The roles of type I and III IFNs at mucosal surfaces and in epithelial cells have been extensively studied in mice (12, 15, 16, 25, 26). Whether and how these two IFN types have antiviral activity in human epithelial cells remains much less characterized, particularly in human intestinal epithelial cells (hIECs). To investigate the functions of both IFN types in the context of primary untransformed human cells, we used human colon and intestinal mini-gut organoids. This ex vivo human model for the gut fully reproduces the structural architecture of the human intestinal tract and contains all major intestinal cell lineages (27, 28). Mini-gut organoids were formed by isolating intestinal crypts containing stem cells from human gut (colon or small intestine) resections from multiple donors. Single crypts were grown in Matrigel and 24 h post-isolation, opened crypts started to re-seal with the evident formation of a lumen within these organoids at 3–5 days of culture. At 7–10 days, the organoids were significantly increased in size (Figure 1A). After differentiation, human colon organoids displayed the typical organization with a clear and developed lumen, localization of E-cadherin at the basolateral side of the cells, tight junctions located at the apical side, as well as presence of mucin-secreting goblet cells (Mucin-2) and enteroendocrine cells (Syn) (Figure 1B). To address whether type I and/or type III IFNs protect the human gut against viral infection we used mammalian reovirus (MRV). MRV is a well-known virus model that induces immune response in infected cells and is sensitive to type I and III IFNs (29). In the following, we use the terms type I and type III IFNs to describe IFN β1 and IFN λ1–3, respectively. Colon organoids were infected with MRV with a multiplicity of infection (MOI) of 0.5, harvested 16 h post-infection (hpi), and viral replication was assessed by immunostaining of the reovirus non-structural protein μNS and by quantification of viral replication using quantitative real-time (qRT)-PCR. As shown in Figure 1C, MRV efficiently infects human mini-gut organoids as evidenced by the presence of MRV-infected cells (Figure 1C, left panels) and potently replicates over the course of infection (Figure 1C, right panel). Of note, MRV infection severely disrupted the structural integrity of the human mini-gut organoids (Figure 1C, also confirmed later in Figure 3B), which were mostly fragmented pieces of cellular monolayers, compared to the intact structures observed in mock-infected organoids. To characterize the innate immune response generated by organoids, we monitored the upregulation of both type I (IFN-β) and III (IFN-λ2–3) IFNs and of two representative ISGs (Viperin and IFIT1) over the course of MRV infection. We found that viral infection of organoids induces the transcriptional upregulation of type III IFN and to a lesser extent type I IFN (Figure 2A). This was congruent with the detection of only type III IFN in the supernatant of infected organoids (Figure 2B). Additionally, viral infection of organoids was associated with the upregulation of ISGs. The transcriptional upregulation of two representative ISGs (Viperin and IFIT1) over the course of MRV infection is shown in Figure 2C.

We found that viral infection of organoids induces the upregulation of both type I and III IFNs. To address whether both IFNs can in turn induce the expression of ISGs, mini-gut organoids were stimulated with a broad range of IFN concentrations. Results revealed that both type I and III IFNs induce the upregulation of ISGs in a dose-dependent manner (Figure 3A). Interestingly, type I IFN appears to be more potent as it induces higher expression of the Viperin and IFIT1 ISGs compared to type III IFN (Figure 3A). Similar results were found with multiple ISGs (Mx-1, ISG15, ISG54, data not shown). We also observed a continuous increase in ISG mRNA levels as the concentration of type I IFN increased, whereas ISG transcript levels quickly reached a plateau in type III IFN-treated cells.

To evaluate whether type I and/or III IFN protect primary human IECs from viral infection, organoid cultures were treated with 8 ng/mL of type I IFN (IFN-β) (equivalent 2,000 RU/mL, see Materials and Methods) or 300 ng/mL of type III IFN (IFN-λ1−3) prior to exposure to MRV. Organoids were harvested 16 hpi for analysis of viral infection/replication by immunostaining and immunoblotting against the reovirus non-structural protein μNS as well as by quantification of viral replication using qRT-PCR. Compared to mock-treated cells, pre-treatment of colon organoids with either IFN significantly reduced both the number of MRV-infected cells (Figures 3B,C, immunostaining and quantification) and the viral antigen levels within these organoids (Figure 3D). Complementarily, viral replication was severely impaired when organoids were treated with either IFNs as assayed by qRT-PCR (Figure 3E). To ensure that these findings were neither donor nor colon specific, colon organoids from different donors (colon D2–D3) and organoids derived from ileum or jejunum were similarly pre-treated with type I or III IFNs and infected with MRV. Reduced viral infection characterized by the lower expression levels of the MRV μNS protein and the decreased MRV replication was observed in colon organoids generated from different donors (Figure S1A in Supplementary Material) and in ileum (Figure S1B in Supplementary Material) and jejunum (Figure S1C in Supplementary Material) derived organoids. Similar results were found using vesicular stomatis virus (VSV), an unrelated model virus whose replication is also sensitive to both type I and III IFNs (29, 30). Pre-treatment of human organoids with either IFNs resulted in a significant inhibition of VSV replication as measured by the significant decrease of bioluminescence when using VSV-expressing luciferase (VSV-luc) as a reporter of viral replication (Figure S2 in Supplementary Material). All together, these results demonstrate the antiviral protective role of both type I and III IFNs in colon, ileum, and jejunum derived hIECs.

Human mini-gut organoids are very difficult to modify genetically. Therefore, in order to better characterize the functions and the mechanisms by which type I and III IFNs confer hIECs an antiviral state, we used the human colon carcinoma-derived cell line T84. T84 cells were infected with MRV and harvested at different time points post-infection to evaluate the transcriptional upregulation of both type I and III IFNs. Viral infection of T84 cells induces the upregulation of type I and type III IFNs (Figure 4A). Similar to human mini-gut organoids (Figure 2), viral infection induces a higher transcriptional upregulation of type III IFNs compared to type I IFN (Figure 4A; Figure S3A in Supplementary Material). To address whether both IFNs were made at the protein level and secreted by infected T84 cells, we measure the amount of both IFNs in the supernatant of infected T84 cells using ELISA. As observed for viral infection of mini-gut organoids (Figure 2B), only type III IFN was found in the supernatant (Figure 4B). However, type I IFN can be detected in the supernatant if added exogenously to inhibit viral infection (data not shown).

To address whether T84 IECs respond to either type I and III IFNs, we treated T84 IECs with type I or III IFN and measured the expression levels of ISGs at different time points post-IFN treatment. Like human mini-gut organoids (Figure 3A), we found that type I IFN induces higher expression of the ISGs Viperin and IFIT1 compared to type III IFN (Figure S3B in Supplementary Material). Transcriptome analysis of T84 cells treated with either type I or III IFN revealed that type I IFN consistently induced higher transcript levels across all induced ISGs (Figure S3C in Supplementary Material).

To determine the antiviral potency of type I and III IFNs in T84 cells, we pre-treated T84 cells with increasing concentrations of each IFN prior infection with MRV. De novo production of viral proteins was monitored by blotting for the MRV non-structural protein μNS. Figure 5A shows that both type I and III IFNs inhibit viral infection in a dose-dependent manner. In addition, cells were fixed 16 hpi and the fraction of μNS-expressing cells was determined by immunofluorescence, which demonstrates that either type I or III IFN decreased both the number of MRV-infected cells and the level of viral antigen per cell (Figure 5B). To confirm that this observation was not virus-specific, T84 cells were treated with increasing concentrations of either type I or III IFNs and subsequently infected with VSV-luc as a reporter of viral replication. Measurement of viral infection by bioluminescence showed that similar to MRV, either type I or III IFNs are capable of inhibiting VSV infection in hIECs in a dose-dependent manner (Figure 5C). All together these results show that either type I or III IFNs confer T84 cells lines an antiviral state and that T84 cells phenocopy the antiviral response generated by primary hIECs in the context of mini-gut organoid.

To test whether types I and III IFNs act in combination or separately in establishing the antiviral state of IECs, we generated T84 cell lines deficient for either the IFN alpha (IFNAR) or the IFN lambda (IFNLR) receptor using CRISPR/Cas9 technology. Inactivation of the IFN receptors was confirmed by sequencing of the knockout (KO) cell lines, which revealed nucleotide deletions and changes of open reading frame in IFNAR−/− and IFNLR−/− genes (data not shown). As shown in Figures 6A,B, IFNAR−/− cells were no longer able to phosphorylate pSTAT1 and induce ISGs after type I IFN treatment, but remained fully responsive to type III IFN, indicating a selective disruption of the type I IFN signaling pathway. Conversely, IFNLR−/− cells were insensitive to type III IFN but responded to type I IFN. These results were consistent across multiple IFNAR−/− and IFNLR−/− cell clones (Figures S4A,B in Supplementary Material).

To evaluate whether deletion of IFNAR or IFNLR renders human IECs more susceptible to viral infection, cells lacking functional receptors for type I or III IFN were infected by either MRV or VSV and compared to wild-type or scrambled guide RNA-exposed cells. Immunofluorescence analysis revealed that loss of IFNAR slightly increased the number of MRV-infected cells compared to control cells (Figure 6C), but did not affect the average fluorescent intensity of MRV antigen per infected cell (Figure 6D). Interestingly, IFNLR−/− cells appeared to be more susceptible to VSV infection. The number of VSV-infected cells and the amount of viral antigens in each cells were significantly increased in IFNLR−/− cells compared to control cells (Figures 6E,F). To confirm the protective role of type I and III IFN against viral infection in human IECs, IFNAR−/− and IFNLR−/− cells were pre-treated with either type I or III IFNs and subsequently infected with MRV or VSV. Type I or III IFN could efficiently inhibit infection by both MRV and VSV in control cells (Figures 6G,H). As expected, the protective effect of type I IFN against MRV (Figure 6G, left panel) and VSV (Figure 6H) was no longer observed in IFNAR1−/− cells, but was preserved in IFNLR1−/− cells. Conversely, disruption of IFNLR1−/− specifically abolished the protective effect of type III IFN, but not of type I IFN. Similar results were obtained with several KO clones (Figure S4C in Supplementary Material). All together these data demonstrate that in human T84 cells, either type I or III IFNs are capable of independently mediating antiviral protection.

Type I and III IFN signaling and antiviral activity are dependent on the JAK/STAT pathway, and inhibition of STAT1 phosphorylation blocks the production of ISGs and inhibits IFN-mediated antiviral protection (31–33). Several MAPKs have also been reported to be activated (34) and contribute to ISG upregulation in type I or III IFN-stimulated cells (35, 36), but the role of the MAPK pathways in the antiviral functions of type III IFN remains unclear. We found that both type I or III IFN treatment induced the phosphorylation of STAT1, STAT2, and STAT3 with similar kinetics in T84 cells (data not shown). Type I or III IFN treatment did not induce STAT5A, STAT5B, or STAT6 phosphorylation (data not shown). We next addressed whether type I and III IFNs activate the MAPKs. We found that both IFNs induce the phosphorylation of the MAPKs, p38, ERK, and JNK to the same extent and with similar kinetics (Figure S5A in Supplementary Material). To determine the role of the STAT and MAPK pathways in the antiviral activity of IFNs, we used specific pharmacological inhibitors in combination with IFN treatment. The specificity of these inhibitors and their toxicity were tested in T84 cells by Western blot analysis (Figure S6 in Supplementary Material) and cell viability assay (Figure S5B in Supplementary Material). Inhibiting the JAK/STAT pathway with a pan-JAK inhibitor almost fully blocked phosphorylation of STAT1 (Figure S6 in Supplementary Material) and strongly impaired the antiviral activity of either type I or III IFNs on both VSV and MRV (Figure 7A). Interestingly, inhibition of the MAPKs with specific inhibitors, had no effect on the phosphorylation kinetics of STAT1 (Figure S6 in Supplementary Material) but strongly affected the antiviral protection conferred by type III IFN only (Figure 7A). This specific inhibition is seen across a range of concentrations (Figure 7B). Of note, a partial inhibition of the antiviral activity of type I IFN was observed at high concentration of JNK inhibitor (Figure 7B) but at this concentration cell viability was severely affected (Figure S5B in Supplementary Material). This type III IFN restricted dependence on MAPKs was independent of IFN concentration (Figure S5C in Supplementary Material), validating that the non-dependence of type I IFN for MAPKs was not the result of differences in the IFN concentration used to stimulate the cells. Altogether, these results demonstrate the fundamental role of STAT-dependent signaling in conferring both type I and type III IFNs antiviral activity, and in addition demonstrate a unique role for MAPKs toward inducing the antiviral state induced by type III IFN but not type I IFN.

Although it has been shown in multiple cell lines that IFNs can induce the activation of MAPKs (34–36), the importance of these kinases in the IFN-mediated antiviral state has never been reported to our knowledge. This suggests that dependency on MAPKs might be cell type specific. To ensure that the antiviral activity of type III IFN in primary non-transformed hIECs depends on MAPKs, we used our mini-gut organoid culture system. Colon organoids were treated with pharmacological inhibitors of the JAK/STAT or MAPKs signaling pathways. Following pre-treatment with type I or type III IFNs, organoids were infected with VSV. Eight hpi, organoids were harvested and the impact of the pharmacological inhibitors on the antiviral activities of both IFNs was measured. As expected, inhibition of the JAK/STAT signaling pathway fully restores VSV infection to a level similar to infected organoids in the absence of IFNs (Figure 8). This confirms that the JAK/STAT signaling pathways is key for both type I and type III IFN activity in primary hIECs. Interestingly and similar to T84 cells, inhibition of either p38 or JNK MAPKs partially impairs only the antiviral activity of type III IFNs in human mini-gut organoids (Figure 8). No significant effect of MAPK inhibition on type I IFN-mediated antiviral activity was observed. The effect of inhibiting ERK-dependent signaling on the antiviral activity of both IFNs was not determined (n.d.) since treatment of mini-gut organoids with ERK inhibitor induced disruption and death of the organoid culture (Figure 8 and data not shown). Altogether, these results confirm that MAPK signaling pathways participate in the establishment of the antiviral state mediated by type III IFN in primary non-transformed hIECs.

T84 human colon carcinoma cells (ATCC CCL-248) were maintained in a 50:50 mixture of Dulbecco’s modified Eagle’s medium and F12 (GibCo) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin (Gibco). Reovirus MRV strains Type 3 clone 9 derived from stocks originally obtained from Bernard N. Fields were grown and purified by standard protocols (49). VSV-luc was a kind gift from Sean Whelan (Harvard Medical School) and was produced as described in Ref. (50). An MOI of 1 was used to infect T84 cells and organoids. Titers were determined as described in Ref. (51). For T84 cell MRV infections, MRV were purified on CsCl-gradient and stocks were titred by fluorescence foci forming assay (express in FFU) in T84 cells. Titers were calculated by determining the 50% tissue culture infective dose and expressed in FFU/mL. T84 cells were infected as described in Ref. (49). The MOI was determined as the ratio of infected cells (determined by fluorescence foci forming assay)/total number of cells. An MOI of 1 was used in T84 based experiments resulting in about 50–60% of infected as determined by fluorescence assay. For mini-gut organoids MRV infection, Organoids were removed from Matrigel by adding cold-PBS for 5 min, liquefied Matrigel and organoids were separated by centrifugation (400 g 5 min), the total number of cells per organoid samples was measured using an haematocytometer. Organoids were resuspended in culture medium containing or not MRV. When using an MOI of 1 (as determined in T84 cells) to infect mini-gut organoids, very few infected cells were detected per organoid. This discrepancy between T84 and organoid infectivity might be due to the 3-dimensional nature of the organoids and to residual Matrigel that might absorb and neutralize MRV. As such MRV stocks were titred directly in organoids by serial dilution infection and subsequent immunostaining. The MOI was calculated by the ratio of the number of infected/total number of cells/organoid. An MOI of 0.5 was used to infect organoids.

Human colon tissue was received from colon resection (52–54) from the University Hospital Heidelberg under the approved study protocol S-024/2003 and human ileum and jejunum were purchased from Baylor University and transferred by signed MTA. Stem cells containing crypts were isolated following 2 mM EDTA dissociation of tissue sample for 1 h at 4°C. Crypts were spun and washed in ice-cold PBS. Fractions enriched in crypts were resuspended in Matrigel and maintained in basal culture media (53) Advanced DMEM/F12, supplemented with 1% penicillin/streptomycin, 10 mM HEPES, 50% v/v Wnt3A conditioned media, 1× B-27 (Life technology), 1× N-2 (Life technology), 2 mM GlutaMax (Gibco), 50 ng/mL EGF (Invitrogen), 1 µg/mL Spondin (Peprotech), 100 ng/mL Noggin (Peprotech), 10 nM Gastrin (Sigma), 1 mM N-acetyl-cysteine (Sigma), 10 mM nicotinamide (Sigma), and 500 nM A-83-01 (Tocris). Differentiation media is the same as above except without Wnt3A, nicotinamide and 50% reduced levels of R-Spondin and Noggin. Organoids were stained after cryo-sectioning of embedded organoids in Tissuetek.

Rabbit polyclonal antibody against reovirus μNS was used at a 1/1,000 dilution for immunostaining and Western blots (49). Commercially available primary antibodies were goat polyclonal antibody recognizing EF-2 (Santa Cruz Biotechnology # sc-13004), rabbit polyclonal anti-Mucin-2 (Santa Graz Biotechnology# sc-15334), mouse monoclonal antibodies recognizing phospho-STAT1 or STAT1 (BD Transductions #612233 or #610115, respectively), ZO-1 (Invitrogen #339100) or E-cadherin (BD Transductions #610181). Rabbit polyclonal anti-phospho p38 (#4511), anti-p38 (#8690), anti-phospho-SAPK/JNK (#4668), anti-SAPK/JNK(#9258), anti-phospho ERK1/2 (#4370), and anti-ERK1/2 (#4695) antibodies were obtained from Cell Signaling. Secondary antibodies were conjugated with AF568 (Molecular Probes) or horseradish peroxidase (HRP) (Sigma-Aldrich) and directed against the animal source. Anti-mouse (GE Healthcare # NA934V), anti-rabbit (GE Healthcare #NA931V) and anti-goat (Jackson Immunoresearch # 705-035-147) antibodies, each coupled with HRP, were used as secondary antibodies for Western blot at a 1:5,000 dilution. Human recombinant IFN-beta1a (IFNβ) was obtained from Biomol (#86421). Recombinant human IFNλ 1 (IL-29) (#300-02L), IFNλ 2 (IL28A) (#300-2K), and IFNλ 3 (IL-28B) (#300-2K) were purchased from Peprotech. The pharmacological inhibitors used were 2 µM Pyridone 6 (Calbiochem #420099-500), 10 μM SB202190 (Tocris Bioscience #1264) for p38, 100 μM SP600125 (Tocris Bioscience #1496) for JNK, and 10 μM U0126 (Cell signaling #9903) for MEK-1/2.

RNA was harvested from cells using the NucleoSpin RNA extraction kit (Machery-Nagel) and following the manufacturer’s instructions. cDNA was made using iSCRIPT reverse transcriptase (Bio-Rad) from 250 ng of total RNA as per the manufacturer’s instructions. qRT-PCR was performed using SsoAdvanced SYBR green (Bio-Rad) as per the manufacturer’s instructions. TBP and HPRT1 were used as normalizing genes. Type I IFN was analyzed using primers specific for human IFNβ, and type III IFN was analyzed using primers specific for human IFNλ 2/3. The expression levels (fold of induction) of the investigated genes were calculated as ΔΔCq, normalizing to untreated or mock samples and to normalizing genes.

At time of harvest, media was removed, cells were rinsed once with 1× PBS and lysed with 1× RIPA (150 mM sodium chloride, 1.0% Triton X-100, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate (SDS), 50 mM Tris, pH 8.0 with phosphatase, and protease inhibitors (Sigma-Aldrich)) for 5 min at room temperature (RT). Lysates were collected and equal protein amounts were separated by SDS-PAGE and blotted onto a PVDF membrane by wet-blotting (Bio-Rad). Membranes were blocked with 5% milk or 5% BSA in TBS containing 0.1% Tween 20 (TBS-T) for 1 h at RT. Primary antibodies were diluted in blocking buffer and incubated overnight at 4°C. Membranes were washed 3× in TBS-T for 5 min at RT. Secondary antibodies were diluted in blocking buffer and incubated at RT for 1 h with rocking. Membranes were washed 3× in TBS-T for 5 min at RT. HRP detection reagent (GE Healthcare) was mixed 1:1 and added to the membrane, which was then incubated at RT for 5 min. Membranes were exposed to film and developed.

T84 cells were seeded in a 24-well plate. Cells were fixed in 2% paraformaldehyde for 20 min at RT, washed with PBS and permeabilized using 0.5% Triton X-100 for 15 min. After blocking with 3% BSA in PBS for 1 h at RT, cells were incubated with primary antibodies in 3% BSA for 1 h at RT. After washing with PBS, cells were stained with secondary antibodies in 3% BSA for 45 min at RT. To stain mini-gut organoids, 10 µm cryosections were fixed in 80% ethanol for 10 min at RT, followed by 2 min incubation in ice-cold acetone. After blocking in 5% goat serum in PBS containing 1% Triton for 1 h at RT, sections were incubated with primary antibodies in blocking solution for 2 h at RT or overnight at 4°C. After washing in PBS, sections were stained with secondary antibodies in 1% BSA in PBS containing 0.5% Triton for 2 h at RT. Nuclear DNA was stained with ProLong Gold DAPI (Molecular Probes). Slides were imaged by epifluorescence using a Nikon Eclipse Ti-S (Nikon) microscope or by confocal tile scans on a Zeiss LSM 780 (Zeiss) microscope. Image processing was performed using the Fiji software. For infection experiments, the percentage of infected cells was determined by counting at least 600–1,000 cells detected in 10 fields of view for each condition.

T84 cells were seeded in a white bottom 96-well plate. Cells were pre-treated prior to infection as indicated with increasing concentrations of type I or type III IFNs. VSV-luc (MOI = 1) was added to the wells and the infection was allowed to proceed for 8 h. At the end of the infection, media was removed, cells were washed 1× with PBS and lysed with Cell Lysis Buffer (Promega) at RT for 5 min. 1:1 dilution of Steady Glo (Promega) and PBS were added to the cells and incubated at RT for 7 min. Luminescence was read using an Omega Luminometer.

Total RNA was purified as described above from T84 cells treated with 2,000 RU/mL of type I IFN (β) or 100 ng/mL of each type III IFN (λ1−3) for 6 hr. Microarray data were processed using the software package R. Differentially expressed probe sets were determined by comparing the triplicate stimulated samples with the three unstimulated samples. Significance was defined by a minimum absolute of twofold change in expression and a q-value (false discovery rate) <0.05.

IFNβ and IFNL2/3 contained in the supernatant of cells were quantified using the human IFN-beta ELISA kit and DIY IFNLR 2/3 ELISA kit both from PBL-Interferon Source, per manufacturer’s instructions.

Knockout of IFNAR1 and IFNLR1 in T84 cells were achieved by using the CRISPR/Cas9 system. Three different single-guide RNAs (sgRNAs) per gene were used targeting the coding region of IFNAR1 and IFNLR1 and inserted into the lentiviral vector lentiCRISPR v2 (Addgene #52961) also encoding the Cas9 nuclease. The following sgRNAs were used: IFNAR1 (#1) 5′ GCGGCTGCGGACAACACCCA 3′, (#2) 5′ GACCCTAGTGCTCGTCGCCG 3′, (#3) 5′CTAGGGTCGTCGCGCCCAGG3′, IFNLR1(#1) 5′ACTGGATCTGAAGTATGAGG3′, (#2) 5′CCTGGTGCTCACCCAGACGG3′ (#3) 5′ TGAGGTGGCATTCTGGAAGG 3′. Lentiviruses were produced and T84 cells were transduced two times using 1:2 diluted stocks of lentiviral particles encoding sgRNA #1, 2 or 3. All shown data were obtained by using a cell clone treated with the sgRNA #2 for IFNAR1 and IFNLR1, but analogous results were obtained with cell clones generated with the other sgRNAs. To establish IFNAR1 and IFNLR1 KO cells, clonal selection was performed via single-cell dilution in a 96-well plate. KOs were confirmed by functional tests.