A range of human cell lines of different (mainly cancer-derived) origins which were cultured adherently or in suspension were screened by flow cytometry for MICA surface expression. Most adherent cell types tested expressed moderate to high levels of MICA (Figure 1A; Figure S1A in Supplementary Material), including two primary adherent non-cancer cell types growing as monolayers (fibroblasts and normal human astrocytes). In contrast, MICA surface expression was absent or low in most of the suspension cell lines tested (Figure 1B; Figure S1B in Supplementary Material). This was not the case for other NKG2D ligands as ULBPs were often found in suspension cell lines, while MICB was not always expressed in adherent cells (Figure 1C).

When adherent tumor cell lines are cultured as monolayers, a small proportion of cells detach from the adherent monolayer (Figure S1C in Supplementary Material). To examine whether loss of surface attachment showed a correlation with a reduction in MICA expression, we analyzed MICA expression on adherent cells and their non-adherent counterparts which had detached and were floating in suspension. Up to 60% of cells found in each suspension sample were alive as assessed by propidium iodide staining, and these live cells expressed lower levels of MICA on their surface compared to their adherent counterparts in the same media across a range of cell types (Figure 2A).

Cells which are normally adherent can be forced to grow in suspension by culture over agarose-coated plates, to which they cannot adhere. Under these conditions, they may form multicellular masses called spheroids (Figure S1D in Supplementary Material) (4). To investigate whether loss of surface adhesion would modulate MICA surface expression, cells were cultured as spheroids and MICA expression was compared to the equivalent surface adherent cells. Cells cultured under adherent conditions expressed high levels of surface MICA, but when surface adherence was prevented by culture in agarose-coated plates, MICA expression was reduced substantially (Figure 2B).

As NKG2D has several human ligands, we examined whether growth in suspension affected the surface expression levels of the other NKG2D ligands on U2OS and HeLa cells (Figure S2 in Supplementary Material). Forcing HeLa cells to grow in suspension by culture on agarose resulted in lower levels of expression of ULBP2 and ULBP3 compared to the levels seen on adherent cells, although the effect was less striking than that observed for MICA. MICB and ULBP1 surface expression levels were very low, but even this expression was reduced in suspension cells (Figure S2A in Supplementary Material). As a control, cell-surface expression of the non-NKG2D ligands HLA-A, B, C was assessed on adherent and suspension cultured cells. After growth in suspension, HLA-A, B, C expression was lower than when grown in an adherent fashion but was still very high compared to NKG2D ligands. The same was the case with U2OS cells, which do not express MICB and ULBP1 (Figure S2B in Supplementary Material). In summary, several cell lines expressed lower levels of NKG2D ligands when grown in suspension compared to when cultured as an adherent monolayer.

Hypoxic environments may be found in the center of spheroids (21), but neither hypoxia nor 24 h of hypoxia followed by 24 h of reoxygenation affected MICA surface expression (Figure S3A in Supplementary Material). Similar results were observed following a full hypoxic stimulus with anoxia (0.1% oxygen) in adherent U2OS, HeLa, and 786-O cells (Figure S3B in Supplementary Material). Furthermore, although 786-O cells are deficient in HIF-1a, which is the key transcription factor in the hypoxic response, these cells still demonstrate reduced MICA expression when grown as spheroids compared to when grown as adherent cells. This pattern was unaffected by hypoxia. Therefore, we found no evidence that hypoxia triggered a reduction in MICA expression in adherent cells.

Loss of adherence can induce cell death through mechanisms involving p53, ATM, and caspase activation. In the experiments detailed above, the analysis was restricted to viable cells as identified by propidium iodide staining. To investigate whether the induction of apoptosis was responsible for the reduction in MICA expression, spheroids were assessed after culture with the p53 inhibitor pifithrin alpha or the caspase inhibitor z-vad (Figure S3C in Supplementary Material). Treatment with these inhibitors did not prevent the downregulation of MICA expression observed on spheroids. This suggests that the downregulation of MICA expression on spheroids is not due to the induction of apoptosis.

Treatment of cells with the metalloprotease inhibitor GM6001 is known to increase MICA expression at the cell surface (22). To test if the downregulation of MICA observed in spheroids was due to metalloprotease shedding of MICA, spheroids and confluent adherent cells were treated with the broad spectrum metalloprotease inhibitor GM6001 during culture. GM6001 had no effect on surface MICA expression of spheroids (Figure S3D in Supplementary Material) suggesting that the observed reduction in MICA was not due to metalloprotease action.

It has previously been reported that MICA is downregulated on normal fibroblasts upon cell contact (23). We were interested to investigate whether this would also be the case in tumor cell lines and what would be the mechanism for this regulation. Spheroids differ from adherent monolayers not only in their loss of cell–matrix interactions but also in their increased cell–cell interactions. Adherent cells were cultured at increasing cell density, and MICA expression was measured by flow cytometry (Figure 3A). Additionally, cell density regulated MICA mRNA expression was also demonstrated by semiquantitative RT-PCR (Figure 3B).

Furthermore, we wished to investigate whether this reduction of MICA surface expression was due to increased adherent cell–cell contact or was an indirect consequence of the addition of more cells, for example, by reducing the availability of nutrients. Therefore, CFSE-labeled U2OS cells were cocultured under non-confluent (10%) conditions with non-adherent, non-activated U937 monocytes or with U937 monocytes that had been activated with 20 nM PMA for 24 h to render them adherent. Coculture with activated adherent U937 monocytes reduced MICA expression on U2OS cells, while coculture with non-activated non-adherent monocytes had no effect on MICA expression (Figure 3C). Furthermore, coculture with adherent HeLa, HT29, and HEK293T cells also reduced MICA expression (Figure 3D), while culture with non-adherent DAUDI, K-562, and Jurkat cells had no effect on MICA expression (Figure 3E). Together, these results indicate that increased cell–cell contact or cell density of adherent cells is correlated with reduced MICA surface expression on a range of cancer cell lines and indicates that the reduction in MICA expression observed at high cell densities is not simply due to factors such as the reduced availability of nutrients. Therefore, we conclude that, in addition to causing loss of adherence, cell–cell contact also inhibits MICA expression.

Calcium-dependent cellular adhesion molecules are essential to cell contact mechanisms (24). To investigate the nature of the cell–cell interactions that regulate MICA expression, spheroids were treated with the calcium chelating agent EDTA. Treatment with up to 5 mM EDTA increased MICA expression on spheroids (Figure 4A). Interestingly, we observed a concentration-dependent adhesion and contact regulation of MICA expression in adherent cells (Figures 4B,C). At 5 mM EDTA, cells detached from the surface and MICA levels were reduced. At the lower concentration of 1–2 mM EDTA treatment, where calcium-dependent cell–cell contact was partially disrupted but cells remained attached to the surface, we observed an increase in the levels of MICA expression. In addition, the more confluent cells are, the less contact area each cell can have with the underlying surface (see Figure 4C untreated vs. 2mM EDTA). Overall, these findings suggest that calcium-dependent cell–matrix adherence promotes MICA expression, while calcium-dependent cell–cell contact inhibits MICA expression.

Focal adhesion kinase and Src have been shown to be essential for cell survival following loss of surface attachment (25). To test if FAK was activated after loss of adhesion or increased cell contact, U2OS cells were grown either un-confluent, over-confluent or under force suspension for 5 days and cell extracts taken. At day 5, MICA levels were clearly downregulated both at high confluency and at forced suspension (Figure 5A). However, at this time point, FAK phosphorylation levels were clearly reduced. In contrast, p21 levels were found increased in confluent and forced suspension treatments. We therefore elected to look at earlier timepoints. At 1 day after confluency and forced suspension, we observed that FAK phosphorylation levels were indeed increased (Figure 5B).

We then sought to determine whether modulating FAK activation would regulate MICA surface expression. Treatment of spheroids with the FAK/Src inhibitors tyrphostin AG82 or PP2 increased MICA expression (Figure 6A). MICA expression was also increased by treatment of spheroids with manumycin, an inhibitor of Ras, which is downstream of FAK (Figure 6A). We then investigated whether FAK expression could influence the surface expression of MICA. Overexpression of FRNK, a dominant negative FAK mutant, had only a small effect on MICA expression in non-confluent adherent cells, but overexpression of FAK reduced surface levels of MICA (Figure 6B). Transfected cells were also resuspended over agarose for 2 days, and then MICA expression was analyzed. Here, we could see that the FRNK transfected cells had higher MICA expression compared to mock-treated suspension cells. These results indicated that inhibition of FAK/Src signaling leads to increased levels of MICA in spheroids, suggesting that FAK/Src can play a role in regulating MICA expression. Adherent cells transfected with the kinase deficient mutant FAKY397F also showed a slight upregulation in MICA expression (Figure 6C). Additionally, knockdown of FAK with shRNA led to upregulation of MICA expression compared to control scramble shRNA (Figure 6D). FAK and shRNA expression was monitored through EGFP expression on an IRES of the plasmids. To further investigate whether FAK activation could reduce MICA expression on adherent cells, cells were cultured with the FAK activators acrylamide (26), colchicine, and lysophosphatidic acid (LPA) (27). MICA expression was reduced following treatments with these FAK activators (Figure 6E). Treatment of adherent cells with the FAK/Src inhibitor tyrphostin AG82 and PF 573228 upregulated MICA surface expression (Figure 6F). Together, these data show that FAK/Src can downregulate MICA expression in adherent cells.

Next, we tested whether the different levels of MICA expression observed on spheroids, confluent adherent cells, and non-confluent adherent cells were functionally relevant and whether they influenced susceptibility to NK cell-mediated killing. Spheroids, confluent, and non-confluent adherent cells were incubated with NK cells in a chromium-release killing assay. The non-confluent adherent cells with the highest MICA expression were more susceptible to NK cell killing than confluent adherent cells. Suspension spheroids were killed less readily than the confluent adherent cells (Figure 7A). Treatment with anti-NKG2D antibody significantly reduced the susceptibility of non-confluent cells to NK cell-mediated killing (Figure 7B). In line with the observed reduction in MICA expression, treatment with the NKG2D blocking antibody had no significant impact on spheroid susceptibility. MICA expression therefore correlates with susceptibility to NK cell killing.

To confirm whether NK cell susceptibility was modulated by FAK/Src activity, adherent cells were treated with the FAK/Src inhibitor AG82 to increase MICA expression and these cells were then exposed to NK cells. AG82-treated U2OS and HeLa cells were more susceptible to NK cell-mediated killing than mock-treated cells (Figures 7C,D). Therefore, FAK/Src signaling inhibition results in increased susceptibility to NK cell killing.

All previous experiments were done in vitro with well-established cell lines, but we were interested to see if what we saw in vitro could be translated in vivo. For this, we selected a cell line, SW620 adenocarcinoma, derived from a metastatic lymph node tumor (28). We first confirmed that this cell line could also downregulate MICA expression after loss of adhesion (Figure 8A). We then stained an SW620 in nude mice xenograft for MICA expression. Here, we could see that the surface of the tumor had a stronger MICA expression than at the core (Figure 8B), recapitulating the in vitro results. Therefore, our observation may be especially important, as treatments that upregulate MICA expression in spheroids may upregulate MICA expression in vivo where tumor MICA expression is often negligible.

The cell lines 786-O, A549, BS125, primary human fibroblasts, HEK293T, HeLa, Hep3b, HEPG2, HT-1080, HT29, HUH7, MCF7, MO59K, RCC4, SF767, SKOV3, SUSA, SW480, SW620, T47D, U2OS, U343MG, U373MG, U87MG, and ZR751 were cultured in D10: DMEM (Sigma, St. Louis, MO, USA) supplemented with 10% fetal calf serum (FCS), 50 U/ml penicillin, 50 µg/ml streptomycin, and 4mM l-glutamine. Normal human astrocytes were grown in Astrocyte Medium (ScienceCell) containing astrocyte growth supplement and FCS. BCL-B7, C1R, DAUDI, HL-60, HUT-78, Jurkat, K-562, NK92, NKL, RAJI, THP-1, U937, and YT were cultured in RPMI-1640 with 10% FCS, 50 U/ml of penicillin, and 50 µg/ml of streptomycin (Sigma). NK92 and NKL cell lines were supplemented with IL-2 (500 U/ml) and 1 mM sodium pyruvate. Heparinized blood obtained from healthy donors was collected and centrifuged at 400 × g for 20 min over Ficoll-Paque (Sigma, St. Louis, MO, USA). PBMC were collected at the interface, washed twice with DMEM, and analyzed immediately, without culture. To promote growth as spheroids, 24-well plates were coated with 1% agarose in PBS. The wells were then washed twice in full media prior to the addition of these cells.

The following inhibitors or activators were used for signaling studies: 1–5 mM EDTA, 10 µM PP2, 1 µM colchicine (Sigma), 6 mM acrylamide (National Diagnostics, Atlanta, GA, USA), 1 µM AG82 FAK/Src inhibitor, 3 µM manumycin (Calbiochem, San Diego, CA, USA), 500nM PF 573228 (R&D Systems, MN, USA), and 5 µM LPA (Enzo Life Sciences).

Cells were transfected with FAK, FAKY397F, FRNK (gifts from C. Chen, University of Pennsylvania), shFAK (GATCCCCGAAGTTGGGTTGT CTAGAATTCAAGAGATTCTA GACAACCCAACTTCTTTTTA), and shScramble in pSIREN (Clontech) using the lipofectamine transfection system per the manufacturer’s manual (Invitrogen, Carlsbad, CA, USA).

A total of 1 × 10⁶ cells were pelleted, and 10 µM CFSE staining solution was added directly to the cells, which were gently resuspended and incubated at 37°C for 20 min. Complete medium was then added to stop the reaction. Finally, cells were washed twice with PBS.

For the analysis of NKG2D ligand expression, cells were washed twice and incubated with 5mM EDTA in PBS for 5 min to detach the cells. Spheroids were also treated with 5mM EDTA and manually disrupted to achieve a single cell suspension. Cells were then resuspended in PBS supplemented with 0.03% azide with 5% BSA for blocking. Staining was performed in the same buffer using monoclonal antibodies against MICA (2C10, Santa Cruz, Santa Cruz, CA, USA), MICB (mAb 1599, R&D System, Minneapolis), ULBP1 (mAB 170818, R&D System, Minneapolis), ULBP2 (MAB1298, R&D System, Minneapolis), ULBP3 (Clone 166510, R&D System, Minneapolis), HLA-A, B, C (W6/32, Thermo Fisher, UK), or IgG1, isotype control monoclonal antibodies (eBiosciences, San Diego, CA, USA). Cells were then washed twice and labeled with FITC-labeled polyclonal rabbit anti-mouse IgG (STAR9B, Serotec, Raleigh, NC, USA) or goat anti-mouse IgG Cy5 conjugated (AP124S, Chemicon). Propidium iodide (Sigma) was added at a concentration of 50 µg/ml to identify viable cells. Flow cytometry was performed using a BD^®FACSCanto machine and FACSDiva Software (BD Biosciences, San Jose, CA, USA) and analyzed using FlowJo software (Tree Star).

A total of 1 × 10⁶ target cells were dissociated from plates, washed twice in RPMI, resuspended in 100 µl of a 7.4 MBq Na251CrO4 solution (GE Healthcare Life Sciences, Piscataway, NJ, USA), diluted in growth media, and then incubated for 1 h in a humidified 5% CO₂ atmosphere at 37°C. After washing three times with RPMI, the labeled cells were resuspended in their growth media and seeded in 96-well plates at 5 × 10⁴ cells per well in quadruplicate. Effector cells were added at the specified effector to target cell ratios (E:T) and were incubated for 4 h at 37°C, 5% CO₂. The supernatant was removed, added to Optiphase Supermix (PerkinElmer), and radioactivity measured with a beta counter (MicroBeta TriLux, PerkinElmer, Waltham, MA, USA). The degree of cytotoxicity was determined according to the formula: % cytotoxicity = [(sample release) − (spontaneous release)]/[(maximum release) − (spontaneous release)]. Spontaneous release was determined by incubating target cells in medium alone. Maximum release of target cells was measured following treatment with 10% detergent Triton X-100 (Sigma). Error bars represent the SD error of the acquired values. To test for significance, a Student’s t-test was performed with the degree of cytotoxicity values of each ratio against the other conditions. *p < 0.05, **p < 0.01.

Total RNA was extracted using TRIzol Plus kit (Invitrogen). One microgram of RNA was reverse transcribed into cDNA using OligodT (Invitrogen), and BioScript reverse transcriptase (Bioline). Twenty nanograms of cDNA were subject to semiquantitative PCR reaction using BioTaq polymerase (Bioline) for 28 cycles for MICA and 22 cycles for GAPDH. The PCR primers are MICA forward TCTTCCTGCTTCTGGCTGGCAT; MICA reverse GGGTCATCCTGAGGTCCTTTCCG; GAPDH forward TCCATGACAACTTTGGTATCGTGG; and GAPDH reverse CACCACCCTGTTGCTGTAGCC. PCR reactions were separated by 1% agarose gel and quantified by densitometry using ImageJ software (NIH).

Cells were plated in a 12-well plate and treated for 48 h with increasing concentrations of EDTA. Cells were then imaged with a Nikon Eclipse TE2000U fluorescence inverted microscope using a 20× objective and Hamamatsu B&W C4742-95 Orca hi-sensitivity CCD camera using IPLab imaging software.

Cells were homogenized in lysis buffer (50 mM Tris–HCl pH 7.5, 120 mM NaCl, 1% NP-40, 40 mM β-glycerophosphate, 1 mM benzamidine, 1 mM phenylmethylsulfonyl fluoride, 1 mM sodium orthovanadate, 25 mM NaF, and 2 µM microcystin-LR). After centrifugation at 15,000 × g for 15 min at 4°C, supernatants were collected and soluble protein concentrations were determined using the Bradford assay (Bio-Rad, Hercules, CA, USA). Fifty micrograms of protein extracts were separated on 8–12% SDS-PAGE and transferred onto PVDF membrane (Millipore, Bedford, MA, USA) by electroblotting. Membranes were blocked with 5% BSA in TBST (50 mM Tris–HCl pH 7.5, 150 mM NaCl, 0.1% Tween 20) and incubated overnight with (1:100 v:v dilution) primary antibody against MICA (2C10), total FAK (C-20), Tyr397 p-FAK, and Tyr 861FAK and beta-actin (Santa Cruz, CA, USA). Subsequently, membranes were incubated with appropriate HRP-linked secondary antibody (1:2,000 v:v dilution) in PBST (anti-mouse HRP, GE Healthcare, and anti-goat HRP, Santa Cruz) for 1 h at room temperature. Blots were analyzed by enhanced chemiluminescence reagents. Quantification of western blots was done through densitometry using ImageJ (NIH) software.

IHC was performed using a rabbit polyclonal antibody against MICA (ab62540, Abcam, UK) at 1:30 dilution. For detection, deparaffinized and rehydrated slides were pretreated in 10 mM citrate buffer, pH 6.0, at 98°C for 60 min for renaturation. The detection ABC method was used per the manufacturer’s instructions. MICA specific signals were recorded from slides of xenografts of SW620 cell lines injected in the flank of Hsd nude mice using an automated instrument reagent system (Discovery XT, Ventana Medical System, Inc.) per the user manual. Images of sections were captured (Nikon, YTHM) and analyzed using Image Access Enterprise 7 and ImageJ software. SW620 xenograft slide was a kind gift from Dr. Lei Zhang in Dr. Brian A. Hemmings lab with help from Sandrine Bichet from the Friedrich Miescher Institute for Biomedical Research, Basel, Switzerland. Tissue samples were processed as described previously (37) with the recommendations of the Ethical Committee of the University Hospital of Basel. The protocol was approved by the Ethical Committee of the University Hospital of Basel.

As shown on each figure, n indicates the number of experiments using cells from independent experiments. Where three or more experiments were conducted a two-tailed Student’s t-test with two samples unequal variance type was conducted. Means were considered significantly different when *p < 0.05, **p < 0.01. Error bars represent the SD of the mean.