Human MUC1.Tg mice (13) on the C57Bl/6 background were a generous gift from Dr. Sandra Gendler (Mayo Clinic) and were bred and maintained in the University of Pittsburgh Animal Facility. C57Bl/6 (WT) mice were purchased from The Jackson Laboratory. All experiments were approved by the Institutional Animal Care and Use Committee of the University of Pittsburgh.

A 100-aa peptide containing five repeats of the MUC1 VNTR sequence HGVTSAPDTRPAPGSTAPPA, was synthesized as previously described (14) by the University of Pittsburgh Genomics and Proteomics Core Laboratories. For soluble peptide vaccinations, 100 μg of this 100mer peptide admixed with 50 μg polyinosinic–polycytidylic acid and poly-l-lysine (Poly-ICLC; Hiltonol) was brought up to 100 μL with PBS and injected via tail vein. For DC-based vaccinations, DC were prepared as previously described (15). Briefly, RBC lysed bone marrow cells were put into culture for 6 days in AIM-V supplemented with 10 ng/mL GM-CSF (Miltenyi), feeding once on day 3. On day 6, semi-adherent cells were collected by gentle agitation and put into culture overnight in AIM-V containing 33 μg/mL MUC1 100mer peptide and 25 μg/mL Poly-ICLC. The next day, mature DC were collected and resuspended in PBS at a final concentration of 0.5⁻¹ × 10⁶ cells/mL. One hundred microliters of this solution was then injected intravenously via tail vein.

Where indicated, mice were given 250 μg of an antibody against the IL-10R (Bio X Cell, Clone 1B1.3A) or an isotype-matched control antibody (Bio X Cell, Clone HPRN), intraperitoneally. Twenty-four to forty-eight hours following treatment, mice were vaccinated as described in “MUC1 vaccination” above and analyzed as described.

RNA was extracted from whole spleen using TRIzol (Invitrogen) according to the manufacturer’s protocol. Following extraction, cDNA was generated using oligo(dT) primers and SuperScript III reverse transcriptase (Invitrogen). qPCR was performed using QuantiTect SYBR Green PCR kit (Qiagen) according to the manufacturer’s protocol. Reactions were run on a StepOnePlus instrument (Applied Biosystems). The following primer pairs were used: trypsin 1 (forward: 5′ACTGTGGCTCTGCCCAGCTC3′; reverse: 5′AGCAGGTCTGGTTCAATGACTGT3′), CPB1 (forward: 5′GCCCTGGTGAAAGGTGCAGCAAAGG3′; reverse: 5′AG CCCAGTCGTCAGATCCCCCAGCA3′), IL-10 (forward: 5′CTTC CCAGTCGGCCAGAGCCA3′; reverse: 5′ CTCAGCCGCATCCTG AGGGTCT3′), and HPRT (forward: 5′TGAGCCATTGCTGAGGC GGCGA3′; reverse: 5′CGGCTCGCGGCAAAAAGCGGTC3′).

For ex vivo T cells assays, 7–9 days post MUC1 vaccination, mice were sacrificed and spleens were removed. Single-cell suspensions were made by mashing the spleens through a 40-μm filter. Total T cells were then bead isolated (Pan T Cell Isolation Kit II, Miltenyi) and cultured with day 6 MUC1-loaded BMDC (prepared as described in “MUC1 vaccination”) for 4–6 h in the presence of GolgiStop (BD biosciences). Cells were then stained with the indicated antibodies using the BD Cytofix/Cytoperm™ kit (BD Bioscience) according to the manufacturer’s protocol. All samples were run on a Fortessa (BD bioscience) flow cytometer and analyzed using FACSDiva (BD Bioscineces) and FlowJo software (Tree Star Inc.). Antibodies used: CD3-PerCP, CD11c-BV421, CD80-FITC, CD86-APC/Cy7, CD40-APC, CD3-PeCy5, CD4-V450, CD8-AF700, IFNγ-PeCy7, TNFα-PE, IL-2-APC, CD44-FITC, CD3-APC/Cy7, and CD8 PerCP.

Twenty-four hours following MUC1 vaccination, splenocytes were harvested as above. Post isolation, cells were put into AIM-V with or without 30 ng/mL IL-10 (PeproTech) for 20 min. At the end of culture, cells were immediately fixed in 1.6% PFA for 10 min at room temperature. After 10 min, four volumes of ice-cold methanol were added and samples were stored at −80°C. At the time of staining cells were put at room temp for 10 min and then immediately spun down and resuspended in flow buffer (PBS containing 1% BSA, 0.02% sodium azide, and 2 nM EDTA). After 10 min incubation at room temperature, cells were spun down and washed with flow buffer twice. Samples were then stained with antibodies against cell surface antigens CD11c, NK1.1, and CD3 and phospho-specific anti-pSAT3 antibody for 1 h at room temperature and prepared for analysis via standard protocol and as described above. Antibodies used: CD11c-Pacific Blue, pSTAT3-AF647, NK1.1-PE, and CD3-APC/Cy7.

MUC1 transgenic mice were pretreated with antibodies and vaccinated as in “IL-10R Blockade.” Post-vaccination, DC were bead isolated (CD11c MicroBeads, Miltenyi) from the spleens of the vaccinated animals. These DC were put into culture with bead isolated (CD4 T cell Isolation Kit II, Miltenyi) CFSE stained MUC1 specific VFT CD4 T cells (15) at a ratio of 1 DC to 5 VFT cells in complete DMEM. Twenty-four hours after the start of culture half of the media was removed and saved for cytokine analysis. IL-2 was analyzed by ELISA (BD OptEIA Mouse IL-2 ELISA set, BD) according to the manufacturer’s protocol. The media was replaced with fresh cDMEM and the cultures were allowed to incubate for three more days. T cell proliferation was then analyzed by CFSE dilution.

Millipore MultiScreen^® Filter Plates (Millipore) were pretreated according to the manufacturer’s instructions using the Mouse IFNg ELISPOT kit (Mabtech). Bead isolated CD4 and CD8 T cells (CD4 T cell Isolation Kit II and CD8α Isolation Kit II, Miltenyi) were cultured as above (see Intracellular Cytokine Staining/Flow Cytometry) with MUC1 pulsed BMDC and analyzed according to the established protocol. DC alone, media alone, and T cells alone were used to establish background cytokine production.

Where appropriate, statistical significance was determined by performing an unpaired Student’s t-test. *Denotes a p-value <0.05 and **denotes a p-value of <0.01. When indicated, to allow for pooling of data from multiple experiments, values have been transformed to account for minor variations in instrument settings and other potential sources of variation (i.e., minor batch to batch variance in DC vaccine prep, etc.). Briefly, all experimental values were divided by the mean value of the control group from the experiment in which they were run. “Relative” values therefore represent a standardized deviance from control.

In order to determine how quickly post-vaccination with a self- versus a foreign-antigen DC phenotype and function begin to diverge and to obtain a more accurate picture of what factors might be responsible for supporting this divergence, we vaccinated intravenously WT and MUC1.Tg mice with the MUC1 100mer peptide (MUC1p) admixed with the Poly-ICLC adjuvant. MUC1.Tg mice express the human tumor antigen MUC1 under the control of its endogenous promoter and therefore MUC1p is seen as a self-antigen in these mice, whereas it is seen as a foreign-antigen in WT animals. Mice were sacrificed 4, 6, 8, and 16 h post-vaccination and the spleens removed for mRNA isolation and analysis. As early as 4 h post-vaccination, two newly discovered biomarkers of DC activation, trypsin 1 and CPB1 (12), were up-regulated in the spleens of WT mice but suppressed in MUC1.Tg mice (Figures 1A,B). In addition to differences in the levels of these enzymes, which our previous study showed to be expressed only in DC and representative of a larger cohort of “pancreatic” enzymes that robustly activated DC expression, we also detected at this early-time point higher levels of IL-10 mRNA in the spleens of vaccinated MUC1.Tg mice compared to WT mice. At 24 h post-vaccination and later, IL-10 production was at equal levels in self- and foreign-antigen vaccinated mice (Figure 1C and data not shown).

The above data showing differences in IL-10 levels early post-vaccination but no difference at 24 h and later would indicate a modest and transient effect by IL-10 on DC. This was, however, inconsistent with our previous observations that functional differences between DC post self-antigen versus foreign-antigen vaccine were evident as late as 72 h post-vaccination (12). We considered the possibility that the early action of IL-10 on DC, along with other factors, might increase their sensitivity to IL-10 at the later-time points. To query this, DC were removed from the spleens of WT and MUC1.Tg mice 24 h post MUC1p vaccination and exposed to IL-10. As signaling through the IL-10R is known to occur through a STAT3 intermediate, the sensitivity of DC to IL-10 was assessed by phosphoflow, measuring phospho-STAT3 levels post ex vivo exposure to IL-10. As hypothesized, there was a significant increase in the number of DC showing STAT3 phosphorylation as well as higher levels of pSTAT3 in the spleens of MUC1p-vaccinated MUC1.Tg mice (Figures 2A–C) indicating that DC in the spleens of MUC1.Tg mice are not only exposed to more IL-10 early on, but are also more sensitive to it at the later-time points.

Given the inverse correlation between IL-10 production and DC pancreatic enzyme expression in the first 24 h following vaccination and previously published data showing that IL-10 is necessary for suppression of trypsin 1 and CPB1 following vaccination with a self-antigen (12), we hypothesized that blocking IL-10 signaling in self-antigen vaccinated mice would improve DC activation and costimulatory molecule expression. We injected MUC1.Tg mice with an antibody against IL-10R and vaccinated intravenously 24–48 h later with MUC1p plus Poly-ICLC. At 24 h post-vaccination, the surface phenotype of splenic DC was analyzed by flow cytometry. As hypothesized, there was an increase in the level of cell surface expression of CD40, CD80, and CD86 in DC from mice pretreated with the antibody to IL-10R, but not from mice treated with the isotype control antibody (Figures 3A–C). Increases in CD40 and CD86 were statistically significant, which is of interest because these two molecules were shown previously to be specifically inhibited in mice vaccinated with a self- but not a foreign-antigen (12). In addition to being less active as measured by surface marker expression, these DC are also less capable of stimulating MUC1 specific CD4 T cells in vitro. DC isolated from MUC1.Tg mice pretreated with an antibody against the IL-10R prior to MUC1 vaccination and put into culture with MUC1 specific CD4 T cells induce higher levels of IL-2 (Figure 4A) and CD4 T cell proliferation (Figures 4B,C) compared to DC from MUC1.Tg mice pretreated with an isotype-matched control antibody.

The increase of costimulatory molecule expression when IL-10 signaling was blocked just prior to vaccination suggested that there would be a resultant increase in the T cell response. To test this, we again pretreated mice with an anti-IL-10R antibody or an isotype-matched control and injected with a vaccine composed of DC loaded with MUC1p. We chose the DC-based vaccine expecting that it would optimally stimulate both CD4 and CD8 T cells, as has been previously shown (16). Seven to nine days post-vaccination, splenic T cells were isolated and their production of relevant cytokines analyzed by ELISPOT and intracellular flow cytometry. In MUC1.Tg mice treated with anti-IL-10R, there was a significant increase in MUC1p specific, IFNγ+ CD4 T cells when compared to mice treated with an isotype-matched control antibody (Figures 5A,C). The level of the response was equivalent to the response of WT mice pretreated with the isotype control antibody (Figure 5A). There was no increase over the isotype control of the T cell response in WT mice pretreated with the anti-IL-10R antibody (Figures 5A,C), indicating that the effect of IL-10 we saw in MUC1.Tg mice was specific for controlling responses to self- but not foreign-antigens. There was a small but not significant increase in the CD8 response that was detectable only by the more sensitive ELISPOT (Figures 5B,D).