation, Hamburg, Germany), slides from five DCL and five LCL cases were incubated with serum-free protein block reagent and then incubated overnight with Nrf2 or Keap1 (4and 10 mg/mL, respectively, both from Abcam, Cambridge, United Kingdom) or anti-rabbit isotype control antibodies. After the sequential application of a peroxidase-blocking reagent, DAKO EnVision + System-HRP (DAKO Corporation, Hamburg, Germany), digital images of the tissue sections were captured using a Nikon E600 light microscope and a Q-color 1 Olympus digital camera. Sections of prostate and lung adenocarcinoma were used as positive controls. Quantification of the stained areas was performed using Image Pro Plus software (Media Cybernetics).

To investigate the promoter activity, RAW-264.7 cells (1 × 10⁵ cells per well) was plated in 48-well polystyrene plates and transfected with 1 µg of reporter plasmids using LIPOFECTAMINE 2000 reagent (Invitrogen, Carlsbad, CA, USA). THP-1 cells (2 × 10⁶) were transfected with 0.5 µg of luciferase reporter plasmids using Nucleofector™ Technology (Lonza, Basel, Switzerland) according to the manufacturer’s instructions. The following plasmids were employed in the assays: Sod1-basal, Sod1-ΔARE, Sod1-WT, 3xARE, and Nrf2-WT. For normalization of the luciferase readout, the plasmid pRL-CMV (Promega) was used. After infection and treatment, the cells were washed with PBS, lysed according to the Dual Luciferase System protocol (Promega), and analyzed using the GloMax^®-Multi detection system (Promega Corp., Madison, WI, USA).

Chromatin immunoprecipitation assay analysis was carried out according to the Simple ChIP Enzymatic Chromatin IP kit protocol (Cell Signaling). RAW 264.7 (WT-PKR and DN-PKR) cells or the human monocytic leukemia cell line THP-1 (ATCC:TIB202TM) were plated to confluence in 15 cm dishes. After infection, the cells were fixed with 1% formaldehyde for 10 min at room temperature, followed by the addition of glycine to a final concentration of 125 mM for 5 min at room temperature prior to cell lysis. One unit of micrococcal nuclease was added to the sample and incubated for 20 min at 37°C to digest DNA to the length of approximately 150–800 base-pairs. The chromatin was immunoprecipitated with 5 µg/mL anti-Nrf2 antibody (D1Z9C-XP—Cell Signaling Technology, Danvers, MA, USA) at 4°C under rotation for 16 h. The DNA isolated from the immunoprecipitated material was amplified by real-time PCR using SybrGreen, and the DNA sequences of the primers used were Sod1-ARE.chip-F: 5′-AAGTCCGGGTCCCAGCTCAGAG-3′ and Sod1-ARE.chip-R: 5′-TTGGTGCAAGCACACCGGGAG-3′; p62-ARE.chip-F: 5′-CCCCACAGTTCCCCATTGGC-3′ and p62-ARE.chip-R: 5′-GACAGTGGGGACGCAAAGGC-3′; and Nrf2-AREL2chip-F: 5′-AAGTCCGGGTCCCAGCTCAGAG-3′ and Nrf2-AREL2chip-R: 5′-TTGGTGCAAGCACACCGGGAG-3′. As a control, 1/50 of the digested input chromatin was similarly processed and analyzed in the absence of immunoprecipitation. To calculate the input percentage of the samples, the input was adjusted to 100% (average Ct of input − Log₂ of 50), followed by the application of the 100 × 2^{(adjusted input − average Ct(IP))} formula.

Total DNA was extracted from THP-1 cells using a Wizard^® Genomic DNA Purification kit (Promega) and measured using a BioPhotometer (Eppendorf). One PCR was carried out with primers spanning different regions of the Sod1 and Nrf2 promoters, yielding different fragment sizes, in the following conditions: 20 ng of genomic DNA and 35 cycles of 95°C for 1 min, 58°C for 1 min, and 72°C for 1 min. The DNA sequences of the primers used were Sod1.wt-F: 5′- GTCTCGAGCTGTAGGGTTGTGGCCTTGCCAAA-3′, Sod1.ΔARE-F: 5′-GTCTCGAGGCCAATTTCGCGTACTGCAACCG-3′, Sod1.basal-F: 5′-GTCTCGAGCTCGCGACCCGAGGCTG-3′ and Sod1-R: 5′-GTAGATCTCAGGAGACTACGACGCAAACCAGC-3′; and Nrf2-F: 5’ AAGTCCGGGTCCCAGCTCAGAG 3′ and Nrf2-R: 5′-TGGGGGCGGAACAAGGACCTAG-3′. A 1.8% agarose gel was run for 50 min at 100 V, and the amplicons were extracted from the gel and purified with the Zymoclean Gel DNA Recovery kit ™ (Zymo Research). The amplicons were ligated into a pJet-Blunt plasmid (Fermentas) with T4 ligase (Promega) for the first selection of positive colonies. After confirming positivity through PCR and a digestion assay, a colony was selected and grown, and a new plasmid extraction was performed. Digestion of the pJet-Blunt vector containing subcloned amplicons was performed with the Bgl-II enzyme (Promega), and the products were subjected to electrophoresis on a 2% agarose gel to extract the gel fragments. The pGL2-basic plasmid was also digested with the Bgl-II enzyme for the subsequent binding of the amplicons with T4 ligase enzyme (Promega). The cloned fragments and final vectors were then transformed into DH5α bacteria, and colonies were selected for further confirmation by sequencing. To obtain a luciferase-expressing pGL2-basic plasmid containing three copies of the sequence regulatory region ARE (3xARE), two oligos (5′-ATGCCGCTCGAGAATGACATTTCTAGAATGACATTTCTAGAATGACATTTCTAGAGATCTCGGCCG-3′ and 3′-TACGGCGAGCTCTTACTGTAAAGATCTTACTGTAAAGATCTTACTGTAAAGATCTCTAGAGCCGGC-5′) were designed and annealed to serve as templates for a PCR under the following conditions: 20 ng of DNA oligo and 35 cycles of 95°C for 1 min, 52°C for 1 min, and 72°C for 1 min with the primers 3xARE-F: 5′-ATGCCGCTCGAGAATG 3′, and 3xARE-R: 5′-CGGCCGAGATCTCTAGA 3′. The binding reactions and digestion with the Bgl-II enzyme followed the same protocol as described above.

HEK-293T cells were used for shNrf2 lentiviral production. Initially, we co-transfected the cells with two packaging plasmids (pΔ8.9 and pVSVG) containing accessory proteins for the generation of the virus and capsid, respectively, along with the plasmid pLKO.1-shMission-Nrf2 (Sigma-Aldrich). For HEK-293T transfection, 60 µL of FuGENE HD reagent (Promega) was used in a 100 mm dish containing approximately 4 × 10⁶ cells, along with 10 µg of target plasmid, 6 µg of pVSVG and 4 µg of pΔ8.9. After 24 h of transfection, the culture medium was changed and, over the next 2 days, the supernatants were collected at 10 mL/day. The 20 mL of supernatant was ultracentrifuged at 16,000 rpm for 90 min at 4°C, and the pellet was resuspended in 1 mL of DMEM without serum. Viral transduction in THP-1 cells was accomplished in 2 × 10⁶ cells incubated with 1 mL of virus preparation for 48 h.

The production of reactive oxygen species (ROS), nitric oxide (NO), and peroxynitrite (OONO) was performed by fluorimetry. For this, 10⁵ cells were seeded in black 96-well plates and maintained for 24 h in DMEM containing 10% fetal bovine serum. The day after, the cells were washed three times with PBS, and HBSS medium without serum was added and incubated for 1 h at 37°C and 5% CO₂. The cells were incubated with different fluorescent probes for 1 h. Then, the cells were washed with PBS and treated with medium or infected with L. amazonensis. Fluorescence counting was monitored after incubation at 1-h intervals for up to 6 h (GloMax™). The production of ROS was detected using the probe CM-H2DCFDA (5 mM, Molecular Probes), with excitation at 495 nm and emission at 525 nm. For NO production, the DAF-FM probe (5 mM, Molecular Probes) was used, with excitation at 495 nm and emission at 515 nm. For the production of OONO^-, the probe HPF (5 mM, molecular probes) was used, with excitation at 490 nm and emission at 515 nm.

Diffuse cutaneous leishmaniasis patients (n = 4) were recruited at our reference clinic in São Luiz, Maranhão, Brazil. DCL patients exhibited chronic progression of the disease with several remissions, multiple nodular and highly parasitized lesions throughout the skin, and a negative DTH response. LCL patients (n = 5), recruited at our reference clinic in Jiquiriçá, Bahia, Brazil, had a single or a few ulcerated lesions present for up to 2 months and a positive DTH response (30). The clinical and epidemiological data from patients with DCL and those with LCL are summarized in Table S3 in Supplementary Material. Skin biopsies were preserved as paraffin-embedded specimens.

This study was approved by the Ethics Committee of the Gonçalo Moniz Research Center (FioCruz-Bahia). Informed consent was obtained from all patients and healthy controls. CL patients were diagnosed according to characteristic lesion morphology, positive skin test, seropositivity toward Leishmania antigen and/or the presence of parasites in the lesion. LCL patients infected with Leishmania braziliensis (n = 18, 10 male, 29.6 ± 2.3 years) were recruited at diagnosis (before treatment) in two outpatient clinics (Jequié and Jiquiriçá-BA, NE Brazil) covering the same rural area.

Written informed consent was obtained from all participants or legal guardians, and all of the data analyzed were anonymized. The project was approved by the Institutional Review Board of Centro de Pesquisas Gonçalo Moniz, FIOCRUZ–BA (license number 136/2007) and complies with the guidelines of the Declaration of Helsinki.

PBMCs from LCL patients and healthy controls were processed in parallel and immediately frozen in Trizol to preserve RNA integrity. Following Trizol extraction, total RNA was further purified using an RNeasy kit according to the manufacturer’s protocol (QIAGEN, Venlo, Netherlands). Affymetrix Whole Genome microarray analysis was performed by the VIB MicroArray Facility (Leuven, Belgium) using a GeneChip^® Human Gene 1.0 ST Array with the WT PLUS reagent kit (Affymetrix, Santa Clara, CA, USA) according to the manufacturer’s specifications. Data preprocessing (RMA) was performed using the Bioconductor xps package. Microarray data were deposited in GEO (accession number: GEO Submission (GSE80008) (NCBI tracking system #17832057)).

RNA extraction from skin biopsies was performed as above. Digital quantification of selected genes (NRF2, PKR, SOD1, SOD2, KEAP1, HMOX1) was performed by nCounter (Nanostring). Two-step normalization using internal positive and negative control RNAs, as well as PTPRC (CD45) normalization to correct for differences in tissue leukocyte infiltration, was performed as previously described (31).

The ingenuity pathway analysis (IPA) program was used to perform the initial pathway/function level analysis on genes determined to be differentially expressed in the microarray analysis (IPA version 9.0, Build 116623, Content version 3211, Ingenuity Systems, Red Wood City, CA, USA). Uncorrected p-values and absolute fold-changes were used with cut-offs of p < 0.05. Based on a scientific literature database, the genes were sorted into gene networks and canonical pathways, and significantly overrepresented pathways were identified. Further enrichment analysis was performed, including Gene Ontology (GO) term enrichment using the WEB-based GEne SeT AnaLysis Toolkit (WebGestalt), KEGG pathway enrichment using the pathway database from the Kyoto Encyclopedia of Genes, and Genomes and transcription factor target enrichment using data from the Broad Institute Molecular Signatures Database (MSigDB). Genesets from the GO, KEGG pathways, WikiPathways, and Pathway Commons databases, as well as transcription factors, were considered overrepresented if their corrected p-value was smaller than 0.05.

The data were analyzed by one-way ANOVA for independent samples or Mann–Whitney (two-sided t-test) using Prism 5 software. The data represent the mean ± SD of the mean. The data are expressed as the average of three independent determinations, and significant differences were indicated by *p < 0.05.

The oxidative stress response plays a determinant role in the control of intracellular pathogens such as Leishmania (32). L. amazonensis dampens some macrophage functions, including the induction of oxidative stress (33, 34). Importantly, Nrf2 activation may promote infection tolerance, thus favoring pathogen survival. We sought to investigate whether L. amazonensis would induce Nrf2 via PKR. Figure 1A and Figure S1A in Supplementary Material shows that Nrf2 translocated to the nuclei of macrophages during the initial phase of interaction with the parasite. Importantly, Nrf2 translocation was not observed in infected pkr-ko and DN-PKR macrophages, respectively. Nrf2 levels were augmented in 6 h of infection and were induced by PKR signaling (Figure 1B; Figure S1B in Supplementary Material). The main target of PKR, eIf2α, is also not activated by phosphorylation in PKR-deficient cells (Figures S1C,D in Supplementary Material). PKR activation by inducers, such as PolyI:C or IFN-I added to macrophages also induced Nrf2 translocation and expression (Figure 1C). Next, we investigated the binding of Nrf2 to cognate Nrf2 promoter (Figure 1D). Our data show that Nrf2 only occupied the ARE sequences in infected wild-type macrophages by ChIP. To address whether ARE genes are activated in Leishmania infection, we constructed two luciferase reporter plasmids. The 3xARE construct contains the canonical ARE promoter response element, while the other construct contains the Nrf2 promoter (also spanning an ARE-like element). Figure 1E shows that the 3xARE regulatory sequence drove luciferase expression in infected wild-type macrophages, while luciferase expression was abrogated in DN-PKR cells. Importantly, the Nrf2 promoter was also induced in infected wild-type macrophages. In summary, our results show that L. amazonensis induces Nrf2 in a PKR-dependent manner.

Recent reports have demonstrated that L. amazonensis activates the classical antiviral response mediated by PKR, leading to Sod1 expression, favoring parasite growth in infected macrophages (35, 36). To address the role of Nrf2 on Sod1 expression in infected macrophages, we cloned the Sod1 promoter and deleted the regulatory regions in the Luciferase vector (pGL2) (Figure 2A). The Sod1 promoter was induced in wild-type infected macrophages, while the deletion of the ARE sequence disrupted Luc expression. Accordingly, Sod1 expression, which is controlled by Nrf2, was only increased in wild-type infected macrophages (Figure 2B). Our data show that ARE element on Sod1 promoter was occupied by Nrf2 only in infected wild-type macrophages by ChIP (Figure 2C). We aimed to test the hypothesis that Sod1 dependence of Nrf2 activity, we developed a macrophage shNrf2 knockdown cell line. In only wild-type infected macrophages, the parasites induce Sod1 expression (Figure 2D). The quantification of infection index show a decrease on proliferation of Leishmania in Nrf2 knockdown cells (Figure 2E). These data support the link between Sod1 and two major signaling pathways represent by Nrf2 and PKR.

Nrf2 activation is controlled at different levels, including indirect phosphorylation by Akt1 (11). Because L. amazonensis promotes Akt1 activation (12), we aimed to investigate its role in Nrf2 induction. Initially, we examined whether the induction of Akt1 by L. amazonensis relied on PKR expression. Figure 3A shows that GSK3 phosphorylation due to Akt1 depended on PKR. The phosphorylation of Akt depends on PKR during Leishmania infection (Figures S3A,B in Supplementary Material). Of note, Nrf2 induction required Akt signaling, as shown in infected shAkt1 macrophages (Figures 3B,C). In macrophages treated with pharmacological inhibitors of Akt1/2 and PI3K (Figures 3D,E), we also observed the same pattern of Nrf2 repression in nucleus translocation and protein expression. As predicted, ARE element, Nrf2 Luciferase and Nrf2 promoter occupancy in ChIP assay were induced by L. amazonensis infection in an Akt1-dependent manner (Figures 3F,G). Likewise, Sod1 expression followed the same PI3K/Akt1 dependence pattern. ChIP assays corroborated these findings, where the occupancy of ARE in the Sod1 promoter by Nrf2 depended on Akt1 (Figure 3H).

We aimed to test the hypothesis that Nrf2 knockdown would favor oxidative stress, leading to the reduction of the parasite load in macrophages. We measured the production of OONO, NO, and ROS as components of the oxidative stress pathway in Nrf2-knockdown infected macrophages (Figure 4A). As expected, the production of ROS and the formation of OONO and NO were enhanced in infected Nrf2-knockdown macrophages. Figure 4B shows that PKR or Akt1 inhibition leads to a similar oxidative stress profile upon infection. Silencing of Nrf2 decreased the infection index, whereas the parasite load was rescued when infected Nrf2-knockdown macrophages were treated with the antioxidant NAC compound (Figure 4C). Notably, the Nrf2 inducer sulforaphane augmented the infection index.

Nuclear factor erythroid 2-related factor 2 is sequestered in the cytosol by a homodimer of Keap1, which limits its nuclear translocation. Nrf2 associated with Keap1 is directed to proteasomal degradation by Cul3-mediated poly-ubiquitination (37). However, Keap1 is degraded through p62-mediated autophagy, releasing Nrf2 into the nucleus (38). Given that Leishmania induces autophagy in infected macrophages (39), we sought to investigate the levels of Keap1 in Leishmania infection. Figure 5A shows the prompt decrease in Keap1 levels in infected macrophages and demonstrates that PKR inactivation prevented Keap1 degradation. Moreover, Keap1 reduction was prevented by chloroquine, an autophagy inhibitor (Figure 5B). Given that Nrf2 released via Keap1 degradation promotes the antioxidant response, we addressed whether the inhibition of autophagy would increase the oxidative stress of infected macrophages. As observed in Figure 5C, the levels of ROS, OONO, and NO increased in infected cells treated with chloroquine. We also confirmed that L. amazonensis triggers LC3-I conversion to LC3-II, a marker of autophagy (Figure 5D). Given that the formation of the LC3-p62-Keap1 ternary complex on the autophagosome membrane directs Keap1 to degradation (40), we investigated the induction of p62 in the infection. We show that p62 was induced in infected macrophages, and this effect relied on PKR and Akt1 (Figure 5E and Figures S5A in Supplementary Material, respectively). Moreover, the ablation of Nrf2 expression prevented p62 induction due to infection (Figure 5F). Given that our data indicate that PKR and Akt control the induction of Nrf2, we tested the occupancy of the p62 promoter by Nrf2 in the context of infection. Our data show that Leishmania promoted Nrf2 occupancy, and the inhibition of either PKR or Akt signaling prevented this effect (Figure 5G and Figure S5B in Supplementary Material, respectively).

We aimed to address whether other L. amazonensis strains isolated from patients with localized cutaneous lesions (LCL) or DCL would induce Nrf2 nuclear translocation and the activation of PKR. Figure 6A shows that all distinct strains ofL. amazonensis activated PKR and Nrf2. Given that most of the cases of human CL in Brazil are caused by L. braziliensis, we decided to address whether this species would induce PKR and Nrf2. Figure 6B shows that L. braziliensis activated PKR and Nrf2. Nrf2 activation depended on PKR function (Figure 6C). Moreover, the expression of the Nrf2 target genes p62 and Sod1 was reduced in Nrf2-silenced L. braziliensis-infected macrophages (Figure 6E), and the growth of amastigotes was impaired in Nrf2-knockdown macrophages (Figure 6D). These results prompted us to investigate the levels of Nrf2 and the negative regulator Keap1 in clinical samples from LCL or DCL patients. Figure 6F shows the marked expression of Nrf2 in DCL samples compared to LCL tissues. Accordingly, Keap1 expression was enriched in LCL samples. Altogether, the data show that Nrf2 induction is triggered by distinct species and strains of L. amazonensis, and high levels of Nrf2 are found in patients with DCL, a severe clinical condition that presents with a high number of parasites and poor prognosis (41).

Next, we tested for transcription factor enrichment among the 413 genes composing the systemic LCL disease signature. Only five transcription factor motifs were significantly enriched among the promoters of the 413 genes of the LCL disease signature. After the E4F1 motif, the Nrf2 binding site was the second-most significantly represented, being present in 15 of the 413 genes composing the LCL disease signature (Table 1). Among those, p62 (Sqstm1), in bold, was confirmed, in agreement with our in vitro data. We herein present the first disease signature of LCL using a systems biology analysis of the PBMC transcriptome of LCL patients (n = 18) vs. healthy controls (n = 12). Using Affymetrix microarrays (HuGene 1.0), we found that Nrf2 was significantly overexpressed in patient PBMCs vs. controls (1.8-fold, uncorrected p = 0.0002, p = 0.033 using the Benjamini–Hochberg correction for genome-wide testing). The top 50 upregulated genes in patients vs. controls are shown in Table S1 in Supplementary Material. Next, we used IPA to determine which biological pathways and molecular networks were enriched among the LCL disease signature. As shown in Table S2 in Supplementary Material, three antioxidant pathways, i.e., the thioredoxin pathway, the antioxidant action of Vitamin C and the Nrf2 pathway, were significantly enriched in the LCL disease signature.

Then, we performed a transcriptome-wide correlation analysis to further investigate whether the molecular links we described at the protein level in vitro might be confirmed at the transcriptional level ex vivo. The expression of a large number of genes was significantly correlated to Nrf2 transcript levels, even following stringent Benjamini–Hochberg correction for multiple testing. Among those, PKR, PIK3C, Sod1, and p62 (SQSTM1) transcripts were positively correlated, whereas Keap1 was negatively correlated, to Nrf2 transcript levels, with minor differences between LCL patients and controls (Figure 7A), thus confirming our protein data of Nrf2 regulation, both upstream or downstream. To validate these microarray results, we performed a targeted analysis of key genes in the Nrf2/PKR crosstalk using nCounter digital transcriptomic quantification in LCL (n = 6) as well as healthy skin biopsies (n = 4). As shown in Figure 7B, unsupervised hierarchical clustering of in situ transcriptomes revealed two major clusters, which coincided with either LCL patients or normal donors (ND). Thus, LCL skin biopsies could be discriminated from healthy skin by differential expression of only six transcripts (Nrf2, PKR, Sod1, Sod2, Keap1, and Hmox1).