The L. monocytogenes strains used in this study were the wild-type strains ATCC19115, EGD, and the LLO deletion mutant EGDΔhly. Tryptic soy broth (TSB; Qingdao Hope Biol-Technology Co., Ltd.) was used to grow L. monocytogenes and Escherichia coli strains with shaking at 200 rpm and 37°C. Curcumin was purchased from the National Institute for the Control of Pharmaceutical and Biological Products (Beijing, China). When the experiment was finished, pathogens were sterilized by autoclave at 121°C for 30 min. Other chemical hazards were treated and disposed in accordance with the guidelines of Jilin University.

The DNA sequence of LLO was PCR amplified from L. monocytogenes genomic DNA with the following primers: 5′-GCGCCATATGGATGCATCTGCATTCAATAAAG-3′ (forward) and 5′-GCGCCTCGAGTTCGATTGGATTATCTACTTTATTAC-3′ (reverse). The fragment was first cloned into a PET-21a expression vector and subsequently transformed into E. coli BL21 (DE3) cells for LLO expression.

The LLO mutagenesis was performed with a QuikChange Site-Directed Mutagenesis Kit. The primer pairs for these mutations were as follows: V100A forward, 5′ GATGGAAATGAATATATCGCGGTGGAGAAAAAGAAGAAATC 3′; V100A reverse, 5′ GATTTCTTCTTTTTCTCCACCGCGATATATTCATTTCCATC 3′; L503A forward, 5′ GATGACCGGAACTTACCAGCGGTGAAAAATAGAAATATCTCC 3′; and L503A reverse, 5′ GGAGATATTTCTATTTTTCACCGCTGGTAAGTTCCGGTCATC 3′.

Cultures of BL21 (DE3) cells harboring the vector that was cloned with the LLO, V100A, and L503A fragments were grown in TSB plus ampicillin at 37°C to an OD₆₀₀ = 0.6. IPTG was then added to the TSB cultures at a final concentration of 0.5 mM with shaking for another 12 h at 16°C. The cells were then centrifuged and resuspended in an LLO lysis buffer (1× PBS, 1 mM DTT, and 1 mM PMSF) and subsequently broken by sonication. The supernatants were centrifuged at 4°C for 45 min, and the lysate was applied to a His-affinity column (GE Amersham). LLO and samples with specific mutations were eluted with 50 mM imidazole and concentrated in a storage buffer (35 mM Na₃PO₄, 125 mM NaCl, pH 5.5). The proteins were saved at −80°C for further studies.

The MIC was defined as the lowest concentration of the drug at which no visible bacterial growth was observed, and the MIC value of curcumin against wild-type L. monocytogenes EGD was determined by the broth microdilution method as previously reported (12).

For the growth curve assay, EGD was cultured in 120 ml of TSB at 37°C to an OD₆₀₀ of 0.3 and aliquoted into six 50-ml Erlenmeyer flasks. Five of the cultures were supplemented with different concentrations of curcumin, which was pre-dissolved in DMSO at 0.25, 0.5, 1, 2, and 4 µg/ml. Then, the mixture samples were further grown at 37°C with shaking at 200 rpm, and the cell growth was monitored by reading the OD₆₀₀ values every 30 min.

The hemolytic activity was measured to assess the protective effect of curcumin against LLO or its variants during mediated cells lysis. In brief, 1 µl of the purified LLO or its mutants were pre-incubated with different concentrations of curcumin at 37°C for 15 min. Then, 25 µl of sheep erythrocytes (5 × 10⁶ cells/ml) was added to each group. The mixture was incubated at 37°C for another 30 min, and then the erythrocytes were removed by centrifugation at 5,000 g for 1 min. The supernatant was measured at OD_543 nm by ultraviolet spectrophotometer. The curcumin-free cultures were used as 100% hemolysis controls, and the hemolysis was determined by comparing each sample to the control culture.

The protective effect of curcumin on L. monocytogenes-infected cells was determined by lactate dehydrogenase (LDH) release assays, and J774 macrophages were plated at a density of 2.0 × 10⁴ cells/well and grown overnight. The cells were infected with 200 µl of L. monocytogenes at moi = 5 with the indicated concentrations of curcumin, or they were treated with 10 ng of purified LLO, which was pre-incubated with different curcumin concentrations for 20 min at 37°C. After 5 h, the supernatants of each well were collected for analysis with a Cytotoxicity Detection Kit (LDH; Roche, Basel, Switzerland).

The J774 macrophage-like cells were cultured in DMEM high glucose (1×; HyClone) and supplemented with 5% fetal bovine serum (Biological Industries). In this assay, the cells were seeded onto cover slips at 3 × 10⁵ cells/well on 13-mm cover slips with antibiotic-free medium overnight. The cells were incubated with 8 or 16 µg/ml curcumin and infected with bacteria at moi = 2.5 for 30 min. The cells were then washed five times with pre-warmed PBS and further incubated with 10 µg/ml gentamicin to kill extracellular bacteria. At arranged time points, the cover slips were placed in distilled water and vortexed violently for 5 min. The water containing the bacteria was then applied to solid TSB medium and cultured for 12 h.

The LLO structure was taken from the X-ray crystal structure in the Protein Data Bank (PDB) using PDB code 4CDB. The free protein obtained from the PDB (4CDB) was first equilibrated with a 100-ns molecular simulation of the solute, which was used for molecular docking with the inhibitor. The curcumin geometries were optimized at the B3LYP/6-31G* level with a Gaussian 03 program. The standard docking procedures for LLO with curcumin were performed with AutoDock4 (13, 14). Subsequently, a molecular dynamics simulation of the complex systems was performed using computational biology methods that have been described in detail in previous reports (15–17).

The Molecular Mechanics/Poisson–Boltzmann Surface Area (MM-PBSA) decomposition process was used to analyze the interaction between curcumin and each residue in the LLO binding site in Amber 10. The binding interaction of each curcumin–residue pair includes three terms, namely, the Van der Waals contribution (ΔE_vdw), the electrostatic contribution (ΔE_ele), and the salvation contribution (ΔE_sol).

J774 macrophages were seeded on 13-mm cover slips and incubated with bacteria at moi = 2.5 with or without curcumin for 0.5, 3, or 5 h. The extracellular bacteria were killed with 10 µg/ml of gentamicin at 0.5 h after infection. The samples were fixed with 4% paraformaldehyde at 4°C for 0.5 h at each time point. Permeabilization and blocking were performed with 0.1% Triton X-100 and 5% BSA, and the samples were further incubated with a rabbit antibody (Abcam) against L. monocytogenes for 2 h at room temperature as the primary antibody and an Alexa Fluor 594-conjugated chicken antibody (Molecular Probes) for 1 h at room temperature as the secondary antibody to indicate the bacteria, while F-actin was stained with phalloidin coupled to Alexa 488 (Molecular Probes).

For the bacterial Live/Dead assay, J774 cells were grown in 100-mm dishes (Thermo Fisher Scientific, USA) at a density of 3.0 × 10⁶ cells/dish overnight. The cells were treated with or without curcumin and infected with L. monocytogenes at moi = 2.5 for 5 h. At 0.5 h after infection, the extracellular bacteria were killed with 10 µg/ml of gentamicin. The cells were directly lyzed with PBS mixed with 0.2% Triton X-100 for 2 min at room temperature. The mixtures were centrifuged at 1,000 g for 10 min, and the supernatants were centrifuged at 10,000 × g for a further 20 min at 4°C. The viability of the bacteria in these cells was determined using the LIVE/DEAD^® BacLight™ Bacterial Viability Kit (L13152) according to the manufacturer’s instructions.

The therapeutic effect of curcumin on cell survival, which was mediated by LLO or mutations, was also assessed by using the LIVE/DEAD (green/red) reagent (Roche) according to the manufacturer’s instructions.

All the samples were observed under a confocal laser scanning microscope (Olympus, Tokyo, Japan).

J774 cells were grown in 100-mm dishes at a density of 3.0 × 10⁶ cells/dish overnight. The cells were infected with bacteria at moi = 2.5, and curcumin was added at a 16 µg/ml concentration. At 0.5 h after infection, the extracellular bacteria were killed by gentamicin. At various times after infection, the samples were collected and examined with an electron microscope according to previous studies (18).

A membrane-binding assay was conducted to determine whether curcumin had an effect on protein binding to target membranes. Sheep erythrocytes were lyzed in 20 mM MgCl₂, broken by sonication, and then, centrifuged at 3,000 × g for 10 min, and the supernatants were centrifuged at 20,000 × g for 2 h. Precipitate was added to the mixture containing pre-incubated LLO or mutants with various concentrations of curcumin for 30 min, following incubation for a further 15 min.

A total of 10 µl of each sample was loaded onto a 12% SDS-PAGE after boiling in Laemmli sample buffer. The proteins were transferred to polyvinylidene fluoride (PVDF) membranes (Wako Pure Chemical Industries Ltd., Osaka, Japan) and blocked with 5% non-fat dried milk at room temperature for 2 h. To test the LLO expression, a rabbit antibody reactive to LLO (Abcam) was diluted at 1:2,000 and applied for 2 h for use as the primary antibody, and a horseradish peroxidase-conjugated antibody (Proteintech) at 1:3,000 was applied for another 2 h as the secondary antibody. Beta-actin (Proteintech) was used as an internal control in this assay, and it was used according to the recommended dilution.

The blots were detected using Amersham ECL Western blotting detection reagents (GE Healthcare, Buckinghamshire, UK).

J774 cells were plated in 100-mm dishes at a density of 3.0 × 10⁶ cells/dish overnight. The cells were infected with bacteria at moi = 2.5, and curcumin was added at a concentration of 16 µg/ml. At 0.5 h after infection, the extracellular bacteria were killed by gentamicin. The expression of LAMP-1 protein at 3 and 5 h after infection was detected according to the instructions recommended by the manufacturer (Proteintech).

Listeriolysin O and its mutated forms were pre-incubated with curcumin at 37°C, and protein oligomerization was induced in vitro; the protocol was performed as previously described (11).

For all the following animal experiments, L. monocytogenes cultures were grown in TSB until reaching an OD₆₀₀ = 0.8 and resuspended in PBS, following the use of PBS to adjust the bacterial concentration for different studies. Additionally, curcumin-treated mice were given 200 mg/kg curcumin subcutaneously at 2 h after infection and then at 8-h intervals until reaching defined time points.

Suspensions of 4 × 10⁶ colony-forming units (CFUs) of bacteria were injected for mortality studies. The mice that were injected with PBS were used as the control group. The mortality analysis was monitored after 96 h. For other animal experiments, at the indicated times after infection, the mice were killed by cervical dislocation to avoid pain. Samples containing 1 × 10⁶ CFUs of bacteria were injected for the bacterial loading assay and pathological analysis, and the data analysis was calculated by weighing and homogenizing the livers and spleens 48 h after infection. The organs were placed in 1% formalin for pathological analysis and stained with hematoxylin and eosin and then observed with a light microscope. The mice were injected with 4 × 10⁵ CFUs of bacteria to determine the potential effect of curcumin on bacterial growth and clearance, and the mice were sacrificed 3 or 7 days postinfection, and their spleens and livers were homogenized in PBS; the bacterial load was calculated as mentioned previously.

All the statistical analyses were performed using SPSS 13.0 software, defining differences to non-curcumin-treated groups as significant (*P < 0.05 and **P < 0.01).

Previous studies in our lab demonstrated that some natural flavonoids with similar structures possess different inhibitory effects on the hemolytic activity of LLO by sharing similar mechanisms (19). Here, we found that curcumin (Figure 1A), a polyphenol, could also inhibit LLO-induced hemolysis. The result of the hemolysis assay revealed that the lysis of sheep red blood cells was significantly inhibited (P < 0.05) when curcumin was added at the indicated concentration of 0.5 µg/ml (Figure 1B). This result suggested that the significant reduction in the hemolytic activity of LLO probably occurred through a direct interaction of curcumin with this toxin and effectively antagonized its activity. Consistent with this finding, cocultured L. monocytogenes with curcumin at the indicated concentrations was enough to inhibit the hemolytic activity of LLO, and they had almost no effect on bacterial growth (Figure 1C). Taken together, curcumin at 0.5 µg/ml is sufficient to decrease the hemolytic activity of LLO, while it has almost no effect on the phagocytosis of L. monocytogenes under experimental conditions. Curcumin does not belong to the flavonoid family, and its structure was not similar to that of these compounds. Thus, we hypothesized that curcumin antagonizes LLO activity through a different mechanism.

Listeriolysin O is known as an essential virulence factor that mediates pathogen escape from the phagosome into the cytoplasm. We have shown the first evidence that curcumin could effectively inhibit the hemolytic activity mediated by LLO, and therefore, we hypothesized that curcumin is capable of blocking the escape of L. monocytogenes, resulting in a decrease in cytotoxicity caused by L. monocytogenes. The result in Figure 1D shows that the cytotoxicity caused by L. monocytogenes was significantly inhibited by curcumin, as evaluated by the release of LDH. Compared with the untreated group, 2 µg/ml curcumin significantly (P < 0.01) decreased the LDH release caused by L. monocytogenes, and cell death was reduced from 44.32 to 27.82%, suggesting that curcumin could protect cell membranes from damage caused by L. monocytogenes. Furthermore, to demonstrate that this protective effect is highly associated with curcumin, decreasing the hemolytic activity of LLO, we incubated LLO with different concentrations of curcumin, which were subsequently cocultured with J774 cells for 5 h; as expected, the cytotoxicity depended on the LLO. This result indicates that curcumin treatment reduced the L. monocytogenes-induced LDH release, which was the consequence of decreasing LLO membrane perforation. In addition, we tested the impact of curcumin on intracellular bacterial growth. As shown in Figure 1E, the L. monocytogenes lacking LLO (strain EGDΔhly) display a defect in bacterial intracellular growth, and the wild-type strains (EGD) grow rapidly in J774 cells, while at the present curcumin concentration (16 µg/ml), the growth of wild-type bacteria was decreased by 87.47 and 77.62% at 3 and 5 h, respectively.

For a stable LLO–curcumin structure, the standard molecular dynamics simulations were performed for the complex. As shown in Figure 2A, the stable structure of LLO with curcumin was given by the 200-ns MD simulation. It is shown that curcumin could be exactly embedded into the split between domains 2 and 4 in LLO via hydrophobic interactions. In detail, it is clear that the benzene ring on the left side of curcumin can form a strong interaction with Arg89 and Val100, which plays an important role in stabilizing the left side of curcumin. Moreover, Leu503, Val504, and Lys505 can also form a strong interaction with the right side of curcumin. In addition, the plane of the benzene ring on the right side of curcumin is parallel to the plane of the benzene ring in residue Tyr414. Then, a strong π–π interaction between this residue and curcumin most likely exists, leading to the stability of the right side of curcumin with LLO.

To validate the LLO–curcumin binding sites, the root-mean-square fluctuation (RMSF) of the residues around the LLO binding sites in the complex and free protein was calculated to explore the flexibility of these residues. As shown in Figure 2B, the flexibilities in the LLO binding sites in the presence and absence of curcumin are clearly different. The residues (80–100, 400–510) in the LLO binding sites that bind with curcumin show a small degree of flexibility with RMSF of <0.4 nm when compared with free protein, indicating that these residues seem to be more rigid as a result of their binding to curcumin. Through the above information, it was initially decided that the stabilization at the LLO–curcumin binding site was mostly due to residues Arg89, Val100, Lys412, Tyr414, Leu503, Val504, and Lys505, as shown in Figure 2A.

To confirm the LLO–curcumin binding sites, the contribution of the residues to the binding energy between curcumin and LLO was calculated using the MM-PBSA method. As shown in Figure 2C, Arg89, Val100, and Lys412 have strong appreciable binding energy contributions with values of <−1.0 kcal/mol, indicating the strong interaction between the LLO and the left part of the curcumin. Consistent with the results of the above analysis, Tyr414, Leu503, Val504, and Lys505 have strong interactions with curcumin, with values of ~−2.26, ~−2.00, ~−1.02, and ~−1.23 kcal/mol, respectively. In summation, it is verified that the key residues of the binding sites are Arg89, Val100, Lys412, Tyr414, Leu503, Val504, and Lys505.

To confirm the binding site in the LLO–curcumin complex, the same process of MD simulations was performed for the complex systems involving V100A-LLO and L503A-LLO mutants with curcumin, and the binding free energies of the two complexes were then calculated by using the MM-PBSA method. Subsequently, the binding free energies of curcumin with the two mutants were measured by the fluorescence spectroscopy quenching method. The total binding free energy of WT-LLO, V100A-LLO, and L503A-LLO with curcumin complexes and their detailed energy contributions are summarized in Table 1. The calculations of the binding free energy for the complexes revealed that the binding free energies of the mutants showed a decrease compared with the WT-LLO with the curcumin complex. However, according to the results from the fluorescence spectroscopy quenching method, the binding free energy between curcumin and the protein decreases in the following order: WT > V100A-LLO > L503A-LLO, which is consistent with the results of calculations based on the MD simulation. Thus, it is clear that the binding site of the LLO–curcumin complex is due to the residues Arg89, Val100, Lys412, Tyr414, Leu503, Val504, and Lys505.

In this work, the most significant motions of the protein in a complex or an unliganded state were identified to explore the inhibition mechanism of curcumin by PCA on the basis of the MD trajectory of the free LLO and the LLO–curcumin complex. As shown in Figure 3A, there is an extended motion between domain 2 and domain 4 to the entire conformation of the free protein in the first principal component (PC1) (as represented by the dotted line in Figure 3), which is large enough to meet the requirement of the conformational transition for LLO from the monomer to the oligomer. Interestingly, curcumin could bind exactly in the split between domain 2 and domain 4 of the LLO based on the MD simulation, indicating that the motion of domain 2 and domain 4 in LLO could be influenced by the binding of curcumin. As we had expected, the extended motion between domain 2 and domain 4 is obviously weaker than that of the unliganded LLO due to the binding of curcumin with the split between domain 2 and domain 4, as shown in Figure 3B. Then, the motion of the conformation transition for LLO from the monomer to the oligomer is confirmed to be restricted by the binding of curcumin with LLO.

In summary, based on these findings, the following inhibition mechanism was realized: the binding of curcumin to the split between domains 2 and 4 in LLO blocks the transition in the conformational change from the monomer to the oligomer for LLO, leading to a decrease in the lytic activity of LLO.

Since V100 and L503 were two amino acids that were predicted by molecular dynamics simulation as the key potential binding sites, a hemolysis assay was first developed to validate the abovementioned results. The hemolytic assay showed that in comparison with WT-LLO, the protective effect of curcumin on LLO mutation-induced hemolysis in sheep blood cells significantly decreased by 8-fold and 16-fold in V100A and L503A (Figure 4A). Consistent with this result, the result from Figure 4B shows that compared with WT-LLO, the protective effects of curcumin on LLO mutations were 8- and 16-fold lower in V100A and L503A, respectively. Furthermore, the same results were observed in the live/dead and cytotoxicity assays, and the sensitivity of LLO to curcumin was more severely affected by the L503A mutation than the L100A mutation. Taken together, these results indicate that V100A and L503A were two important amino acids through which curcumin interfered with LLO (Figure 4C).

To express its cytolytic activity, the LLO monomers were first secreted by L. monocytogenes, subsequently binding to the target membrane, and then, oligomerization occurred to form pores and directly led to cytolytic activity. Thus, the influence of LLO and mutations on the membrane-binding assay was evaluated by Western blot assay, and no visual differences were detected between WT-LLO/V100A/L503A and the sample that was treated with curcumin, indicating that curcumin did not have an obvious impact on the binding of LLO/mutations to the target membrane (Figure 4D). Pretreating curcumin with LLO results in the significantly lower production of high molecular-weight LLO complexes, while this decreasing effect was less sensitive in LLO mutations, suggesting that this compound could directly reduce the oligomer formed by LLO (Figure 4E). Taken as a whole and consistent with the predictions derived from the molecular modeling, these observations demonstrated that curcumin could decrease the activity of LLO by interfering with the oligomer formation of LLO.

To gain insight into the mechanism through which curcumin prevents L. monocytogenes growth in J774 cells and clearly demonstrates which step of the intracellular life cycle was impacted, the cells were incubated with curcumin when infected with EGD or EGDΔhly at the indicated time points (0.5, 3, and 5 h), washed, and fixed. The bacteria were labeled with red immunostaining, and F-actin was labeled with green immunostaining. The result at 0.5 h showed that no significant differences were observed between the EGD group or the curcumin-treated group (Figures 5A,B), suggesting that the concentration of curcumin (16 µg/ml) that inhibited intracellular bacterial growth has no significant influence on phagocytosis. Bacterial polymerization of actin is a typical feature associated with bacterial escape from the phagosome for inducing bacterial motility. We have demonstrated that curcumin could antagonize the hemolytic activity of LLO, suggesting that curcumin was able to limit the number of bacteria that would escape. As we expected, at 3 h after infection, and with EGDΔhly as the negative control, the results were consistent with earlier studies showing that the LLO-deficient strains remained trapped in the phagosome and were incapable of recruiting actin. By contrast, ~56.71% of wild-type strains (yellow; merge) were labeled with both bacterial fluorescent antibody and F-actin fluorescent antibody (Figure 6A). The percentage of bacteria escaping into the cytoplasm and acquiring an actin tail was 23.94%, and it was strikingly lower in curcumin-treated macrophages (Figure 6B). Taken together, these results demonstrated that curcumin effectively reduced bacterial multiplication by limiting the pathogen’s LLO-mediated phagosomal escape.

Furthermore, intracellular bacterial replication was measured by immune staining for 5 h after infection (Figure 7A). In the macrophages that were infected with EGD, abundant amounts of bacteria were replicated and stained positive for F-actin, and this group served as the positive control (100% bacteria), whereas LLO-deficient L. monocytogenes remained confined in the phagosome with few bacteria in the cell (~8.39%). Treating the bacteria with 16 µg/ml resulted in a decreased percentage from 100 to 29.03 (Figure 7B). To assess whether the bacteria were alive or dead in the macrophages 5 h after infection, intercellular bacteria were collected and stained with PI or SYTO 9 (Figure 7C). The number of live bacteria in the curcumin-treated group decreased from 96.7 to 37.29% (Figure 7D), indicating that treating the macrophages with curcumin helped the cells to clear intracellular L. monocytogenes. Taken together, the results shown previously demonstrate that 16 µg/ml curcumin has no significant influence on phagocytosis but does inhibit the escape of L. monocytogenes by decreasing the LLO-mediated phagosome membrane perforation.

We then investigated whether targeting the LLO with curcumin could be an effective strategy for combating L. monocytogenes infections in the mouse model. Following an intraperitoneal administration of a sublethal dose of L. monocytogenes and the subcutaneous administration of curcumin at 200 mg/kg every 8 h for 48 h, the results showed that in the control group that was infected with bacteria, numerous spotty necroses were accompanied by inflammatory foci, congestion, and cell depletion as observed in the liver (Figure 8A), and a mass involving lymphocyte destruction with necrosis and congestion in the germinal centers of the spleen was also observed in the spleen (Figure 8B). In addition, the histopathology damage caused by L. monocytogenes in the liver and spleen was discernibly alleviated in the curcumin-treated group. Curcumin-treated mice displayed mild minor inflammatory lesions in their spleens and livers (Figures 8A,B). Curcumin has been shown to reduce bacterial burdens and mild histopathology damage during infection; the decreased bacterial load in the targeted tissues represented a significant (P < 0.01) reduction (Figure 8C). Moreover, with an intravenous inoculation of a lethal L. monocytogenes dose, the mice were partially protected, with 55.6% surviving compared to 80% dead controls 4 days after infection. Furthermore, curcumin-treated mice with 30% mice survival showed significantly longer survival times than the untreated group since therapy was discontinued. Altogether, these results suggest that after curcumin treatment, the mouse animal models were conferred with significant and effective protection against L. monocytogenes infection (Figure 8D). Together, our results established that the curcumin treatment systematically protected the mice from lethal infections of L. monocytogenes.

It is well demonstrated that LLO grants wild-type L. monocytogenes the ability to escape before phagosomes fuse with the lysosome, which is an important step for macrophages to participate in the degradation of pathogens within phagosomes. Thus, in order to examine whether curcumin could aid macrophages in clearing bacteria by targeting LLO, electron microscopic observation was performed, and the expression level of LAMP-1 was evaluated. Transmission electron microscopy observations were performed at 3 h (Figure 9A) and 5 h (Figure 9B) after the infection of J774 cells by L. monocytogenes EGD. The results demonstrated that after curcumin treatment, most invading bacteria remained surrounded by an intact phagocytic membrane. In addition, unlike the EGD strain, the phagosome membrane was destroyed and bacteria spread intracellularly after 3 and 5 h, and L. monocytogenes were often found within lysosomal bodies, indicating that curcumin could help the phagolysosome to clear the EGD while reducing LLO activity and limiting the bacteria in the endosomal membrane. Since LAMP-1 is the marker that can be detected in the lysosome membrane, LLO-deficient bacteria have been shown to remain trapped in LAMP-1-positive phagosomes. Thus, by using the Western blot assay, we evaluated LAMP-1 protein expression in the curcumin treatment group and the wild-type group. The results in Figures 9C,D show that more LAMP-1 protein expression was observed in the curcumin treatment group at both 3 and 5 h after infection, which suggested that more bacteria were confined with LAMP-1-positive J774 cells after curcumin treatment. This compound could facilitate the engulfment of more bacteria within the lysosome. Moreover, infection with a sublethal dose of L. monocytogenes is sufficient to trigger the immune system to clear the bacteria (8). Thus, we simultaneously investigated L. monocytogenes clearance in mice by establishing an in vivo model of intraperitoneal injection with a lower dose of bacteria. As shown in Figures 9E,F, mice infected with L. monocytogenes displayed a large number of bacterial colonies in their livers and spleens 3 days after infection, while the bacteria were still not cleared on day 7. Compared with this group, the curcumin-treated mice reflected higher resistance to bacterial infections because no Listeria colonies were detected in the spleens and livers on day 7, suggesting that curcumin effectively facilitates bacterial clearance depending on the host immune system.