Anti C5 scFv antibody (6) was cloned, using BssH2 and NheI restriction sites, into pMB-SV5 vector (16) containing human IgG1 Fc region to produce the scFv-Fc molecule called Mubodina (ADIENNE Pharma & Biotech). Ergidina was generated by replacing SV5 tag with the peptide RGD-4C (17). To this end, Mubodina was amplified with the following oligos pMBsense CTGCTTACTGGCTTATCG and pMB-RGD-anti GGTTTAAGCTTTTAGCCGCAGAAACAATCTCCTCGGCAGTCGCAGGCGCCTTTACCCGGGGACAGGGAGAG. The first oligo anneals on the vector pMB at the 5′ while the second anneals at the end of human CH3 region and introduce the RGD-4C sequence and the Hind III restriction site sequence. After PCR amplification, the fragments were cut with XbaI an Hind III restriction sites and cloned into pMB-SV5 vector. Finally, both Moubodina and Ergidina were subcloned into pUCOE (18) vector. All clones obtained were confirmed by sequencing.

Purified plasmid DNA was transfected with freestyle max reagent (Invitrogen) in CHO-S cells according to a standard protocol and the cells were grown in Pro-CHO 5 (Lonza). The recombinant scFv-Fcs were purified from cell-conditioned medium loaded on Protein A column and eluted with citric acid 0.1M pH 3. Fractions containing the recombinant proteins were selected by ELISA (6) and checked for purity by SDS-PAGE (19).

The hemolytic activity of the classical pathway of the C system was evaluated incubating human serum with sensitized sheep red blood cells in the presence of different amount of purified recombinant antibodies, as previously described (6).

Male Wistar rats weighing 240–270 g were obtained from a colony kept in the animal house at the University of Trieste. Male BALB/c mice weighing 20–24 g were purchased from Charles River Italy and maintained in our university facilities. The in vivo experiments were performed in compliance with the guidelines of the European (86/609/EEC) and Italian (D.L.116/92) laws, were approved by the Italian Ministry of Health and the Administration of the University Animal House, in line with NIH Guide for the care and use of laboratory animal, in order to minimize the number of animals used and their suffering.

Ergidina was labeled with N-hydroxysuccinimmide ester of the cyanine 5.5 (Cy5.5. Amersham Biosciences: Fluorolink Cy5.5 Monofunctional Dye 5-pack) following a previously reported procedure (19).

BALB/c mice received 0.05 mg of Ergidina labeled with 1 nmol of Cy5.5 in the tail vein. A small-animal time-domain Optix MX preclinical NIR-imager (Advanced Research Technologies) equipped with a pulsed laser diode and a time-correlated single photon counting detector was used in this study for the in vivo and ex vivo evaluation of labeled Ergidina distribution, as previously detailed (20).

Wistar rats were first anesthetized with sodium thiobarbital (Inactin, Sigma, 80 mg/kg) and then received i.v. 100–150 IU/kg of heparin (Ratiopharm, Germany).

The kidneys were excised and stored in ice for 24 or 48 h after perfusion with 5 ml of Celsior through a PE20 polyethylene catheter (Intramedic Clay-Adams, Sparks, MD, USA) inserted into the renal artery to remove blood.

Afterward, two groups of 18 kidneys each were infused with 1 ml of iso-osmotic physiologic sterile solution containing either 0.5 or 1 mg of Cy5.5-labeled Ergidina and stored at 4, 10, and 25°C for either 15 or 30 min. Three kidneys for each experimental condition were used and analyzed by time-domain optical imaging before and after washing with 20 ml of Celsior in order to quantify the amount of the initially injected and the remaining bound Ergidina after washing.

The kidneys were snap frozen in liquid nitrogen and kept at −80°C. Seven micrometer sections were also examined by confocal microscopy to confirm the data obtain using optical imaging.

Seven micrometer sections were also analyzed by confocal microscopy to confirm data obtained using optical imaging. Sections were examined using a Nikon C1-SI confocal microscope (TE-2000U) equipped with a 20× and 60× oil immersion lens. Light was delivered to the sample with an 80/20 reflector. The system was operated with a pinhole size of one airy disk (30 nm). Electronic zoom was kept at minimum values for measurements to reduce potential bleaching, collecting series of optical images at 2 µm z resolution step size. The unstained tissue was visualized using the 488 nm light line of the Argon laser and a 515 dichroic mirror with a 30 nm band emission filter was used. The Cy5.5 was exited using the 640 nm light coming from a diode laser and the fluorescence collected using a 650 long pass mirror. All images were acquired in the linear intensity window and with no visible saturation points. Representative images are z-projection performed using standard deviation algorithm in ImageJ software (NIH).

Two groups of six male Wistar rats were anesthetized with sodium thiobarbital (Inactin; 80 mg/kg) (Sigma) and underwent unilateral right nephrectomy following Pavone and Boonstra surgical procedure (21). After kidney excision, the animals were allowed to rest for 24 h, and then housed in metabolic cages for 24 h to collect urine 1 and 4 days after operation. Blood samples were drawn and analyzed to check glucose, blood cells, kidney, and liver functional parameters. Blood pressure was daily monitored using a tail sphygmomanometric device (22).

Two weeks after unilateral nephrectomy, all the rats underwent a second surgical intervention consisting in the exposition of left kidneys through a small flank incision and in the occlusion of both left renal artery and vein with a non-traumatic clamp for 45 min. At the end of the ischemic period, the clamp was released and the organ reperfused.

Before inducing ischemia, a PE20 polyethylen catheter (Intramedic Clay-Adams, Sparks, MD, USA) was inserted into the right femoral artery, gently pushed toward the iliac artery and abdominal aorta, and the tip of the catheter was finally placed at the origin of the left renal artery. Two groups of eight rats received 1 ml of Celsior containing 250 µg of either Ergidina or an unrelated miniantibody infused into the renal artery in a 5 min time.

Following IR procedure, the rats were housed in metabolic cages to collect daily excreted urine 1 and 4 days after operation, and blood samples were also obtained. The animals were sacrificed 4 days after surgery, and the kidneys were removed, embedded in OCT compound (Miles, Milan, Italy), snap frozen in liquid nitrogen, and kept at −80°C until used for immunofluorescence and histologic analysis.

Urinary proteins were analyzed using Bradfor solution (Sigma) and the serum creatinine level was quantified by Integrated System Dx 880 (Beckman Coulter).

Ergidina binding to kidney or heart samples was evaluated using frozen sections (7 µm) that had been incubated with the antibody (10 µg/ml) for 60 min at room temperature followed by FITC-labeled goat anti-human IgG (Aczon, Monte SanPietro, Bologna, Italy).

Tissue deposition of C3 was assessed by incubating frozen kidney 7 µm sections with 1:200 goat IgG anti-rat C3 (Cappel, ICN Biomedicals, Milan, Italy) for 60 min at room temperature followed by FITC-labeled rabbit anti-goat IgG at a 1:200 dilution (DAKO, Glostrup, Denmark) for additional 60 min at room temperature. A similar approach was used to evaluate the presence of C9, using rabbit IgG anti-rat C9 (a kind gift from Prof. P. Morgan, Cardiff, UK) at a 1:1,000 dilution, followed by FITC-labeled swine anti-rabbit IgG (DAKO) at a 1:40 dilution.

The fluorescence intensity was evaluated in 10 different randomly selected areas (0.07 mm² each) of renal tissue. ImageJ image analysis software (National Institutes of Health) was used.

The excised kidneys were preserved in phosphate-buffered 10% formalin, embedded in paraffin wax, cut into thin sections (7 µm), and stained with hematoxylin and eosin.

Histopathological changes were analyzed for tubular necrosis, proteinaceous casts, and medullary congestion, as previously described (23). Tubular necrosis and extension of proteinaceous casts were both graded as follows: no damage (0), mild (+1, unicellular, patchy isolated damage), moderate (+2, damage less than 25%), severe (+3, damage between 25 and 50%), and very severe (+4, more than 50% damage). The degree of medullary congestion was defined as follows: no congestion (0), mild (+1, vascular congestion with identification of erythrocytes by +400 magnification), moderate (+2, vascular congestion with identification of erythrocytes by +200 magnification), severe (+3, vascular congestion with identification of erythrocytes by +100 magnification), and very severe (+4, vascular congestion with identification of erythrocytes by +40 magnification).

The tissue sections were analyzed in a blind fashion by two experienced observers.

The results were expressed as mean ± SD. Data were compared by ANOVA using post hoc analysis for paired multiple comparisons with Fisher’s corrected t-test. A non-parametric Mann–Whitney test was used to determine the significance of differences between tissue damage scores in the tested groups.

We designed and cloned a novel recombinant antibody called Ergidina containing the neutralizing scFv to C5 (6, 24, 25) fused at the C terminal end to the Fc domains of human IgG1 (Hinge-CH2-CH3) to form Mubodina and the cyclic RGD-4C peptide (ACDCRGDCFCG) shown to bind avidly to the integrins αvβ3 and αvβ5 (26). A schematic picture of the two recombinant molecules, Mubodina and Ergidina, and the cyclic peptide RGD-4C used to generate Ergidina is presented in Figure 1A.

Analysis of Mubodina and Ergidina by SDS-PAGE and western blot revealed a major band of the expected size of 115–120 kDa, corresponding to the scFv-Fc dimers. Low amounts of monomers and degradation products were detected in all preparations of both Mubodina and Ergidina (Figure S1A in Supplementary Material). Moreover, Ergidina, examined by HPLC using SEC300 size exclusion column (Yarra), was eluted as a single peak corresponding to a protein of about 120 kDa (Figure S1B in Supplementary Material). Immunoenzymatic analysis showed that both miniantibodies were able to bind human C5, but failed to interact with human C3 (Figure S1C in Supplementary Material). We also tested the ability of Ergidina to neutralize C5 and to prevent C activation using a standard hemolytic assay. As shown in Figure 1B, Ergidina was found to be as efficient as the parent molecule Mubodina in inhibiting serum C hemolytic activity at similar concentration.

The distribution of the targeted anti-C5 recombinant antibody was first examined in healthy mice. The antibody (0.05 mg) labeled with 1 nmol Cy5.5 was injected intravenously (i.v.) into the tail vein, and its localization was examined by time domain optical imaging. Ergidina was diffusely distributed throughout the mouse body soon after i.v. administration followed, 6 h later, by a preferential accumulation in the kidney peaking at 24 h (Figure 2A). As already observed with the distribution pattern of other Cy5.5-labeled antibodies (19, 27), a proportion of the molecule was removed by the liver and the free dye was excreted through the kidney, thus explaining the visualization of fluorescent signals in the liver and bladder (Figures 2A,B). These data were confirmed by ex vivo analysis of the different organs performed 6 and 48 h after injection of the labeled molecule (Figure 2C). The pharmacokinetic profile of Ergidina was supported by confocal microscopy analysis of sections of different organs removed 6 h after antibody challenging that revealed specific near infrared fluorescent staining in the kidney and liver. The green fluorescence observed in both these organs was due to autofluorescence observed also in the lung that was examined as a control organ (Figure S2 in Supplementary Material).

To investigate the extent of Ergidina deposition in isolated perfused rat kidney under various experimental conditions, the organ was removed from healthy animals and either fixed immediately or kept in ice for 24 h to mimic ischemic conditions prior to fixation in formalin. Tissue sections were then analyzed for antibody deposits. As shown in Figure 3A, Ergidina bound weakly to the endothelium and more strongly to the tubules of normal kidneys. Conversely, glomerular and vessel endothelium of ischemic kidney were heavily decorated by RGD-targeted antibody under ischemic conditions with levels of fluorescence intensity of glomeruli approximately sevenfold higher than that observed in control kidney (Figure 3B).

We then tested the capacity of Ergidina to decorate renal endothelium of kidneys kept under different ischemic conditions. To this end, 0.5 mg of Cy5.5-labeled Ergidina was injected into the renal artery of surgically removed kidneys that had been washed and stored at 4°C for 24 h in Celsius^®. The fluorescence intensity was assessed before and after organ perfusion using time-domain optical imaging. As shown in supplemental Figure S3, approximately half of the antibody was still bound to the renal vessels after incubation for 15 min at 4°C followed by perfusion to wash out unbound antibodies. This percentage remained essentially unchanged when the incubation temperature was raised to 10 and 25°C (Figure 4A). The binding of RGD-targeted antibody to the vascular endothelium of kidney kept at 4°C for 24 h occurred in a short period of time reaching a plateau at 15 min (Figure 4B). The percentage of bound antibody was slightly increased when the cold ischemia time was prolonged from 24 to 48 h. However, the difference was not statistically significant (Figure 4C).

The amount of Ergidina bound to the kidney stored at 4°C for 24 h was related to the dose of administered antibody and increased from 0.26 to 0.48 mg using doses of 0.5 and 1 mg, respectively (Figure 4D). The analysis of frozen sections of these organs treated with 0.5 mg of cy5.5-labeled Ergidina by confocal microscopy showed that the antibody was widely distributed on all glomeruli and extraglomerular vessels and was undetectable on renal tubules (Figure 5).

To assess whether the binding of Ergidina to surgically removed organs was restricted to the kidney, we analyzed isolated perfused rat heart stored at 4°C for 24 h. Frozen sections of this organ were incubated with Cy5.5-labeled Ergidina and examined by confocal microscopy. Figure S4 in Supplementary Material shows that the endothelium of ischemic heart is covered by RGD-guided anti-C5 antibody.

The finding that Ergidina preferentially accumulates in rat renal vessels in vivo suggested a potential use of the targeted antibody to prevent renal C-mediated damage. This hypothesis was tested in a rat model of kidney IRI described in Section “Materials and Methods.”

Prior to the ischemic injury, the animals received 0.25 mg of Ergidina found in the ex vivo experiments to fully cover the renal endothelium. After 45 min of ischemia, the kidney was reperfused and samples of serum and urine were collected 24 and 96 h later for analysis. The data reported in Figure 6 show clear signs of renal impairment in animals receiving the control antibody with marked increase in both protein excretion and serum creatinine level peaking 24 h after reperfusion. In contrast, Ergidina was able to completely prevent C-mediated damages, as revealed by the lack of significant changes in protein and creatinine concentrations that were comparable to those collected before IRI. The effect of Ergidina was still apparent 4 days after induction of ischemia despite the marked reduction in the protein and creatinine levels observed in the control group of rats.

We also investigated the ability of Ergidina to control C-mediated tissue damage in ischemic kidneys removed from rats treated with the C5 neutralizing and control antibodies. A strong C activation was observed in the ischemic rat model that proceeds to completion of the reaction sequence as documented by C3 and C9 deposition in the kidneys of rats receiving an irrelevant antibody. As expected, administration of Ergidina to rats undergoing renal IRI did not prevent C3 deposition but resulted in the complete inhibition of C5 activation and an undetectable localization of C9 on glomeruli and vascular endothelium (Figure 7).

Histologic analysis of ischemic kidney of rats treated with the control antibody revealed extensive necrosis of tubular cells, and some degree of glomerular hypercellularity and mesangial hyperplasia (Figure 8). Injection of Ergidina proved to be effective in preventing tissue injury both at glomerular and tubular level, reducing the damage score to more than half compared to that observed in the control group of rats.

The dose of Ergidina used in this study was sufficient to fully inhibit C5 activation at renal level preventing tissue injury and increase in serum creatinine and urine protein levels, and was not associated with any overt sign of toxicity.