<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article article-type="research-article" dtd-version="2.3" xml:lang="EN" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Genome Ed.</journal-id>
<journal-title>Frontiers in Genome Editing</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Genome Ed.</abbrev-journal-title>
<issn pub-type="epub">2673-3439</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="publisher-id">1074641</article-id>
<article-id pub-id-type="doi">10.3389/fgeed.2023.1074641</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Genome Editing</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Editing efficiencies with Cas9 orthologs, Cas12a endonucleases, and temperature in rice</article-title>
<alt-title alt-title-type="left-running-head">Illa-Berenguer et al.</alt-title>
<alt-title alt-title-type="right-running-head">
<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3389/fgeed.2023.1074641">10.3389/fgeed.2023.1074641</ext-link>
</alt-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Illa-Berenguer</surname>
<given-names>Eudald</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
<uri xlink:href="https://loop.frontiersin.org/people/142063/overview"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>LaFayette</surname>
<given-names>Peter R.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Parrott</surname>
<given-names>Wayne A.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/342071/overview"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Center for Applied Genetic Technologies</institution>, <institution>University of Georgia</institution>, <addr-line>Athens</addr-line>, <addr-line>GA</addr-line>, <country>United States</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Department of Crop and Soil Sciences</institution>, <institution>University of Georgia</institution>, <addr-line>Athens</addr-line>, <addr-line>GA</addr-line>, <country>United States</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Institute of Plant Breeding, Genetics and Genomics</institution>, <institution>University of Georgia</institution>, <addr-line>Athens</addr-line>, <addr-line>GA</addr-line>, <country>United States</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>
<bold>Edited by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1752286/overview">Nayla Munawar</ext-link>, United Arab Emirates University, United Arab Emirates</p>
</fn>
<fn fn-type="edited-by">
<p>
<bold>Reviewed by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/374738/overview">Jitesh Kumar</ext-link>, University of Minnesota Twin Cities, United States</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/937615/overview">Daan Swarts</ext-link>, Wageningen University and Research, Netherlands</p>
</fn>
<corresp id="c001">&#x2a;Correspondence: Eudald Illa-Berenguer, <email>eillaberenguer@uga.edu</email>
</corresp>
<fn fn-type="other">
<p>This article was submitted to Genome Editing in Plants, a section of the journal Frontiers in Genome Editing</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>17</day>
<month>03</month>
<year>2023</year>
</pub-date>
<pub-date pub-type="collection">
<year>2023</year>
</pub-date>
<volume>5</volume>
<elocation-id>1074641</elocation-id>
<history>
<date date-type="received">
<day>19</day>
<month>10</month>
<year>2022</year>
</date>
<date date-type="accepted">
<day>07</day>
<month>03</month>
<year>2023</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2023 Illa-Berenguer, LaFayette and Parrott.</copyright-statement>
<copyright-year>2023</copyright-year>
<copyright-holder>Illa-Berenguer, LaFayette and Parrott</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>The advent of CRISPR-Cas technology has made it the genome editing tool of choice in all kingdoms of life, including plants, which can have large, highly duplicated genomes. As a result, finding adequate target sequences that meet the specificities of a given Cas nuclease on any gene of interest remains challenging in many cases. To assess target site flexibility, we tested five different Cas9/Cas12a endonucleases (SpCas9, SaCas9, St1Cas9, Mb3Cas12a, and AsCas12a) in embryogenic rice calli from Taipei 309 at 37&#xb0;C (optimal temperature for most Cas9/Cas12a proteins) and 27&#xb0;C (optimal temperature for tissue culture) and measured their editing rates under regular tissue culture conditions using Illumina sequencing. StCas9 and AsCas12 were not functional as tested, regardless of the temperature used. SpCas9 was the most efficient endonuclease at either temperature, regardless of whether monoallelic or biallelic edits were considered. Mb3Cas12a at 37&#xb0;C was the next most efficient endonuclease. Monoallelic edits prevailed for both SaCas9 and Mb3Cas12a at 27&#xb0;C, but biallelic edits prevailed at 37&#xb0;C. Overall, the use of other Cas9 orthologs, the use of Cas12a endonucleases, and the optimal temperature can expand the range of targetable sequences.</p>
</abstract>
<kwd-group>
<kwd>genome editing</kwd>
<kwd>cas proteins</kwd>
<kwd>editing efficiency</kwd>
<kwd>specificity</kwd>
<kwd>temperature</kwd>
<kwd>heat treatment</kwd>
</kwd-group>
</article-meta>
</front>
<body>
<sec id="s1">
<title>1 Introduction</title>
<p>Modern plant breeding and agricultural biotechnology are experiencing a major revolution with the emergence of the clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) endonucleases. This technology enables modifications of target DNA in a broad range of plant species. These include not only model plants, such <italic>Arabidopsis</italic>, <italic>Brachypodium</italic>, or <italic>Medicago</italic>, but also more than 70 crop species (<xref ref-type="bibr" rid="B70">Ricroch et al., 2017</xref>; <xref ref-type="bibr" rid="B49">Liu et al., 2021</xref>). The scope of CRISPR-Cas technology&#x2019;s applications ranges from crop quality improvement (<xref ref-type="bibr" rid="B41">Ku and Ha, 2020</xref>; <xref ref-type="bibr" rid="B49">Liu et al., 2021</xref>) to abiotic (<xref ref-type="bibr" rid="B63">Osakabe and Osakabe, 2017</xref>; <xref ref-type="bibr" rid="B88">Zafar et al., 2019</xref>) and biotic stress (<xref ref-type="bibr" rid="B1">Ahmad et al., 2021</xref>; <xref ref-type="bibr" rid="B33">Jain et al., 2021</xref>) management.</p>
<p>Despite the widespread adoption of gene-editing technologies, attaining high editing efficiency on any gene of interest remains a challenge in many cases, particularly in large, complex, and partially duplicated plant genomes. For these, one of the major bottlenecks is finding adequate targetable sequences that meet the specificities of a given Cas nuclease.</p>
<p>Successful and specific targeting relies on a unique protospacer adjacent motif (PAM) adjacent to each target sequence. The Cas9 from <italic>Streptococcus pyogenes</italic> (SpCas9), the most commonly used Cas, requires a short 5&#x2032;-NGG-3&#x2032; PAM sequence for targeting (<xref ref-type="bibr" rid="B34">Jinek et al., 2012</xref>). The simplicity of this PAM sequence increases the editing feasibility of the target DNA but leads to unintended edits if there are multiple copies of the target sequence, as happens in complex genomes.</p>
<p>Thus, the characterization of Cas9 orthologs, the use of Cas12a nucleases, and the application of rational protein engineering have expanded the range of targetable sequences. To date, almost 800 different Cas9 (<xref ref-type="bibr" rid="B24">Gasiunas et al., 2020</xref>; <xref ref-type="bibr" rid="B51">Makarova et al., 2020</xref>) and 58 distinct Cas12a orthologous (<xref ref-type="bibr" rid="B89">Zetsche et al., 2015</xref>; <xref ref-type="bibr" rid="B54">Marshall et al., 2018</xref>; <xref ref-type="bibr" rid="B81">Teng et al., 2019</xref>; <xref ref-type="bibr" rid="B31">Jacobsen et al., 2020</xref>; <xref ref-type="bibr" rid="B90">Zetsche et al., 2020</xref>) have been identified. In addition, 59 Cas effectors have been engineered to recognize a more flexible PAM (<xref ref-type="bibr" rid="B18">Collias and Beisel, 2021</xref>).</p>
<p>Much effort has been dedicated to increasing the frequency of induced mutations at the target site, including temperature optimization (<xref ref-type="bibr" rid="B85">Xiang et al., 2017</xref>; <xref ref-type="bibr" rid="B56">Milner et al., 2020</xref>). Cas9 and Cas12a enzymes are sensitive to temperature (<xref ref-type="bibr" rid="B45">LeBlanc et al., 2018</xref>; <xref ref-type="bibr" rid="B52">Malzahn et al., 2019</xref>), and changes in temperature affect the on-target mutation rate and increase off-target editing rates (<xref ref-type="bibr" rid="B85">Xiang et al., 2017</xref>; <xref ref-type="bibr" rid="B45">LeBlanc et al., 2018</xref>; <xref ref-type="bibr" rid="B6">Banakar et al., 2022</xref>; <xref ref-type="bibr" rid="B8">Blomme et al., 2022</xref>). Their optimal temperature coincides with that of their mammalian commensals, which is at least 10&#xb0;C too high for most plant tissue cultures. With these precedents in mind, we aimed to assess which Cas9/Cas12a proteins and incubation temperature are best for editing calli derived from rice.</p>
</sec>
<sec sec-type="materials|methods" id="s2">
<title>2 Materials and methods</title>
<sec id="s2-1">
<title>2.1 Plant material and growing conditions</title>
<p>Rice seeds (<italic>Oryza sativa</italic> L. cv Taipei 309) were used to start cell lines as described by <xref ref-type="bibr" rid="B65">Phan et al. (2007)</xref>. Seeds were dehusked and surface-sterilized in 70% (v/v) ethanol for 2&#xa0;min followed by a 30-min soak incubation in 60% household bleach (6.0% sodium hypochlorite) with 0.01% Tween-20. After rinsing three times with sterile H<sub>2</sub>O for 2&#xa0;minutes, the kernels were dried and plated in a 5 &#xd7; 5 grid on modified NB medium (<xref ref-type="bibr" rid="B16">Chen et al., 1998</xref>) solidified with 2.5&#xa0;g&#xa0;L<sup>-1</sup> Gelzan&#x2122; (BioWORLD, Dublin, OH, USA) in 100 &#xd7; 15&#xa0;mm Petri dishes sealed with 3M&#x2122; Micropore&#x2122; tape (3M Healthcare, Saint Paul, MN, US). Plates were incubated at 27&#xb0;C in dark conditions to induce callus formation. Type II calli (<xref ref-type="bibr" rid="B3">Armstrong and Green, 1985</xref>) were selected and maintained in the dark with transfers every 3&#xa0;weeks for 5&#xa0;months before transformation.</p>
</sec>
<sec id="s2-2">
<title>2.2 Vectors</title>
<p>The editing vectors (<xref ref-type="fig" rid="F1">Figure 1A</xref>) were modified versions of pOsC9-H2, which contain the OsUbi2 promoter:Cas9 (<italic>Sbf</italic> I/<italic>Xba</italic> I fragment from pRGEB32 Addgene plasmid &#x23;63142, <xref ref-type="bibr" rid="B86">Xie et al. (2015)</xref>) and the PCR-amplified nopaline synthase (NOS) terminator inserted into a modified pMECA vector (<xref ref-type="bibr" rid="B82">Thomson and Parrott, 1998</xref>). The PvUbi2 promoter:<italic>hph</italic> (<italic>Sbf</italic> I/<italic>Xho</italic> I fragment from pPANIC10A (<xref ref-type="bibr" rid="B53">Mann et al., 2012</xref>) and the PCR-amplified Pv<italic>Ub</italic>i<italic>2</italic> terminator (GenBank HM209468) were then added to complete the plant selectable marker cassette.</p>
<fig id="F1" position="float">
<label>FIGURE 1</label>
<caption>
<p>Experimental design overview. <bold>(A)</bold> Schematic representation of the plasmids used for stable biolistic transformation. <bold>(B)</bold> Workflow of temperature treatment for assessing Cas9/Cas12a editing rates.</p>
</caption>
<graphic xlink:href="fgeed-05-1074641-g001.tif"/>
</fig>
<p>Vector pOsSpC9E1-H2 was assembled by inserting a T4 DNA polymerase-blunted <italic>Bam</italic> HI/<italic>Avr</italic> II fragment of pStuHSpyCas9 (<xref ref-type="bibr" rid="B12">Campbell et al., 2019</xref>) containing SpCas9 and the E1 NLS from Glyma.06g207800 to replace the Cas9:NLS in pOsC9-H2 digested with <italic>Bsr</italic> GI/<italic>Not</italic> I and blunted with T4 DNA polymerase.</p>
<p>Next, pOsSaC9E1-H2 was assembled as above from pStuHSaC9 in which <italic>Staphylococcus aureous</italic> Cas9 (SaCas9, Addgene plasmid &#x23;61591) replaced SpCas9 in pStuHSpyC9. Plasmid OsSt1C9E1-H2 contains the <italic>Streptococcus thermophilus</italic> &#x23;1 Cas9 (St1Cas9, Addgene plasmid &#x23;48669), pOsAsC12aE1-H2 contains the <italic>Acidaminococcus</italic> AsCas12a (Addgene plasmid &#x23;69982) and pOsMb3C12aE1-H2 contains the <italic>Moraxella bovoculi</italic> AAX11_00205 Mb3Cas12a (Addgene plasmid &#x23;92293).</p>
<p>The gRNA cassette containing the OsU6 promoter (<xref ref-type="bibr" rid="B23">Feng et al., 2013</xref>), the specific target site sequences, and the corresponding trans-activating crRNA (tracrRNA) scaffold or direct repeat (DR) sequence for each endonuclease (<xref ref-type="sec" rid="s10">Supplementary Table S1</xref>) was inserted into an <italic>Asc</italic>I/<italic>Pme</italic>I-digested modified pOsC9-H2 plasmid <italic>via</italic> Gibson assembly as described in <xref ref-type="bibr" rid="B12">Campbell et al. (2019)</xref>.</p>
<p>PCR for cloning used Q5 Polymerase (New England Biolabs, Ipswich, MA, United States) and was verified with Sanger sequencing (Genewiz, Inc.). NEB 5-&#x3b1; competent <italic>E. coli</italic> (New England Biolabs, Ipswich, MA, United States) was used as host for cloning and plasmid propagation. Bacteria were grown in Luria-Bertani (<italic>LB</italic>) medium supplemented with 100&#xa0;&#x3bc;g&#xa0;mL<sup>-1</sup> ampicillin.</p>
<sec id="s2-2-1">
<title>2.2.1 Target selection for protein activity assessment</title>
<p>Phytoene desaturase (PDS) from rice (OsPDS, LOC_Os03g08570, Os03g0184000) was selected as the target gene to evaluate Cas nuclease activity at different temperatures. OsPDS is encoded by a single copy gene that consists of 14 exons and spans 4,416&#xa0;bp on rice chromosome 3. The PDS gene is commonly targeted because its disruption produces a bleached phenotype due to the absence of chlorophyll-protecting carotene. The bleached color serves as a marker to visually score CRISPR-Cas activity.</p>
<p>One single target was selected for each Cas ortholog (except AsCas12a and Mb3Cas12a, which share the same target site, <xref ref-type="table" rid="T1">Table 1</xref>). An appropriate target site was selected from the sites that displayed the lowest predicted off-target rate and the highest predicted on-target activity. gRNA expression through OsU6 promoter requires a guanosine nucleotide to initiate transcription. Geneious 11.0.5 (<ext-link ext-link-type="uri" xlink:href="https://www.geneious.com/">https://www.geneious.com</ext-link>) was used to identify all possible candidate targets for each Cas protein [GN19-NGG (SpCas9), GN20-NNGRRT (SaCas9), GN19-NNAGAAW (St1Cas9), TTTV-N20 (As/Mb3Cas12a)] and their potential off-targets, with a maximum mismatch tolerance against off-targets of six or fewer nucleotides and up to 1 indel. <italic>O. sativa</italic> Japonica Group (Japanese rice) genome assembly IRGSP-1.0 from The International Rice Genome Sequencing Project (IRGSP) (<xref ref-type="bibr" rid="B37">Kawahara et al., 2013</xref>) was used for off-target site prediction. Potential on-target activity was determined using Azimuth 2.0 (<xref ref-type="bibr" rid="B20">Doench et al., 2016</xref>; <xref ref-type="bibr" rid="B72">Sanson et al., 2018</xref>) for SpCas9 and SaCas9, CCTop (<xref ref-type="bibr" rid="B78">Stemmer et al., 2015</xref>; <xref ref-type="bibr" rid="B43">Labuhn et al., 2017</xref>) for St1Cas9 and Seq-DeepCpf1 (<xref ref-type="bibr" rid="B39">Kim et al., 2018</xref>) for both Cas12a endonucleases.</p>
<table-wrap id="T1" position="float">
<label>TABLE 1</label>
<caption>
<p>Molecular analyses of OsPDS alleles in rice embryogenic calli exposed to heat treatment.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th rowspan="3" align="center">Cas effector</th>
<th rowspan="3" align="center">Temperature (&#xb0;C)</th>
<th rowspan="3" align="center">Initial explants</th>
<th rowspan="3" align="center">Hyg<sup>R</sup> callus</th>
<th rowspan="3" align="center">Hyg<sup>R</sup> events</th>
<th rowspan="3" align="center">Non-analyzed events</th>
<th rowspan="3" align="center">Events with no reads</th>
<th rowspan="3" align="center">Events analyzed</th>
<th rowspan="3" align="left">Edited events</th>
<th colspan="4" align="left">Edition</th>
</tr>
<tr>
<th rowspan="2" align="left">Monoallelic</th>
<th colspan="2" align="left">Biallelic</th>
<th rowspan="2" align="left">Multiple alleles</th>
</tr>
<tr>
<th align="left">HOM</th>
<th align="left">HET</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td rowspan="2" align="left">SaCas9</td>
<td align="center">27</td>
<td align="center">125</td>
<td align="center">22</td>
<td align="center">33</td>
<td align="center">0</td>
<td align="center">1</td>
<td align="center">30</td>
<td align="center">8</td>
<td align="center">4</td>
<td align="center">1</td>
<td align="center">0</td>
<td align="center">3</td>
</tr>
<tr>
<td align="center">37</td>
<td align="center">125</td>
<td align="center">36</td>
<td align="center">80</td>
<td align="center">2</td>
<td align="center">1</td>
<td align="center">77</td>
<td align="center">26</td>
<td align="center">11</td>
<td align="center">8</td>
<td align="center">4</td>
<td align="center">3</td>
</tr>
<tr>
<td rowspan="2" align="left">SpCas9</td>
<td align="center">27</td>
<td align="center">125</td>
<td align="center">50</td>
<td align="center">121</td>
<td align="center">5</td>
<td align="center">0</td>
<td align="center">116</td>
<td align="center">73</td>
<td align="center">8</td>
<td align="center">19</td>
<td align="center">33</td>
<td align="center">13</td>
</tr>
<tr>
<td align="center">37</td>
<td align="center">125</td>
<td align="center">60</td>
<td align="center">140</td>
<td align="center">1</td>
<td align="center">0</td>
<td align="center">139</td>
<td align="center">78</td>
<td align="center">11</td>
<td align="center">12</td>
<td align="center">38</td>
<td align="center">17</td>
</tr>
<tr>
<td rowspan="2" align="left">St1Cas9 <bold>(Esvelt)</bold>
</td>
<td align="center">27</td>
<td align="center">125</td>
<td align="center">29</td>
<td align="center">79</td>
<td align="center">1</td>
<td align="center">1</td>
<td align="center">77</td>
<td align="center">0</td>
<td align="center">0</td>
<td align="center">0</td>
<td align="center">0</td>
<td align="center">0</td>
</tr>
<tr>
<td align="center">37</td>
<td align="center">125</td>
<td align="center">41</td>
<td align="center">118</td>
<td align="center">1</td>
<td align="center">1</td>
<td align="center">116</td>
<td align="center">0</td>
<td align="center">0</td>
<td align="center">0</td>
<td align="center">0</td>
<td align="center">0</td>
</tr>
<tr>
<td rowspan="2" align="left">St1Cas9 <bold>(Briner)</bold>
</td>
<td align="center">27</td>
<td align="center">125</td>
<td align="center">24</td>
<td align="center">55</td>
<td align="center">2</td>
<td align="center">0</td>
<td align="center">53</td>
<td align="center">0</td>
<td align="center">0</td>
<td align="center">0</td>
<td align="center">0</td>
<td align="center">0</td>
</tr>
<tr>
<td align="center">37</td>
<td align="center">125</td>
<td align="center">22</td>
<td align="center">44</td>
<td align="center">1</td>
<td align="center">0</td>
<td align="center">43</td>
<td align="center">0</td>
<td align="center">0</td>
<td align="center">0</td>
<td align="center">0</td>
<td align="center">0</td>
</tr>
<tr>
<td rowspan="2" align="left">AsCas12a</td>
<td align="center">27</td>
<td align="center">125</td>
<td align="center">40</td>
<td align="center">86</td>
<td align="center">2</td>
<td align="center">0</td>
<td align="center">66</td>
<td align="center">1</td>
<td align="center">0</td>
<td align="center">0</td>
<td align="center">0</td>
<td align="center">1</td>
</tr>
<tr>
<td align="center">37</td>
<td align="center">125</td>
<td align="center">48</td>
<td align="center">96</td>
<td align="center">1</td>
<td align="center">0</td>
<td align="center">95</td>
<td align="center">2</td>
<td align="center">1</td>
<td align="center">0</td>
<td align="center">1</td>
<td align="center">0</td>
</tr>
<tr>
<td rowspan="2" align="left">Mb3Cas12a</td>
<td align="center">27</td>
<td align="center">125</td>
<td align="center">45</td>
<td align="center">96</td>
<td align="center">1</td>
<td align="center">1</td>
<td align="center">94</td>
<td align="center">5</td>
<td align="center">4</td>
<td align="center">1</td>
<td align="center">2</td>
<td align="center">0</td>
</tr>
<tr>
<td align="center">37</td>
<td align="center">125</td>
<td align="center">52</td>
<td align="center">130</td>
<td align="center">2</td>
<td align="center">1</td>
<td align="center">127</td>
<td align="center">55</td>
<td align="center">9</td>
<td align="center">5</td>
<td align="center">27</td>
<td align="center">14</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>Abbreviations: Hyg<sup>R</sup> stands for hygromycin-resistant tissue, HOM denotes homozygous biallelic edits, and HET indicates heterozygous biallelic edits.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
</sec>
<sec id="s2-3">
<title>2.3 Biolistic transformation</title>
<p>Type II rice callus was transformed using biolistic microprojectile bombardment 4 days after the last subculture. Prior to transformation, for each construct, 50 rice calli were transferred onto NB osmotic medium (NBO, <xref ref-type="bibr" rid="B16">Chen et al., 1998</xref>) and placed for 6&#xa0;h in a 2-cm diameter disk in the center of a Petri dish.</p>
<p>Transformation was achieved using the Biolistic PDS-1000/He particle delivery system (BIO-RAD, Hercules, CA) at a target distance of 9&#xa0;cm and helium pressure of 7,584.233&#xa0;kPa (1,100 psi). For each shot, 0.3175&#xa0;mg of 0.4-&#xb5;m gold particles (InBio Gold, Victoria, Australia) and 125&#xa0;ng of plasmid DNA were used. Briefly, 5&#xa0;mg of gold particles were washed with 1&#xa0;mL of 100% ethanol. The microcarriers were suspended by water bath sonication for 10&#xa0;s and placed on ice for 30&#xa0;s. The sonication and ice step was repeated a total of three times. The gold particles were recovered by centrifugation at 3,287 &#xd7;g for 5&#xa0;min and resuspended in 175&#xa0;&#xb5;L of 100% ethanol. Two rounds of vortexing for 1&#xa0;min and water bath sonication for 10&#xa0;s were conducted prior to withdrawing a 40&#xa0;&#xb5;L aliquot to a new sterile microfuge tube. A short centrifugation was carried out to settle the microcarriers, and the supernatant was removed. The gold particles were washed in 1&#xa0;mL sterile water followed by a 5-min centrifugation step at 268 &#xd7;g to recover the gold prep. After spinning, 400&#xa0;ng of plasmid DNA, 220&#xa0;&#xb5;L sterile water, 250&#xa0;&#xb5;L of 2.5&#xa0;M CaCl<sub>2</sub>, and 50&#xa0;&#xb5;L of 100&#xa0;mM spermidine were added to the microcarriers. The gold suspension was homogenized after the addition of each solution by vortexing for 2&#xa0;s and sonicating for 10&#xa0;s. DNA/gold suspension was precipitated on ice for 2&#xa0;min, pelleted by centrifugation at 43 &#xd7;g for 5&#xa0;min, washed in 600&#xa0;&#xb5;L 100% ethanol at 43 &#xd7;g for 5&#xa0;min, and finally resuspended in 36&#xa0;&#xb5;L 100% ethanol. The microcarriers were incubated on ice for 1&#xa0;h. Ten &#xb5;L of DNA-coated gold beads were spread on a macrocarrier and allowed to dry.</p>
<p>The six different plasmids were shot the same day using a randomized block design, with five replicates. Each treatment consisted of one Cas endonuclease whose activity was assessed at two different temperatures (27&#xb0;C and 37&#xb0;C). The experimental unit consisted of a 100 &#xd7; 15&#xa0;mm Petri dish containing 25 type II embryogenic callus pieces.</p>
<p>Eighteen hours post-bombardment, tissue from each shot was transferred from NBO medium onto two 100 &#xd7; 15&#xa0;mm Petri dish plates of modified NB medium containing 50&#xa0;mg/L hygromycin B (Calbiochem<sup>&#xae;</sup>, NBH50) in a 5x5-grid. Plates were divided into two groups: one group was subjected to heat treatment (37&#xb0;C for 1 week) and then moved to 27&#xb0;C, while the other group was kept at 27&#xb0;C. In both cases plates were maintained in the dark. PDS <italic>knockout</italic> phenotypes were discernable by their white color and were visually scored 4&#xa0;weeks after moving plates to 27&#xb0;C (<xref ref-type="fig" rid="F1">Figure 1B</xref>).</p>
</sec>
<sec id="s2-4">
<title>2.4 Tissue culture genotyping</title>
<p>Genomic DNA from all hygromycin-resistant calli was isolated using the CTAB method adapted from <xref ref-type="bibr" rid="B79">Stewart and Via (1993)</xref>. In summary, callus pieces were ground with 900&#xa0;&#xb5;L CTAB buffer (100&#xa0;mM Tris-Cl (pH 8.0), 20&#xa0;mM EDTA, 1.42&#xa0;M NaCl, 2% (w/v) cetrimonium bromide (CTAB), 2% (w/v) polyvinylpyrrolidone (PVP-40), and 4&#xa0;nM diethyldithiocarbamicacid (DIECA)) with two 4.8-mm diameter steel beads (Med Supply Partners, Atlanta, GA, USA) in a GenoGrinder 2010 (Spex<sup>&#xae;</sup> SamplePrep LLC, Metuchen, NJ, USA) for 1&#xa0;min at 1,000 strokes min<sup>-1</sup>. The solution was incubated at 65&#xb0;C for 30&#xa0;min, after which 800&#xa0;&#xb5;L of chloroform:isoamyl alcohol (24:1) were added. The water-soluble fraction was recovered after centrifugation for 10&#xa0;min at 16,000 &#xd7;g. DNA was precipitated with 0.85 volumes of 100% isopropanol and centrifugation as described before. Finally, the DNA pellet was washed twice with 70% ethanol, air-dried overnight, and resuspended in TE buffer. DNA quantity was measured with the BioTek&#x2122; Synergy&#x2122; 2 microplate reader (BioTek Instruments, Winooski, VT, United States).</p>
<p>A subset of 18 samples were analyzed by Sanger sequencing, using specific primers (<xref ref-type="sec" rid="s10">Supplementary Table S2</xref>) to amplify the corresponding target regions in exon 5 and 10, respectively. The Synthego ICE Analysis tool v2 (<xref ref-type="bibr" rid="B80">Synthego, 2019</xref>) was used to detect the presence of CRISPR-Cas-induced mutations.</p>
<p>Editing patterns for all collected samples were then determined by deep sequencing of PCR amplification products using specific primers tailed with Illumina sequencing primers to check for both on-target and off-target cleavage (<xref ref-type="sec" rid="s10">Supplementary Table S2</xref>) as described in <xref ref-type="bibr" rid="B91">Zhou et al. (2015)</xref>. Indexed samples were pooled together and sequenced on the Illumina MiSeq platform (2x 150 cycles) at the Georgia Genomics and Bioinformatics Core (GGBC). Paired-end raw reads were pre-processed with Cutadapt v.3.4 (<xref ref-type="bibr" rid="B55">Martin (2011)</xref>, with the settings -q 20 -m 125). Then, corresponding mates were merged with BBMerge function from the BBtools suite v.38.92 (<ext-link ext-link-type="uri" xlink:href="https://jgi.doe.gov/data-and-tools/bbtools">https://jgi.doe.gov/data-and-tools/bbtools</ext-link>). Processed reads were analyzed using AGEseq software (<xref ref-type="bibr" rid="B87">Xue and Tsai, 2015</xref>). Statistical analyses were performed using R open-source software (version 4.2.0, <xref ref-type="bibr" rid="B67">R Core Team (2022)</xref>).</p>
</sec>
</sec>
<sec sec-type="results" id="s3">
<title>3 Results</title>
<p>Genome editing rates were assessed for five different RNA-guided endonucleases, SpCas9, SaCas9, St1Cas9, AsCas12a and Mb3Cas12a under two temperature regimes: 27&#xb0;C and 37&#xb0;C. The target gene for editing was the rice phytoene desaturase (OsPDS), as PDS knockouts display a detectable albino phenotype, allowing for quick screening based on tissue color (<xref ref-type="fig" rid="F2">Figure 2A</xref>).</p>
<fig id="F2" position="float">
<label>FIGURE 2</label>
<caption>
<p>Gene editing using different Cas9/Cas12a variants. <bold>(A)</bold> Representative rice embryogenic callus phenotypes. Wild-type (WT) calli are yellow, while PDS-<italic>ko</italic> calli are white. <bold>(B)</bold> CRISPR-Cas gene editing efficiency of rice phytoene desaturase (OsPDS) gene both at 27&#xb0;C (light blue) and 37&#xb0;C (red). Bar graphs show the percentage of PDS mutants identified by transformed calli visual inspection. Standard error mean (SEM) is indicated by whiskers. St1Cas9 trans-activating CRISPR RNA (tracrRNA) reported by <xref ref-type="bibr" rid="B22">Esvelt et al. (2013)</xref> (tacrRNA 1) and <xref ref-type="bibr" rid="B10">Briner et al. (2014)</xref> (tacrRNA 2), respectively. <bold>(C)</bold> Indel distribution of insertions and deletions from single samples analyzed by Sanger sequencing.</p>
</caption>
<graphic xlink:href="fgeed-05-1074641-g002.tif"/>
</fig>
<p>All possible 20-bp protospacer sequences targeting the OsPDS gene were identified for each Cas endonuclease, except SaCas9, which requires 21-bp protospacers (<xref ref-type="sec" rid="s10">Supplementary Figure S1</xref>). Two hundred seventy-four targets were identified for Cas12a and 127 for SpCas9, both of which use shorter PAM sequences. Conversely, 31 and 7 target sequences were found for SaCas9 and St1Cas9, which recognize 6- and 7-nucleotide PAM sequences, respectively. Only a small subset of targets overlaps with coding sequences: 82, 48, 4 and 2 for Cas12a, SpCas9, SaCas9, and St1Cas9, respectively. To facilitate the direct comparisons between all Cas nucleases, we chose target sequences located within a 100-bp region on exon 5, on the premise that editing at any of these targets would have a similar impact on the protein structure and function. Predicted on-target activity and potential off-target sites were also considered, maximizing on-target activity and reducing off-target reactivity when choosing the target sites. Due to the reduced number of candidate protospacer sequences for St1Cas9, its the best target sequence is located on exon 10. Each target-specific crRNA was cloned into a biolistic vector with the rice ubiquitin 2 promoter driving the expression of the specific Cas nuclease, an E1 nuclear localization signal (NLS), and nopaline synthase (NOS) gene terminator (<xref ref-type="fig" rid="F1">Figure 1A</xref>). Rice RNA polymerase III U6 promoter was used for single guide RNA (sgRNA) expression.</p>
<p>Constructs were shot into rice type II embryogenic calli. The experiment was conducted using a randomized complete block design with five replicates. There were 250 calli tested for each Cas endonuclease (125 per temperature treatment). One month after completing the different heat treatments, editing rates were assessed by visual scoring of calli to determine the number of calli that showed at least one edit present (i.e., 1 callus with 1 white event got the same score as 1 callus with 3 white events), and editing rates are summarized in <xref ref-type="fig" rid="F2">Figure 2B</xref>.</p>
<p>SpCas9 is the best performing Cas enzyme, yielding the best editing rate, regardless of the incubation temperature (24.8% at 27&#xb0;C and 27.2% at 37&#xb0;C). Mb3Cas12a is the next best performing enzyme, albeit with relatively low efficiency at 27&#xb0;C (8%) but reasonably high efficiency at 37&#xb0;C (16%). The next best enzyme is SaCas9 at 37&#xb0;C (12% efficiency), but its efficiency dropped to 0.8% at 27&#xb0;C. St1Cas9 with the tracrRNA described by <xref ref-type="bibr" rid="B22">Esvelt et al. (2013)</xref> scored a 3.2% efficiency at 27&#xb0;C, but only 1.6% efficiency at 37&#xb0;C. The same protein using the alternative tracrRNA described by <xref ref-type="bibr" rid="B10">Briner et al. (2014)</xref> yielded &#x003C;1% editing efficiency at 27&#xb0;C and did not generate any edits at 37&#xb0;C. Finally, AsCas12a produced a 1.6% editing rate at 37&#xb0;C but only 0.8% at 27&#xb0;C.</p>
<p>Tissue was collected for DNA extraction and molecular verification of editing from all newly formed hygromycin-resistant events (both white and yellow). In total, 1,072 samples were collected, including many events recovered from Cas transformations that showed low or no editing activity, as there could be underlying monoallelic edits that were missed in the visual scoring. Eighteen random events derived from each endonuclease were genotyped by Sanger sequencing. As expected, white tissue samples showed either homozygous or heterozygous biallelic mutations that knocked out PDS. Yellow tissue samples showed either no deletions (wt-like PDS) or, in some cases, editing in one of the alleles. These results prompted us to verify all available samples (<xref ref-type="fig" rid="F2">Figure 2C</xref>).</p>
<p>Individual Illumina libraries were prepared for all the samples. Libraries were designed to include the target site, plus the three most likely off-target locations and were evaluated for each Cas protein. Illumina sequencing revealed some discrepancies from visual scoring (<xref ref-type="fig" rid="F3">Figure 3A</xref>; <xref ref-type="table" rid="T2">Table 2</xref>, <xref ref-type="sec" rid="s10">Supplementary Table S3</xref>), but all Sanger sequences were identical to their Illumina counterpart.</p>
<fig id="F3" position="float">
<label>FIGURE 3</label>
<caption>
<p>Gene editing efficiency of different Cas effectors <italic>via</italic> Illumina sequencing. <bold>(A)</bold> Editing frequencies of rice phytoene desaturase (OsPDS) gene under different temperatures, 27&#xb0;C (light blue) and 37&#xb0;C (red). Bar graphs show the percentage of PDS gene edits as identified by short-read sequencing. Trans-activating CRISPR RNA (tracrRNA) 1 and tracrRNA 2 were reported by <xref ref-type="bibr" rid="B22">Esvelt et al. (2013)</xref> and <xref ref-type="bibr" rid="B10">Briner et al. (2014)</xref>, respectively. Significance <italic>p</italic>-value levels according to t-test are shown as &#x3c;0.05 (&#x2a;). <bold>(B)</bold> Indel size profiles. Occurrence of deletion (d) and insertion (i). Frequencies (as percentage shown in the <italic>y</italic>-axis) were calculated using the number of edited alleles with N bp deletions or insertions by the number of all the alleles identified by sequencing. Graphs depict means and error bars show standard error of the mean (SEM) from 5 replicates. Results from St1Cas9 are not shown due to the lack of editing.</p>
</caption>
<graphic xlink:href="fgeed-05-1074641-g003.tif"/>
</fig>
<table-wrap id="T2" position="float">
<label>TABLE 2</label>
<caption>
<p>Summary of the different target-specific crRNAs.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th rowspan="2" align="left">Endonuclease</th>
<th rowspan="2" align="left">PAM sequence</th>
<th rowspan="2" align="left">Spacer sequence (5&#x27; &#x2192; 3&#x27;)</th>
<th rowspan="2" align="left">Direction</th>
<th colspan="2" align="left">Predicted on-target activity (Percentage)</th>
<th colspan="9" align="left">Predicted off-target activity</th>
</tr>
<tr>
<th align="left">CRISPRko<xref ref-type="table-fn" rid="Tfn1">
<sup>a</sup>
</xref>
</th>
<th align="left">CCTop<xref ref-type="table-fn" rid="Tfn2">
<sup>b</sup>
</xref>
</th>
<th align="left">Sequence (&#x23;1)</th>
<th align="left">Off-target &#x23;1 Score</th>
<th align="left">Location (&#x23;1)</th>
<th align="left">Sequence (&#x23;2)</th>
<th align="left">Off-target &#x23;2 Score</th>
<th align="left">Location (&#x23;2)</th>
<th align="left">Sequence (&#x23;3)</th>
<th align="left">Off-target &#x23;3 Score</th>
<th align="left">Location (&#x23;3)</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">SpCas9</td>
<td align="left">CGG</td>
<td align="left">GCGAGCTTGGTATTAATGAT</td>
<td align="left">forward</td>
<td align="left">54.47</td>
<td align="left">56.24</td>
<td align="left">
<underline>TAT</underline>A<underline>T</underline>CTTG<underline>A</underline>TATTAATGAT<bold>
<underline>A</underline>GG</bold>
</td>
<td align="left">4.01</td>
<td align="left">Chr02:28740598..28740620</td>
<td align="left">GCGAG<underline>G</underline>TTGGT<underline>G</underline>ATTAATG<underline>G</underline>T<bold>
<underline>G</underline>GG</bold>
</td>
<td align="left">2.75</td>
<td align="left">Chr10:19346533..19346556</td>
<td align="left">G<underline>TA</underline>A<underline>C</underline>C<underline>A</underline>TG<underline>A</underline>TATTAATGAT<bold>
<underline>A</underline>GG</bold>
</td>
<td align="left">2.71</td>
<td align="left">Chr01:35317259..35317281</td>
</tr>
<tr>
<td align="left">SaCas9</td>
<td align="left">CTGAAT</td>
<td align="left">GTTTCAGGAAAATCAAACCGG</td>
<td align="left">reverse</td>
<td align="left">81.47</td>
<td align="left">67.22</td>
<td align="left">GTT<underline>AG</underline>AG<underline>T</underline>AAAAT<underline>G</underline>AAACCGG<bold>
<underline>T</underline>TGAAT</bold>
</td>
<td align="left">1.89</td>
<td align="left">Chr11:22975874..22975900</td>
<td align="left">GTTTC<underline>T</underline>G<underline>TTGG</underline>ATCAAACCGG<bold>
<underline>TG</underline>G<underline>G</underline>AT</bold>
</td>
<td align="left">1.62</td>
<td align="left">Chr05:8034722..8034748</td>
<td align="left">G<underline>A</underline>TT<underline>GT</underline>GG<underline>T</underline>A<underline>GT</underline>TCAAACCGG<bold>CTG<underline>GG</underline>T</bold>
</td>
<td align="left">1.55</td>
<td align="left">Chr03:27509680..27509706</td>
</tr>
<tr>
<td align="left">St1Cas9</td>
<td align="left">ATAGAAA</td>
<td align="left">GTTTGAACATTTCAGGTTTG</td>
<td align="left">forward</td>
<td align="left">N/A</td>
<td align="left">75.74</td>
<td align="left">G<underline>CC</underline>T<underline>A</underline>AA<underline>G</underline>ATTT<underline>T</underline>AGGTTTG<bold>
<underline>GC</underline>AGAA<underline>T</underline>
</bold>
</td>
<td align="left">1.73</td>
<td align="left">Chr01:3663026..3663052</td>
<td align="left">
<underline>C</underline>TTTGAA<underline>-</underline>ATT<underline>AAA</underline>GGTTTG<bold>A<underline>C</underline>AGAA<underline>T</underline>
</bold>
</td>
<td align="left">1.43</td>
<td align="left">Chr08:25668255..25668280</td>
<td align="left">G<underline>AACA</underline>AACA<underline>G</underline>T<underline>C</underline>CAGGTTTG<bold>
<underline>GA</underline>AGAA<underline>T</underline>
</bold>
</td>
<td align="left">1.36</td>
<td align="left">Chr08:20390698..20390724</td>
</tr>
<tr>
<td align="left">Cas12a<xref ref-type="table-fn" rid="Tfn3">
<sup>&#x2021;</sup>
</xref>
</td>
<td align="left">TTTA</td>
<td align="left">AGTTGGAGCTTATCCCAACA</td>
<td align="left">reverse</td>
<td align="left">83.23</td>
<td align="left">70.97</td>
<td align="left">
<bold>TTTA</bold>AGTTGGA<underline>C</underline>CTT<underline>C</underline>TCCC<underline>AG</underline>C<underline>T</underline>
</td>
<td align="left">1.75</td>
<td align="left">Chr03:6381960..6381983 (XP_015631410.1)</td>
<td align="left">
<bold>TTTA</bold>A<underline>T</underline>TTGGAGCTTA<underline>G</underline>CC<underline>ATC</underline>CA</td>
<td align="left">1.49</td>
<td align="left">Chr05:4301398..4301421</td>
<td align="left">
<bold>TTT<underline>C</underline>
</bold>AG<underline>C</underline>TGGAGCT<underline>C</underline>A<underline>G</underline>CC<underline>A</underline>AACA</td>
<td align="left">1.38</td>
<td align="left">Chr08:801967..801990</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="Tfn1">
<label>
<sup>a</sup>
</label>
<p>On-target scoring is performed using Azimuth 2.0 (<xref ref-type="bibr" rid="B20">Doench et al., 2016</xref>; <xref ref-type="bibr" rid="B72">Sanson et al., 2018</xref>) for SpCas9 and SaCas9 systems and Seq-DeepCpf1 (<xref ref-type="bibr" rid="B39">Kim et al., 2018</xref>) for Cas12a (<ext-link ext-link-type="uri" xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design">https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design</ext-link>)</p>
</fn>
<fn id="Tfn2">
<label>
<sup>b</sup>
</label>
<p>
<xref ref-type="bibr" rid="B78">Stemmer et al. (2015)</xref>; <xref ref-type="bibr" rid="B43">Labuhn et al. (2017)</xref> (<ext-link ext-link-type="uri" xlink:href="https://crispr.cos.uni-heidelberg.de/">https://crispr.cos.uni-heidelberg.de</ext-link>).</p>
</fn>
<fn>
<p>PAM sequences are highlighted in bold.</p>
</fn>
<fn>
<p>Underlined bases indicated mismatches between the spacer used and the putative off-target site.</p>
</fn>
<fn id="Tfn3">
<label>
<sup>&#x2021;</sup>
</label>
<p>Same spacer was used for both AsCas12a and Mb3Cas12a.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<p>When St1Cas9 was used with the tracrRNA described by <xref ref-type="bibr" rid="B22">Esvelt et al. (2013)</xref> a total of 197 newly formed hygromycin resistant events were recovered (118 events from heat-treated plus 79 events from tissue kept at 27&#xb0;C). However, no evidence of editing was detected when the callus was sequenced, even though five transformed calli were initially identified as positively edited (presence of white callus colonies).</p>
<p>Similarly, when St1Cas9 was used with the tracrRNA described by <xref ref-type="bibr" rid="B10">Briner et al. (2014)</xref> no evidence of editing was detected among the 43 events recovered from tissue subjected to heat treatment or the 53 events recovered from tissue kept at 27&#xb0;C. These findings agree with the nearly null activity observed visually. No edits were detected on any of the predicted off-target sites.</p>
<p>For SaCas9, the best observed editing rate (12%) occurred when the transformed tissue was incubated at 37&#xb0;C for a week. The Illumina results show that this protein induces mainly 1-bp insertions (66%). Despite the prevalence of small mutations, monoallelic deletions up to 32-bp or biallelic deletions of 16-bp were also detected. Sequencing data confirmed what was visually observed, with the differences in editing activity detected between the two approaches being attributable to event heterozygosity that could only be detected by sequencing. However, the latter approach shows very similar SaCas9 activity levels at both tested temperatures (21.8% at 27&#xb0;C and 19.3% at 37&#xb0;C). No clear evidence of editing was observed for two of the three off-targets. Sequencing data retrieved for the third off-target was of extremely low quality and made it difficult to assess editing. However, the first off target from two replicates showed one consistent SNP located 7&#xa0;bp downstream of the forward primer, not overlapping with the target sequence.</p>
<p>Finally, SpCas9 sequencing results confirm that activity levels are similar at both tested temperatures (65.9% at 27&#xb0;C vs. 63.1% at 37&#xb0;C). Editing rates are comparable to those obtained by visual scoring, with minor variation due to the presence of editing in heterozygosis and marginal error during tissue phenotyping. In contrast to SaCas9, SpCas9 primarly produces 3- to 5-bp deletions, although shorter and longer deletions were also observed. For instance, Sample C2-1&#xa0;at 27&#xb0;C from replicate 2 (PDS_Rep2_27C_Sp_C2-1) displays a biallelic edit: 22&#xa0;bp and 26&#xa0;bp deletions. Large insertions were also detected: sample C5-3&#xa0;at 27&#xb0;C from replicate 2 (PDS_Rep2_27C_Sp_C5-3) shows a monoallelic replacement of 14-bp that overlaps with the last section of the target. Interestingly, at 37&#xb0;C we observed a significant increase in the number of 1-bp insertions (from 4% at 27&#xb0;C to 11% at 37&#xb0;C), rating close to 3- and 5-bp deletions (<xref ref-type="fig" rid="F3">Figure 3B</xref>). Moreover, 30 events present multiple editing events, with up to six different alleles from editing. No strong evidence of editing at the first two off-target sites was observed, but, as described for SaCas9, samples from two replicates always have one SNP at the same position, in this case 6&#xa0;bp downstream from the forward primer, with no overlap with the target sequence. As was also the case with SaCas9, reduced numbers of reads were obtained for the third off-target site, but in most cases, it was sufficient to confirm lack of editing. In 75 cases (29.4%), one or two reads presented SNPs localized on the target sequence, but since those are SNPs (as opposed to deletions) often located far from the predicted cut site of SpCas9 (between position 17&#x2013;18 of the target sequence), they may be due to PCR errors rather than real editing events.</p>
<p>For AsCas12a, 179 independent events were recovered (84 events from tissue maintained at 27&#xb0;C and 95 independent events from calli incubated at 37&#xb0;C for a week). However, only two samples from heat-treated tissue and one from control temperature show editing: one of the heat-treated samples shows biallelic editing (one allele has a 7-bp deletion and the other presents a 4-bp deletion), and the second sample has a 10-bp deletion in one of the alleles. The sample maintained at 27&#xb0;C shows minimal modifications, with 90% of the reads showing no editing and 10% of the reads have either a 5- (5.4%) or 8-bp deletion (4.6%). No editing was detected at any of the predicted off-target sites.</p>
<p>Finally, Mb3Cas12a sequencing shows nearly null editing rates when tissue was maintained at 27&#xb0;C (2.96%), contrasting with the visual inspection score that showed editing rates of 8%. This difference can only be explained by phenotyping errors on the first replicate, where pale yellow calli were scored as white. When tissue was heat-treated, sequencing results are the same as with visual scoring (27.4% by sequencing vs 16% visually). No evidence of editing was detected at any of the off-target sites, except for one sample (PDS_Rep3_27C_Mb3_C8-2) from one replicate kept at 27&#xb0;C, which shows a 45-bp deletion in 8.1% of the reads at the third off-target site.</p>
</sec>
<sec sec-type="discussion" id="s4">
<title>4 Discussion</title>
<p>We evaluated the efficiency, specificity, and temperature effects of the most frequently used Cas variants&#x2014;Cas9 and Cas12a (also named Cpf1)&#x2014;used in plant science (<xref ref-type="bibr" rid="B57">Modrzejewski et al., 2019</xref>), by evaluating editing frequencies in PDS gene using rice embryogenic calli. The PDS gene has been used as a marker to infer CRISPR-Cas activity in several species (<xref ref-type="bibr" rid="B46">Li et al., 2013</xref>; <xref ref-type="bibr" rid="B75">Shan et al., 2014</xref>; <xref ref-type="bibr" rid="B11">Cai et al., 2015</xref>; <xref ref-type="bibr" rid="B61">Nishitani et al., 2016</xref>; <xref ref-type="bibr" rid="B64">Pan et al., 2016</xref>; <xref ref-type="bibr" rid="B59">Nakajima et al., 2017</xref>; <xref ref-type="bibr" rid="B62">Odipio et al., 2017</xref>; <xref ref-type="bibr" rid="B36">Kaur et al., 2018</xref>; <xref ref-type="bibr" rid="B28">Hooghvorst et al., 2019</xref>; <xref ref-type="bibr" rid="B84">Wilson et al., 2019</xref>; <xref ref-type="bibr" rid="B7">B&#xe1;nfalvi et al., 2020</xref>; <xref ref-type="bibr" rid="B83">Wang et al., 2020</xref>; <xref ref-type="bibr" rid="B50">Lu and Tian, 2022</xref>), as PDS knockout mutants have an easily noticeable albino phenotype. Rice embryogenic tissue was the chosen system because, as a mass of pluripotent cells, calli have the ability to induce <italic>de novo</italic> shoot bud regeneration, being highly relevant to developmental biology. Protoplast, in contrast, can be isolated from virtually any plant tissues (<xref ref-type="bibr" rid="B69">Reed and Bargmann, 2021</xref>) and provide a valid system for rapid, high throughput <italic>in vivo</italic> studies of gene expression and evaluation of genome editing efficacy (<xref ref-type="bibr" rid="B66">Poddar et al., 2020</xref>), but its preparation is laborious, time-consuming, and there&#x2019;s a lack of streamlined protocols to regenerate plants after protoplast transformation (<xref ref-type="bibr" rid="B69">Reed and Bargmann, 2021</xref>).</p>
<p>The sequence of the target-specific crRNA, its structural properties (<xref ref-type="bibr" rid="B9">Bortesi et al., 2016</xref>; <xref ref-type="bibr" rid="B27">Hassan et al., 2021</xref>; <xref ref-type="bibr" rid="B71">Riesenberg et al., 2022</xref>), and free energy changes on the target PAM context (<xref ref-type="bibr" rid="B19">Corsi et al., 2022</xref>) dictate the DNA target recognition mechanism of Cas protein and consequently have an impact on the Cas protein efficiency at on- and off-target sites. Accordingly, gene editing is facilitated by the availability of software (<xref ref-type="bibr" rid="B78">Stemmer et al., 2015</xref>; <xref ref-type="bibr" rid="B14">Chari et al., 2017</xref>; <xref ref-type="bibr" rid="B48">Liu et al., 2017</xref>; <xref ref-type="bibr" rid="B39">Kim et al., 2018</xref>; <xref ref-type="bibr" rid="B47">Listgarten et al., 2018</xref>; <xref ref-type="bibr" rid="B44">Labun et al., 2019</xref>; <xref ref-type="bibr" rid="B92">Zhu and Liang, 2019</xref>) that can identify different PAM sites, predict the editing efficiency at that site, and predict if off-target editing will take place. Finding unique target sites helps minimize the occurrence of such off-target edits, but truly unique target sites are difficult to find in highly duplicated genomes. The ability to choose from an assortment of PAM sites helps identify sites that are less likely to result in off-target effects. While it is unlikely that an off-target edit in a plant will lead to a novel risk (<xref ref-type="bibr" rid="B25">Graham et al., 2020</xref>), such edits remain a cause of public and regulatory concern, so they are best avoided.</p>
<p>Here we monitored the three best potential off-target sites for each target-specific sequence. In general, no edits were detected in any of the off-target sites selected for any of the different Cas nucleases tested. Only one single event (PDS_Rep3_27C_Mb3_C8-2) from one specific replicate kept at 27&#xb0;C, had 8.1% of the reads edited at the third off-target site. Some samples had the same exact same SNP in a recurrent position, always far from the expected cleavage site. These results can be explained by Illumina sequencing interpretation errors. We observed a decrease in average quality of R2 reads as compared to R1 reads in Illumina MiSeq platform paired end sequencing. The degree of quality reduction varied between reads of the same library. The low quality of R2 reads reduces sequencing depth and thus confounds data interpretation. Similar findings have been reported previously (<xref ref-type="bibr" rid="B74">Schirmer et al., 2015</xref>; <xref ref-type="bibr" rid="B17">Chen et al., 2018</xref>; <xref ref-type="bibr" rid="B68">Ramakodi, 2021</xref>).</p>
<p>As mentioned above, we aimed to test the impact of temperature on Cas9/Cas12a activity, as these nucleases were isolated from different bacteria having an optimal growth range, from 35&#xb0;C to 45&#xb0;C (<xref ref-type="bibr" rid="B2">Angelos, 2010</xref>; <xref ref-type="bibr" rid="B13">Chang et al., 2010</xref>; <xref ref-type="bibr" rid="B26">Harnett et al., 2011</xref>; <xref ref-type="bibr" rid="B30">Hudson, 2014</xref>; <xref ref-type="bibr" rid="B4">Gera and McIver, 2013</xref>), and these temperatures are substantially higher than the 20&#xb0;C&#x2013;28&#xb0;C temperature range that is best suited for plant tissue culture and transformation. In fact, when solely assessed visually, nuclease activity appears to be reduced at room temperature (22&#xb0;C&#x2013;28&#xb0;C) (<xref ref-type="bibr" rid="B58">Moreno-Mateos et al., 2017</xref>; <xref ref-type="bibr" rid="B45">LeBlanc et al., 2018</xref>; <xref ref-type="bibr" rid="B52">Malzahn et al., 2019</xref>; <xref ref-type="bibr" rid="B56">Milner et al., 2020</xref>; <xref ref-type="bibr" rid="B73">Schindele and Puchta, 2020</xref>), with Cas12a being the most negatively impacted. Editing efficiency is reported to improve when transformed plant tissue is incubated at higher temperature for a shorter period of time (<xref ref-type="bibr" rid="B35">Jordan et al., 2021</xref>; <xref ref-type="bibr" rid="B42">Kurokawa et al., 2021</xref>). In our work, when all edits were considered (i.e., including monoallelic edits detected only after amplicon sequencing), the beneficial effect of elevated temperature only held true for Mb3Cas12a. Temperature did not alter the number of edits achieved in our samples with either SpCas9 or SaCas9; what differed was the ratio of monoallelic to biallelic edits in SaCas9. Likewise, in a recent study, <xref ref-type="bibr" rid="B6">Banakar et al. (2022)</xref> found no significant temperature dependency on the activity of 6 different CRISPR-Cas ribonucleoproteins (RNP), including SpCas9, AsCas12a, and LbCas12a.</p>
<p>The low editing efficiency of AsCas12a in our results is consistent with three previous reports (<xref ref-type="bibr" rid="B29">Hu et al., 2017</xref>; <xref ref-type="bibr" rid="B38">Kim et al., 2017</xref>; <xref ref-type="bibr" rid="B5">Banakar et al., 2020</xref>): two of the reports failed to detect any activity in rice T<sub>0</sub> plants whereas the second one reported barely any AsCas12a-induced mutations in soybean protoplasts. In contrast, another study found AsCas12a has higher temperature sensitivity and lower nuclease activity than LbCas12a and FnCas12a under comparable conditions, but still achieved up to 93% editing frequency in T<sub>0</sub> rice mutant lines when tissue was selected at 32&#xb0;C (<xref ref-type="bibr" rid="B52">Malzahn et al., 2019</xref>).</p>
<p>Finally, despite having evaluated 289 events obtained with two different tracrRNAs &#x2013; none of the events recovered after St1Cas9 transformation were edited. This apparent null activity in our results for St1Cas9 sharply contrasts with previous studies conducted in Arabidopsis at 22&#xb0;C reporting successful gene editing with similar mutation frequencies as SpCas9 (<xref ref-type="bibr" rid="B76">Steinert et al., 2015</xref>; <xref ref-type="bibr" rid="B77">Steinert et al., 2017</xref>). At the same time, St1Cas9 has been used successfully for editing mammalian cells cultured at 37&#xb0;C (<xref ref-type="bibr" rid="B22">Esvelt et al., 2013</xref>; <xref ref-type="bibr" rid="B40">Kleinstiver et al., 2015</xref>). Thus, we can only hypothesize that the use of a non-ideal specific target site sequence could have negatively impacted St1Cas9 activity.</p>
<p>Of all the endonucleases studied here, <italic>S. pyogenes</italic> Cas9 (SpCas9) is the most robust and widely used Cas9 endonuclease (<xref ref-type="bibr" rid="B32">Jaganathan et al., 2018</xref>; <xref ref-type="bibr" rid="B15">Chen et al., 2019</xref>; <xref ref-type="bibr" rid="B21">El-Mounadi et al., 2020</xref>; <xref ref-type="bibr" rid="B60">Nidhi et al., 2021</xref>) and is also the most efficient in our tests in terms of mono- and biallelic edits. It is relatively temperature insensitive. In contrast, the proportion of biallelic editing increased with temperature for SaCas9 from <italic>Staphylococcus aureus.</italic> When Mb3Cas12a from <italic>M. bovoculi</italic> was used, total editing increased with temperature, but proportionally more biallelic editing was obtained at 37&#xb0;C. Collectively, these three endonucleases used at the proper temperature provide a measure of flexibility when the number of suitable PAM sites is limited, as can happen in complex plant genomes. At the same time, the widely different reports on the efficiency of any given endonuclease shows that a lot of the parameters for their efficient use are still not understood.</p>
</sec>
</body>
<back>
<sec sec-type="data-availability" id="s5">
<title>Data availability statement</title>
<p>The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/bioproject">https://www.ncbi.nlm.nih.gov/bioproject</ext-link>, PRJNA892053.</p>
</sec>
<sec id="s6">
<title>Author contributions</title>
<p>EI-B performed the experiments and wrote the manuscript. PL assembled the different plasmids. WP conceived the experiment and helped with experimental design and writing the manuscript. All authors have read and approved the final manuscript.</p>
</sec>
<sec id="s7">
<title>Funding</title>
<p>The Funding provided by The Center for Bioenergy Innovation a U.S. Department of Energy Research Center supported by the Office of Biological and Environmental Research in the DOE Office of Science.</p>
</sec>
<sec sec-type="COI-statement" id="s8">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec sec-type="disclaimer" id="s9">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s10">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fgeed.2023.1074641/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fgeed.2023.1074641/full&#x23;supplementary-material</ext-link>
</p>
<supplementary-material>
<label>Supplementary Figure S1</label>
<caption>
<p>Identification of protospacer sequences targeting the rice phytoene desaturase (OsPDS) gene using different Cas9/Cas12a variants. Schematic representation of the rice PDS gene with the mRNA and CDS sequences indicated as blue and yellow block arrows, respectively. Each triangle represents a protospacer sequence. Each specific target site sequence is colored according to their activity (on-target) or specificity (off-target) score. The annotation for the activity score is a gradient from red to green with lower values in red and higher values green. The change of coloring for the off-target score ranges from red (indicating lower specificity) to green (high specificity or fewer off-target sites). Black indicates that the algorithm available in Geneious (<ext-link ext-link-type="uri" xlink:href="https://www.geneious.com">https://www.geneious.com</ext-link>) cannot predict the activity scores for that specific Cas variant. Selected guide RNA sequences are highlighted by pink color boxes.</p>
</caption>
</supplementary-material>
<supplementary-material>
<label>Supplementary Table S1</label>
<caption>
<p>Relevant sequences used in this study.</p>
</caption>
</supplementary-material>
<supplementary-material>
<label>Supplementary Table S2</label>
<caption>
<p>List of oligonucleotides used in this study.</p>
</caption>
</supplementary-material>
<supplementary-material>
<label>Supplementary Table S3</label>
<caption>
<p>Molecular verification of editing from all newly formed hygromycin-resistant events.</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="Table2.XLSX" id="SM1" mimetype="application/XLSX" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table3.XLSX" id="SM2" mimetype="application/XLSX" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Image1.TIF" id="SM3" mimetype="application/TIF" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table1.XLSX" id="SM4" mimetype="application/XLSX" xmlns:xlink="http://www.w3.org/1999/xlink"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ahmad</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Tang</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Shahzad</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Mawia</surname>
<given-names>A. M.</given-names>
</name>
<name>
<surname>Rao</surname>
<given-names>G. S.</given-names>
</name>
<name>
<surname>Jamil</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>CRISPR-based crop improvements: A way forward to achieve zero hunger</article-title>. <source>J. Agric. Food Chem.</source> <volume>69</volume>, <fpage>8307</fpage>&#x2013;<lpage>8323</lpage>. <pub-id pub-id-type="doi">10.1021/acs.jafc.1c02653</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Angelos</surname>
<given-names>J. A.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>
<italic>Moraxella bovoculi</italic> and infectious bovine keratoconjunctivitis: Cause or coincidence?</article-title> <source>Veterinary Clin. N. Am. Food Animal Pract.</source> <volume>26</volume>, <fpage>73</fpage>&#x2013;<lpage>78</lpage>. <pub-id pub-id-type="doi">10.1016/j.cvfa.2009.10.002</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Armstrong</surname>
<given-names>C. L.</given-names>
</name>
<name>
<surname>Green</surname>
<given-names>C. E.</given-names>
</name>
</person-group> (<year>1985</year>). <article-title>Establishment and maintenance of friable, embryogenic maize callus and the involvement of L-proline</article-title>. <source>Planta</source> <volume>164</volume>, <fpage>207</fpage>&#x2013;<lpage>214</lpage>. <pub-id pub-id-type="doi">10.1007/BF00396083</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Banakar</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Schubert</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Collingwood</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Vakulskas</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Eggenberger</surname>
<given-names>A. L.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>K.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Comparison of CRISPR-Cas9/Cas12a ribonucleoprotein complexes for genome editing efficiency in the rice phytoene desaturase (<italic>OsPDS</italic>) Gene</article-title>. <source>Rice</source> <volume>13</volume>, <fpage>4</fpage>. <pub-id pub-id-type="doi">10.1186/s12284-019-0365-z</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Banakar</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Schubert</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Kurgan</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Rai</surname>
<given-names>K. M.</given-names>
</name>
<name>
<surname>Beaudoin</surname>
<given-names>S. F.</given-names>
</name>
<name>
<surname>Collingwood</surname>
<given-names>M. A.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>Efficiency, specificity and temperature sensitivity of Cas9 and Cas12a RNPs for DNA-free genome editing in plants</article-title>. <source>Front. Genome Ed.</source> <volume>3</volume>, <fpage>760820</fpage>. <pub-id pub-id-type="doi">10.3389/fgeed.2021.760820</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>B&#xe1;nfalvi</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Cs&#xe1;kv&#xe1;ri</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Vill&#xe1;nyi</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Kondr&#xe1;k</surname>
<given-names>M.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Generation of transgene-free PDS mutants in potato by <italic>Agrobacterium</italic>-mediated transformation</article-title>. <source>BMC Biotechnol.</source> <volume>20</volume>, <fpage>25</fpage>. <pub-id pub-id-type="doi">10.1186/s12896-020-00621-2</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Blomme</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Develtere</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>K&#xf6;se</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Arraiza Ribera</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Brugmans</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Jaraba-Wallace</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>The heat is on: A simple method to increase genome editing efficiency in plants</article-title>. <source>BMC Plant Biol.</source> <volume>22</volume>, <fpage>142</fpage>. <pub-id pub-id-type="doi">10.1186/s12870-022-03519-7</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bortesi</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Zischewski</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Perez</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Bassi&#xe9;</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Nadi</surname>
<given-names>R.</given-names>
</name>
<etal/>
</person-group> (<year>2016</year>). <article-title>Patterns of CRISPR/Cas9 activity in plants, animals and microbes</article-title>. <source>Plant Biotechnol. J.</source> <volume>14</volume>, <fpage>2203</fpage>&#x2013;<lpage>2216</lpage>. <pub-id pub-id-type="doi">10.1111/pbi.12634</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Briner</surname>
<given-names>A. E.</given-names>
</name>
<name>
<surname>Donohoue</surname>
<given-names>P. D.</given-names>
</name>
<name>
<surname>Gomaa</surname>
<given-names>A. A.</given-names>
</name>
<name>
<surname>Selle</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Slorach</surname>
<given-names>E. M.</given-names>
</name>
<name>
<surname>Nye</surname>
<given-names>C. H.</given-names>
</name>
<etal/>
</person-group> (<year>2014</year>). <article-title>Guide RNA functional modules direct Cas9 activity and orthogonality</article-title>. <source>Mol. Cell</source> <volume>56</volume>, <fpage>333</fpage>&#x2013;<lpage>339</lpage>. <pub-id pub-id-type="doi">10.1016/j.molcel.2014.09.019</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cai</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Sun</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>B.</given-names>
</name>
<etal/>
</person-group> (<year>2015</year>). <article-title>CRISPR/Cas9-mediated genome editing in soybean hairy roots</article-title>. <source>PLoS One</source> <volume>10</volume>, <fpage>e0136064</fpage>. <pub-id pub-id-type="doi">10.1371/journal.pone.0136064</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Campbell</surname>
<given-names>B. W.</given-names>
</name>
<name>
<surname>Hoyle</surname>
<given-names>J. W.</given-names>
</name>
<name>
<surname>Bucciarelli</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Stec</surname>
<given-names>A. O.</given-names>
</name>
<name>
<surname>Samac</surname>
<given-names>D. A.</given-names>
</name>
<name>
<surname>Parrott</surname>
<given-names>W. A.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Functional analysis and development of a CRISPR/Cas9 allelic series for a CPR5 ortholog necessary for proper growth of soybean trichomes</article-title>. <source>Sci. Rep.</source> <volume>9</volume>, <fpage>14757</fpage>. <pub-id pub-id-type="doi">10.1038/s41598-019-51240-7</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chang</surname>
<given-names>Y. J.</given-names>
</name>
<name>
<surname>Pukall</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Saunders</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Lapidus</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Copeland</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Nolan</surname>
<given-names>M.</given-names>
</name>
<etal/>
</person-group> (<year>2010</year>). <article-title>Complete genome sequence of <italic>Acidaminococcus fermentans</italic> type strain (VR4)</article-title>. <source>Stand. Genomic Sci.</source> <volume>3</volume>, <fpage>1</fpage>&#x2013;<lpage>14</lpage>. <pub-id pub-id-type="doi">10.4056/sigs.1002553</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chari</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Yeo</surname>
<given-names>N. C.</given-names>
</name>
<name>
<surname>Chavez</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Church</surname>
<given-names>G. M.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>sgRNA Scorer 2.0: a species-independent model to predict CRISPR/Cas9 activity</article-title>. <source>ACS Synth. Biol.</source> <volume>6</volume>, <fpage>902</fpage>&#x2013;<lpage>904</lpage>. <pub-id pub-id-type="doi">10.1021/acssynbio.6b00343</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>C.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>CRISPR/Cas genome editing and precision plant breeding in agriculture</article-title>. <source>Annu. Rev. Plant Biol.</source> <volume>70</volume>, <fpage>667</fpage>&#x2013;<lpage>697</lpage>. <pub-id pub-id-type="doi">10.1146/annurev-arplant-050718-100049</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Beachy</surname>
<given-names>R. N.</given-names>
</name>
<name>
<surname>Fauquet</surname>
<given-names>C. M.</given-names>
</name>
</person-group> (<year>1998</year>). <article-title>A protocol for consistent, large-scale production of fertile transgenic rice plants</article-title>. <source>Plant Cell Rep.</source> <volume>18</volume>, <fpage>25</fpage>&#x2013;<lpage>31</lpage>. <pub-id pub-id-type="doi">10.1007/s002990050526</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Johnson</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Jeraldo</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Chia</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Kocher</surname>
<given-names>J.-P. A.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Hybrid-denovo: A de novo OTU-picking pipeline integrating single-end and paired-end 16S sequence tags</article-title>. <source>GigaScience</source> <volume>7</volume>, <fpage>1</fpage>&#x2013;<lpage>7</lpage>. <pub-id pub-id-type="doi">10.1093/gigascience/gix129</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Collias</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Beisel</surname>
<given-names>C. L.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>CRISPR technologies and the search for the PAM-free nuclease</article-title>. <source>Nat. Commun.</source> <volume>12</volume>, <fpage>555</fpage>. <pub-id pub-id-type="doi">10.1038/s41467-020-20633-y</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Corsi</surname>
<given-names>G. I.</given-names>
</name>
<name>
<surname>Qu</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Alkan</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Pan</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Luo</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Gorodkin</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>CRISPR/Cas9 gRNA activity depends on free energy changes and on the target PAM context</article-title>. <source>Nat. Commun.</source> <volume>13</volume>, <fpage>3006</fpage>. <pub-id pub-id-type="doi">10.1038/s41467-022-30515-0</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Doench</surname>
<given-names>J. G.</given-names>
</name>
<name>
<surname>Fusi</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Sullender</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Hegde</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Vaimberg</surname>
<given-names>E. W.</given-names>
</name>
<name>
<surname>Donovan</surname>
<given-names>K. F.</given-names>
</name>
<etal/>
</person-group> (<year>2016</year>). <article-title>Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9</article-title>. <source>Nat. Biotechnol.</source> <volume>34</volume>, <fpage>184</fpage>&#x2013;<lpage>191</lpage>. <pub-id pub-id-type="doi">10.1038/nbt.3437</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>El-Mounadi</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Morales-Floriano</surname>
<given-names>M. L.</given-names>
</name>
<name>
<surname>Garcia-Ruiz</surname>
<given-names>H.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Principles, applications, and biosafety of plant genome editing using CRISPR-Cas9</article-title>. <source>Front. Plant Sci.</source> <volume>11</volume>, <fpage>56</fpage>. <pub-id pub-id-type="doi">10.3389/fpls.2020.00056</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Esvelt</surname>
<given-names>K. M.</given-names>
</name>
<name>
<surname>Mali</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Braff</surname>
<given-names>J. L.</given-names>
</name>
<name>
<surname>Moosburner</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Yaung</surname>
<given-names>S. J.</given-names>
</name>
<name>
<surname>Church</surname>
<given-names>G. M.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Orthogonal Cas9 proteins for RNA-guided gene regulation and editing</article-title>. <source>Nat. Methods</source> <volume>10</volume>, <fpage>1116</fpage>&#x2013;<lpage>1121</lpage>. <pub-id pub-id-type="doi">10.1038/nmeth.2681</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Feng</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Ding</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>D.-L.</given-names>
</name>
<name>
<surname>Wei</surname>
<given-names>P.</given-names>
</name>
<etal/>
</person-group> (<year>2013</year>). <article-title>Efficient genome editing in plants using a CRISPR/Cas system</article-title>. <source>Cell Res.</source> <volume>23</volume>, <fpage>1229</fpage>&#x2013;<lpage>1232</lpage>. <pub-id pub-id-type="doi">10.1038/cr.2013.114</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gasiunas</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Young</surname>
<given-names>J. K.</given-names>
</name>
<name>
<surname>Karvelis</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Kazlauskas</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Urbaitis</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Jasnauskaite</surname>
<given-names>M.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>A catalogue of biochemically diverse CRISPR-Cas9 orthologs</article-title>. <source>Nat. Commun.</source> <volume>11</volume>, <fpage>5512</fpage>. <pub-id pub-id-type="doi">10.1038/s41467-020-19344-1</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Gera</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>McIver</surname>
<given-names>K. S.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Laboratory growth and maintenance of <italic>Streptococcus pyogenes</italic> (the Group A Streptococcus, GAS)</article-title>. <source>Curr. Protoc. Microbiol</source> <volume>30</volume>, <fpage>9D.2.1</fpage>&#x2013;<lpage>9D.2.13</lpage>. <pub-id pub-id-type="doi">10.1002/9780471729259.mc09d02s3</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Graham</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Patil</surname>
<given-names>G. B.</given-names>
</name>
<name>
<surname>Bubeck</surname>
<given-names>D. M.</given-names>
</name>
<name>
<surname>Dobert</surname>
<given-names>R. C.</given-names>
</name>
<name>
<surname>Glenn</surname>
<given-names>K. C.</given-names>
</name>
<name>
<surname>Gutsche</surname>
<given-names>A. T.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Plant genome editing and the relevance of off-target changes</article-title>. <source>Plant Physiol.</source> <volume>183</volume>, <fpage>1453</fpage>&#x2013;<lpage>1471</lpage>. <pub-id pub-id-type="doi">10.1104/pp.19.01194</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Harnett</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Davey</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Patrick</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Caddick</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Pearce</surname>
<given-names>L.</given-names>
</name>
</person-group> (<year>2011</year>). &#x201c;<article-title>Lactic acid bacteria &#x7c; Streptococcus thermophilus</article-title>,&#x201d; in <source>Encyclopedia of dairy sciences (Second Edition)</source>. Editor <person-group person-group-type="editor">
<name>
<surname>Fuquay</surname>
<given-names>J. W.</given-names>
</name>
</person-group> (<publisher-loc>San Diego</publisher-loc>: <publisher-name>Academic Press</publisher-name>), <fpage>143</fpage>&#x2013;<lpage>148</lpage>. <pub-id pub-id-type="doi">10.1016/B978-0-12-374407-4.00268-5</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hassan</surname>
<given-names>M. M.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Yuan</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>De</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>J.-G.</given-names>
</name>
<name>
<surname>Muchero</surname>
<given-names>W.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Construct design for CRISPR/Cas-based genome editing in plants</article-title>. <source>Trends Plant Sci.</source> <volume>26</volume>, <fpage>1133</fpage>&#x2013;<lpage>1152</lpage>. <pub-id pub-id-type="doi">10.1016/j.tplants.2021.06.015</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hooghvorst</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>L&#xf3;pez-Cristoffanini</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Nogu&#xe9;s</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Efficient knockout of phytoene desaturase gene using CRISPR/Cas9 in melon</article-title>. <source>Sci. Rep.</source> <volume>9</volume>, <fpage>17077</fpage>. <pub-id pub-id-type="doi">10.1038/s41598-019-53710-4</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hu</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Fu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>K.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Targeted mutagenesis in rice using CRISPR-Cpf1 system</article-title>. <source>J. Genet. Genomics</source> <volume>44</volume>, <fpage>71</fpage>&#x2013;<lpage>73</lpage>. <pub-id pub-id-type="doi">10.1016/j.jgg.2016.12.001</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Hudson</surname>
<given-names>J. A.</given-names>
</name>
</person-group> (<year>2014</year>). &#x201c;<article-title>Microbiological safety of meat &#x7c; <italic>Staphylococcus aureus</italic>
</article-title>,&#x201d; in <source>Encyclopedia of meat sciences (Second Edition)</source>. Editors <person-group person-group-type="editor">
<name>
<surname>Dikeman</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Devine</surname>
<given-names>C.</given-names>
</name>
</person-group> (<publisher-loc>Oxford</publisher-loc>: <publisher-name>Academic Press</publisher-name>), <fpage>376</fpage>&#x2013;<lpage>381</lpage>. <pub-id pub-id-type="doi">10.1016/B978-0-12-384731-7.00041-6</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jacobsen</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Ttofali</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Liao</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Manchalu</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Gray</surname>
<given-names>B. N.</given-names>
</name>
<name>
<surname>Beisel</surname>
<given-names>C. L.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Characterization of Cas12a nucleases reveals diverse PAM profiles between closely-related orthologs</article-title>. <source>Nucleic Acids Res.</source> <volume>48</volume>, <fpage>5624</fpage>&#x2013;<lpage>5638</lpage>. <pub-id pub-id-type="doi">10.1093/nar/gkaa272</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jaganathan</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Ramasamy</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Sellamuthu</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Jayabalan</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Venkataraman</surname>
<given-names>G.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>CRISPR for crop improvement: An update review</article-title>. <source>Front. Plant Sci.</source> <volume>9</volume>, <fpage>985</fpage>. <pub-id pub-id-type="doi">10.3389/fpls.2018.00985</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Jain</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Bhar</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Das</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2021</year>). &#x201c;<article-title>Improving biotic and abiotic stress tolerance in plants: A CRISPR-cas awpproach</article-title>,&#x201d; in <source>Genome engineering for crop improvement</source>. Editors <person-group person-group-type="editor">
<name>
<surname>Sarmah</surname>
<given-names>B. K.</given-names>
</name>
<name>
<surname>Borah</surname>
<given-names>B. K.</given-names>
</name>
</person-group> (<publisher-loc>Cham</publisher-loc>: <publisher-name>Springer International Publishing</publisher-name>), <fpage>217</fpage>&#x2013;<lpage>237</lpage>. <pub-id pub-id-type="doi">10.1007/978-3-030-63372-1_9</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jinek</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Chylinski</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Fonfara</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Hauer</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Doudna</surname>
<given-names>J. A.</given-names>
</name>
<name>
<surname>Charpentier</surname>
<given-names>E.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity</article-title>. <source>Science</source> <volume>337</volume>, <fpage>816</fpage>&#x2013;<lpage>821</lpage>. <pub-id pub-id-type="doi">10.1126/science.1225829</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jordan</surname>
<given-names>W. T.</given-names>
</name>
<name>
<surname>Currie</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Schmitz</surname>
<given-names>R. J.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Multiplex genome editing in <italic>Arabidopsis thaliana</italic> using Mb3Cas12a</article-title>. <source>Plant Direct</source> <volume>5</volume>, <fpage>e344</fpage>. <pub-id pub-id-type="doi">10.1002/pld3.344</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kaur</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Alok</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>ShivaniKaur</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Pandey</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Awasthi</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Tiwari</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>CRISPR/Cas9-mediated efficient editing in phytoene desaturase (PDS) demonstrates precise manipulation in banana cv. Rasthali genome</article-title>. <source>Funct. Integr. Genomics</source> <volume>18</volume>, <fpage>89</fpage>&#x2013;<lpage>99</lpage>. <pub-id pub-id-type="doi">10.1007/s10142-017-0577-5</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kawahara</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>De La Bastide</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Hamilton</surname>
<given-names>J. P.</given-names>
</name>
<name>
<surname>Kanamori</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Mccombie</surname>
<given-names>W. R.</given-names>
</name>
<name>
<surname>Ouyang</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2013</year>). <article-title>Improvement of the <italic>Oryza sativa</italic> Nipponbare reference genome using next generation sequence and optical map data</article-title>. <source>Rice</source> <volume>6</volume>, <fpage>4</fpage>. <pub-id pub-id-type="doi">10.1186/1939-8433-6-4</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kim</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>S.-T.</given-names>
</name>
<name>
<surname>Ryu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Kang</surname>
<given-names>B.-C.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>J.-S.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>S.-G.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>CRISPR/Cpf1-mediated DNA-free plant genome editing</article-title>. <source>Nat. Commun.</source> <volume>8</volume>, <fpage>14406</fpage>. <pub-id pub-id-type="doi">10.1038/ncomms14406</pub-id>
</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kim</surname>
<given-names>H. K.</given-names>
</name>
<name>
<surname>Min</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Song</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Jung</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Choi</surname>
<given-names>J. W.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>Y.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Deep learning improves prediction of CRISPR&#x2013;Cpf1 guide RNA activity</article-title>. <source>Nat. Biotechnol.</source> <volume>36</volume>, <fpage>239</fpage>&#x2013;<lpage>241</lpage>. <pub-id pub-id-type="doi">10.1038/nbt.4061</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kleinstiver</surname>
<given-names>B. P.</given-names>
</name>
<name>
<surname>Prew</surname>
<given-names>M. S.</given-names>
</name>
<name>
<surname>Tsai</surname>
<given-names>S. Q.</given-names>
</name>
<name>
<surname>Topkar</surname>
<given-names>V. V.</given-names>
</name>
<name>
<surname>Nguyen</surname>
<given-names>N. T.</given-names>
</name>
<name>
<surname>Zheng</surname>
<given-names>Z.</given-names>
</name>
<etal/>
</person-group> (<year>2015</year>). <article-title>Engineered CRISPR-Cas9 nucleases with altered PAM specificities</article-title>. <source>Nature</source> <volume>523</volume>, <fpage>481</fpage>&#x2013;<lpage>485</lpage>. <pub-id pub-id-type="doi">10.1038/nature14592</pub-id>
</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ku</surname>
<given-names>H.-K.</given-names>
</name>
<name>
<surname>Ha</surname>
<given-names>S.-H.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Improving nutritional and functional quality by genome editing of crops: Status and perspectives</article-title>. <source>Front. Plant Sci.</source> <volume>11</volume>, <fpage>577313</fpage>. <pub-id pub-id-type="doi">10.3389/fpls.2020.577313</pub-id>
</citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kurokawa</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Rahman</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Yamanaka</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Ishizaki</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Islam</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Aiso</surname>
<given-names>T.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>A simple heat treatment increases SpCas9-mediated mutation efficiency in arabidopsis</article-title>. <source>Plant Cell Physiol</source> <volume>62</volume>, <fpage>1676</fpage>&#x2013;<lpage>1686</lpage>. <pub-id pub-id-type="doi">10.1093/pcp/pcab123</pub-id>
</citation>
</ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Labuhn</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Adams</surname>
<given-names>F. F.</given-names>
</name>
<name>
<surname>Ng</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Knoess</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Schambach</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Charpentier</surname>
<given-names>E. M.</given-names>
</name>
<etal/>
</person-group> (<year>2017</year>). <article-title>Refined sgRNA efficacy prediction improves large- and small-scale CRISPR&#x2013;Cas9 applications</article-title>. <source>Nucleic Acids Res.</source> <volume>46</volume>, <fpage>1375</fpage>&#x2013;<lpage>1385</lpage>. <pub-id pub-id-type="doi">10.1093/nar/gkx1268</pub-id>
</citation>
</ref>
<ref id="B44">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Labun</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Montague</surname>
<given-names>T. G.</given-names>
</name>
<name>
<surname>Krause</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Torres Cleuren</surname>
<given-names>Y. N.</given-names>
</name>
<name>
<surname>Tjeldnes</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Valen</surname>
<given-names>E.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>CHOPCHOP v3: Expanding the CRISPR web toolbox beyond genome editing</article-title>. <source>Nucleic Acids Res.</source> <volume>47</volume>, <fpage>W171</fpage>&#x2013;<lpage>W174</lpage>. <pub-id pub-id-type="doi">10.1093/nar/gkz365</pub-id>
</citation>
</ref>
<ref id="B45">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Leblanc</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Mendez</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Lozano</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Chatpar</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Irish</surname>
<given-names>V. F.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Increased efficiency of targeted mutagenesis by CRISPR/Cas9 in plants using heat stress</article-title>. <source>Plant J.</source> <volume>93</volume>, <fpage>377</fpage>&#x2013;<lpage>386</lpage>. <pub-id pub-id-type="doi">10.1111/tpj.13782</pub-id>
</citation>
</ref>
<ref id="B46">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>J.-F.</given-names>
</name>
<name>
<surname>Norville</surname>
<given-names>J. E.</given-names>
</name>
<name>
<surname>Aach</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Mccormack</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Bush</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2013</year>). <article-title>Multiplex and homologous recombination&#x2013;mediated genome editing in <italic>Arabidopsis</italic> and <italic>Nicotiana benthamiana</italic> using guide RNA and Cas9</article-title>. <source>Nat. Biotechnol.</source> <volume>31</volume>, <fpage>688</fpage>&#x2013;<lpage>691</lpage>. <pub-id pub-id-type="doi">10.1038/nbt.2654</pub-id>
</citation>
</ref>
<ref id="B47">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Listgarten</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Weinstein</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Kleinstiver</surname>
<given-names>B. P.</given-names>
</name>
<name>
<surname>Sousa</surname>
<given-names>A. A.</given-names>
</name>
<name>
<surname>Joung</surname>
<given-names>J. K.</given-names>
</name>
<name>
<surname>Crawford</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Prediction of off-target activities for the end-to-end design of CRISPR guide RNAs</article-title>. <source>Nat. Biomed. Eng.</source> <volume>2</volume>, <fpage>38</fpage>&#x2013;<lpage>47</lpage>. <pub-id pub-id-type="doi">10.1038/s41551-017-0178-6</pub-id>
</citation>
</ref>
<ref id="B48">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Ding</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Jin</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Xie</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>L.-L.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>CRISPR-P 2.0: An improved CRISPR-cas9 tool for genome editing in plants</article-title>. <source>Mol. Plant</source> <volume>10</volume>, <fpage>530</fpage>&#x2013;<lpage>532</lpage>. <pub-id pub-id-type="doi">10.1016/j.molp.2017.01.003</pub-id>
</citation>
</ref>
<ref id="B49">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Rahman</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Islam</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Application of CRISPR/Cas9 in crop quality improvement</article-title>. <source>Int. J. Mol. Sci.</source> <volume>22</volume>, <fpage>4206</fpage>. <pub-id pub-id-type="doi">10.3390/ijms22084206</pub-id>
</citation>
</ref>
<ref id="B50">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lu</surname>
<given-names>Q. S. M.</given-names>
</name>
<name>
<surname>Tian</surname>
<given-names>L.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>An efficient and specific CRISPR-Cas9 genome editing system targeting soybean phytoene desaturase genes</article-title>. <source>BMC Biotechnol.</source> <volume>22</volume>, <fpage>7</fpage>. <pub-id pub-id-type="doi">10.1186/s12896-022-00737-7</pub-id>
</citation>
</ref>
<ref id="B51">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Makarova</surname>
<given-names>K. S.</given-names>
</name>
<name>
<surname>Wolf</surname>
<given-names>Y. I.</given-names>
</name>
<name>
<surname>Iranzo</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Shmakov</surname>
<given-names>S. A.</given-names>
</name>
<name>
<surname>Alkhnbashi</surname>
<given-names>O. S.</given-names>
</name>
<name>
<surname>Brouns</surname>
<given-names>S. J. J.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Evolutionary classification of CRISPR&#x2013;cas systems: A burst of class 2 and derived variants</article-title>. <source>Nat. Rev. Microbiol.</source> <volume>18</volume>, <fpage>67</fpage>&#x2013;<lpage>83</lpage>. <pub-id pub-id-type="doi">10.1038/s41579-019-0299-x</pub-id>
</citation>
</ref>
<ref id="B52">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Malzahn</surname>
<given-names>A. A.</given-names>
</name>
<name>
<surname>Tang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Ren</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Sretenovic</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Y.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Application of CRISPR-Cas12a temperature sensitivity for improved genome editing in rice, maize, and Arabidopsis</article-title>. <source>BMC Biol.</source> <volume>17</volume>, <fpage>9</fpage>. <pub-id pub-id-type="doi">10.1186/s12915-019-0629-5</pub-id>
</citation>
</ref>
<ref id="B53">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mann</surname>
<given-names>D. G. J.</given-names>
</name>
<name>
<surname>Lafayette</surname>
<given-names>P. R.</given-names>
</name>
<name>
<surname>Abercrombie</surname>
<given-names>L. L.</given-names>
</name>
<name>
<surname>King</surname>
<given-names>Z. R.</given-names>
</name>
<name>
<surname>Mazarei</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Halter</surname>
<given-names>M. C.</given-names>
</name>
<etal/>
</person-group> (<year>2012</year>). <article-title>Gateway-compatible vectors for high-throughput gene functional analysis in switchgrass (<italic>Panicum virgatum</italic> L.) and other monocot species</article-title>. <source>Plant Biotechnol. J.</source> <volume>10</volume>, <fpage>226</fpage>&#x2013;<lpage>236</lpage>. <pub-id pub-id-type="doi">10.1111/j.1467-7652.2011.00658.x</pub-id>
</citation>
</ref>
<ref id="B54">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Marshall</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Maxwell</surname>
<given-names>C. S.</given-names>
</name>
<name>
<surname>Collins</surname>
<given-names>S. P.</given-names>
</name>
<name>
<surname>Jacobsen</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Luo</surname>
<given-names>M. L.</given-names>
</name>
<name>
<surname>Begemann</surname>
<given-names>M. B.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Rapid and scalable characterization of CRISPR Technologies using an <italic>E. coli</italic> cell-free transcription-translation system</article-title>. <source>Mol. Cell</source> <volume>69</volume>, <fpage>146</fpage>&#x2013;<lpage>157</lpage>. <pub-id pub-id-type="doi">10.1016/j.molcel.2017.12.007</pub-id>
</citation>
</ref>
<ref id="B55">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Martin</surname>
<given-names>M.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Cutadapt removes adapter sequences from high-throughput sequencing reads</article-title>. <source>EMBnet.J.</source> <volume>17</volume>, <fpage>10</fpage>. <pub-id pub-id-type="doi">10.14806/ej.17.1.200</pub-id>
</citation>
</ref>
<ref id="B56">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Milner</surname>
<given-names>M. J.</given-names>
</name>
<name>
<surname>Craze</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Hope</surname>
<given-names>M. S.</given-names>
</name>
<name>
<surname>Wallington</surname>
<given-names>E. J.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Turning up the temperature on CRISPR: Increased temperature can improve the editing efficiency of wheat using CRISPR/Cas9</article-title>. <source>Front. Plant Sci.</source> <volume>11</volume>, <fpage>583374</fpage>. <pub-id pub-id-type="doi">10.3389/fpls.2020.583374</pub-id>
</citation>
</ref>
<ref id="B57">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Modrzejewski</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Hartung</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Sprink</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Krause</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Kohl</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Wilhelm</surname>
<given-names>R.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>What is the available evidence for the range of applications of genome-editing as a new tool for plant trait modification and the potential occurrence of associated off-target effects: A systematic map</article-title>. <source>Environ. Evid.</source> <volume>8</volume>, <fpage>27</fpage>. <pub-id pub-id-type="doi">10.1186/s13750-019-0171-5</pub-id>
</citation>
</ref>
<ref id="B58">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Moreno-Mateos</surname>
<given-names>M. A.</given-names>
</name>
<name>
<surname>Fernandez</surname>
<given-names>J. P.</given-names>
</name>
<name>
<surname>Rouet</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Vejnar</surname>
<given-names>C. E.</given-names>
</name>
<name>
<surname>Lane</surname>
<given-names>M. A.</given-names>
</name>
<name>
<surname>Mis</surname>
<given-names>E.</given-names>
</name>
<etal/>
</person-group> (<year>2017</year>). <article-title>CRISPR-Cpf1 mediates efficient homology-directed repair and temperature-controlled genome editing</article-title>. <source>Nat. Commun.</source> <volume>8</volume>, <fpage>2024</fpage>. <pub-id pub-id-type="doi">10.1038/s41467-017-01836-2</pub-id>
</citation>
</ref>
<ref id="B59">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nakajima</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Ban</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Azuma</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Onoue</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Moriguchi</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Yamamoto</surname>
<given-names>T.</given-names>
</name>
<etal/>
</person-group> (<year>2017</year>). <article-title>CRISPR/Cas9-mediated targeted mutagenesis in grape</article-title>. <source>PLoS One</source> <volume>12</volume>, <fpage>e0177966</fpage>. <pub-id pub-id-type="doi">10.1371/journal.pone.0177966</pub-id>
</citation>
</ref>
<ref id="B60">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nidhi</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Anand</surname>
<given-names>U.</given-names>
</name>
<name>
<surname>Oleksak</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Tripathi</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Lal</surname>
<given-names>J. A.</given-names>
</name>
<name>
<surname>Thomas</surname>
<given-names>G.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Novel CRISPR&#x2013;cas systems: An updated review of the current achievements, applications, and future research perspectives</article-title>. <source>Int. J. Mol. Sci.</source> <volume>22</volume>, <fpage>3327</fpage>. <pub-id pub-id-type="doi">10.3390/ijms22073327</pub-id>
</citation>
</ref>
<ref id="B61">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nishitani</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Hirai</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Komori</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Wada</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Okada</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Osakabe</surname>
<given-names>K.</given-names>
</name>
<etal/>
</person-group> (<year>2016</year>). <article-title>Efficient genome editing in apple using a CRISPR/Cas9 system</article-title>. <source>Sci. Rep.</source> <volume>6</volume>, <fpage>31481</fpage>. <pub-id pub-id-type="doi">10.1038/srep31481</pub-id>
</citation>
</ref>
<ref id="B62">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Odipio</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Alicai</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Ingelbrecht</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Nusinow</surname>
<given-names>D. A.</given-names>
</name>
<name>
<surname>Bart</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Taylor</surname>
<given-names>N. J.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Efficient CRISPR/Cas9 genome editing of phytoene desaturase in cassava</article-title>. <source>Front. Plant Sci.</source> <volume>8</volume>, <fpage>1780</fpage>. <pub-id pub-id-type="doi">10.3389/fpls.2017.01780</pub-id>
</citation>
</ref>
<ref id="B63">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Osakabe</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Osakabe</surname>
<given-names>K.</given-names>
</name>
</person-group> (<year>2017</year>). &#x201c;<article-title>Chapter Six - genome editing to improve abiotic stress responses in plants</article-title>,&#x201d; in <source>Progress in molecular biology and translational science</source>. Editors <person-group person-group-type="editor">
<name>
<surname>Weeks</surname>
<given-names>D. P.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>B.</given-names>
</name>
</person-group> (<publisher-name>Academic Press</publisher-name>), <fpage>99</fpage>&#x2013;<lpage>109</lpage>. <pub-id pub-id-type="doi">10.1016/bs.pmbts.2017.03.007</pub-id>
</citation>
</ref>
<ref id="B64">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pan</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Ye</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Qin</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2016</year>). <article-title>CRISPR/Cas9-mediated efficient and heritable targeted mutagenesis in tomato plants in the first and later generations</article-title>. <source>Sci. Rep.</source> <volume>6</volume>, <fpage>24765</fpage>. <pub-id pub-id-type="doi">10.1038/srep24765</pub-id>
</citation>
</ref>
<ref id="B65">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Phan</surname>
<given-names>B. H.</given-names>
</name>
<name>
<surname>Jin</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Topp</surname>
<given-names>C. N.</given-names>
</name>
<name>
<surname>Zhong</surname>
<given-names>C. X.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Dawe</surname>
<given-names>R. K.</given-names>
</name>
<etal/>
</person-group> (<year>2007</year>). <article-title>Transformation of rice with long DNA-segments consisting of random genomic DNA or centromere-specific DNA</article-title>. <source>Transgenic Res.</source> <volume>16</volume>, <fpage>341</fpage>&#x2013;<lpage>351</lpage>. <pub-id pub-id-type="doi">10.1007/s11248-006-9041-3</pub-id>
</citation>
</ref>
<ref id="B66">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Poddar</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Tanaka</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Cate</surname>
<given-names>J. H. D.</given-names>
</name>
<name>
<surname>Staskawicz</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Cho</surname>
<given-names>M.-J.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Efficient isolation of protoplasts from rice calli with pause points and its application in transient gene expression and genome editing assays</article-title>. <source>Plant Methods</source> <volume>16</volume>, <fpage>151</fpage>. <pub-id pub-id-type="doi">10.1186/s13007-020-00692-4</pub-id>
</citation>
</ref>
<ref id="B67">
<citation citation-type="book">
<collab>R Core Team</collab> (<year>2022</year>). <source>R: A language and environment for statistical computing</source>. <publisher-loc>Vienna, Austria</publisher-loc>: <publisher-name>R Foundation for Statistical Computing</publisher-name>.</citation>
</ref>
<ref id="B68">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ramakodi</surname>
<given-names>M. P.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>A comprehensive evaluation of single-end sequencing data analyses for environmental microbiome research</article-title>. <source>Arch. Microbiol.</source> <volume>203</volume>, <fpage>6295</fpage>&#x2013;<lpage>6302</lpage>. <pub-id pub-id-type="doi">10.1007/s00203-021-02597-9</pub-id>
</citation>
</ref>
<ref id="B69">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Reed</surname>
<given-names>K. M.</given-names>
</name>
<name>
<surname>Bargmann</surname>
<given-names>B. O. R.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Protoplast regeneration and its use in new plant breeding technologies</article-title>. <source>Front. Genome Ed.</source> <volume>3</volume>, <fpage>734951</fpage>. <pub-id pub-id-type="doi">10.3389/fgeed.2021.734951</pub-id>
</citation>
</ref>
<ref id="B70">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ricroch</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Clairand</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Harwood</surname>
<given-names>W.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Use of CRISPR systems in plant genome editing: Toward new opportunities in agriculture</article-title>. <source>Emerg. Top. Life Sci.</source> <volume>1</volume>, <fpage>169</fpage>&#x2013;<lpage>182</lpage>. <pub-id pub-id-type="doi">10.1042/etls20170085</pub-id>
</citation>
</ref>
<ref id="B71">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Riesenberg</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Helmbrecht</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Kanis</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Maricic</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>P&#xe4;&#xe4;bo</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Improved gRNA secondary structures allow editing of target sites resistant to CRISPR-Cas9 cleavage</article-title>. <source>Nat. Commun.</source> <volume>13</volume>, <fpage>489</fpage>. <pub-id pub-id-type="doi">10.1038/s41467-022-28137-7</pub-id>
</citation>
</ref>
<ref id="B72">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sanson</surname>
<given-names>K. R.</given-names>
</name>
<name>
<surname>Hanna</surname>
<given-names>R. E.</given-names>
</name>
<name>
<surname>Hegde</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Donovan</surname>
<given-names>K. F.</given-names>
</name>
<name>
<surname>Strand</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Sullender</surname>
<given-names>M. E.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Optimized libraries for CRISPR-Cas9 genetic screens with multiple modalities</article-title>. <source>Nat. Commun.</source> <volume>9</volume>, <fpage>5416</fpage>. <pub-id pub-id-type="doi">10.1038/s41467-018-07901-8</pub-id>
</citation>
</ref>
<ref id="B73">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Schindele</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Puchta</surname>
<given-names>H.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Engineering CRISPR/LbCas12a for highly efficient, temperature-tolerant plant gene editing</article-title>. <source>Plant Biotechnol. J.</source> <volume>18</volume>, <fpage>1118</fpage>&#x2013;<lpage>1120</lpage>. <pub-id pub-id-type="doi">10.1111/pbi.13275</pub-id>
</citation>
</ref>
<ref id="B74">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Schirmer</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Ijaz</surname>
<given-names>U. Z.</given-names>
</name>
<name>
<surname>D&#x27;amore</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Hall</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Sloan</surname>
<given-names>W. T.</given-names>
</name>
<name>
<surname>Quince</surname>
<given-names>C.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Insight into biases and sequencing errors for amplicon sequencing with the Illumina MiSeq platform</article-title>. <source>Nucleic Acids Res.</source> <volume>43</volume>, <fpage>e37</fpage>. <pub-id pub-id-type="doi">10.1093/nar/gku1341</pub-id>
</citation>
</ref>
<ref id="B75">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shan</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>C.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Genome editing in rice and wheat using the CRISPR/Cas system</article-title>. <source>Nat. Protoc.</source> <volume>9</volume>, <fpage>2395</fpage>&#x2013;<lpage>2410</lpage>. <pub-id pub-id-type="doi">10.1038/nprot.2014.157</pub-id>
</citation>
</ref>
<ref id="B76">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Steinert</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Schiml</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Fauser</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Puchta</surname>
<given-names>H.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Highly efficient heritable plant genome engineering using Cas9 orthologues from <italic>Streptococcus thermophilus</italic> and <italic>Staphylococcus aureus</italic>
</article-title>. <source>Plant J.</source> <volume>84</volume>, <fpage>1295</fpage>&#x2013;<lpage>1305</lpage>. <pub-id pub-id-type="doi">10.1111/tpj.13078</pub-id>
</citation>
</ref>
<ref id="B77">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Steinert</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Schmidt</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Puchta</surname>
<given-names>H.</given-names>
</name>
</person-group> (<year>2017</year>). &#x201c;<article-title>Use of the Cas9 orthologs from <italic>Streptococcus thermophilus</italic> and <italic>Staphylococcus aureus</italic> for non-homologous end-joining mediated site-specific mutagenesis in <italic>Arabidopsis thaliana</italic>
</article-title>,&#x201d; in <source>Plant germline development: Methods and protocols</source>. Editor <person-group person-group-type="editor">
<name>
<surname>Schmidt</surname>
<given-names>A.</given-names>
</name>
</person-group> (<publisher-loc>New York, NY</publisher-loc>: <publisher-name>Springer New York</publisher-name>), <fpage>365</fpage>&#x2013;<lpage>376</lpage>. <pub-id pub-id-type="doi">10.1007/978-1-4939-7286-9_27</pub-id>
</citation>
</ref>
<ref id="B78">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Stemmer</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Thumberger</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Del Sol Keyer</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Wittbrodt</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Mateo</surname>
<given-names>J. L.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>CCTop: An intuitive, flexible and reliable CRISPR/Cas9 target prediction tool</article-title>. <source>PLoS One</source> <volume>10</volume>, <fpage>e0124633</fpage>. <pub-id pub-id-type="doi">10.1371/journal.pone.0124633</pub-id>
</citation>
</ref>
<ref id="B79">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Stewart</surname>
<given-names>C. N.</given-names>
</name>
<name>
<surname>Via</surname>
<given-names>L. E.</given-names>
</name>
</person-group> (<year>1993</year>). <article-title>A rapid CTAB DNA isolation technique useful for RAPD fingerprinting and other PCR applications</article-title>. <source>BioTechniques</source> <volume>14</volume>, <fpage>748</fpage>&#x2013;<lpage>750</lpage>.</citation>
</ref>
<ref id="B80">
<citation citation-type="web">
<collab>Synthego</collab> (<year>2019</year>). <article-title>Synthego performance analysis, ICE analysis</article-title>. <comment>Available at: <ext-link ext-link-type="uri" xlink:href="https://ice.synthego.com/">https://ice.synthego.com/</ext-link> </comment>(<comment>Accessed 30 12, 2022)</comment>.</citation>
</ref>
<ref id="B81">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Teng</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Cui</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Guo</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>Q.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Enhanced mammalian genome editing by new Cas12a orthologs with optimized crRNA scaffolds</article-title>. <source>Genome Biol.</source> <volume>20</volume>, <fpage>15</fpage>. <pub-id pub-id-type="doi">10.1186/s13059-019-1620-8</pub-id>
</citation>
</ref>
<ref id="B82">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Thomson</surname>
<given-names>J. M.</given-names>
</name>
<name>
<surname>Parrott</surname>
<given-names>W. A.</given-names>
</name>
</person-group> (<year>1998</year>). <article-title>pMECA: A cloning plasmid with 44 unique restriction sites that allows selection of recombinants based on colony size</article-title>. <source>BioTechniques</source> <volume>24</volume>, <fpage>922</fpage>&#x2013;<lpage>924</lpage>. <pub-id pub-id-type="doi">10.2144/98246bm04</pub-id>
</citation>
</ref>
<ref id="B83">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Yin</surname>
<given-names>T.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Efficient CRISPR/Cas9-mediated gene editing in an interspecific hybrid poplar with a highly heterozygous genome</article-title>. <source>Front. Plant Sci.</source> <volume>11</volume>, <fpage>996</fpage>. <pub-id pub-id-type="doi">10.3389/fpls.2020.00996</pub-id>
</citation>
</ref>
<ref id="B84">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wilson</surname>
<given-names>F. M.</given-names>
</name>
<name>
<surname>Harrison</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Armitage</surname>
<given-names>A. D.</given-names>
</name>
<name>
<surname>Simkin</surname>
<given-names>A. J.</given-names>
</name>
<name>
<surname>Harrison</surname>
<given-names>R. J.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>CRISPR/Cas9-mediated mutagenesis of phytoene desaturase in diploid and octoploid strawberry</article-title>. <source>Plant Methods</source> <volume>15</volume>, <fpage>45</fpage>. <pub-id pub-id-type="doi">10.1186/s13007-019-0428-6</pub-id>
</citation>
</ref>
<ref id="B85">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xiang</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>An</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Cheng</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>H.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Temperature effect on CRISPR-Cas9 mediated genome editing</article-title>. <source>J. Genet. Genomics</source> <volume>44</volume>, <fpage>199</fpage>&#x2013;<lpage>205</lpage>. <pub-id pub-id-type="doi">10.1016/j.jgg.2017.03.004</pub-id>
</citation>
</ref>
<ref id="B86">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xie</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Minkenberg</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Y.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Boosting CRISPR/Cas9 multiplex editing capability with the endogenous tRNA-processing system</article-title>. <source>Proc. Natl. Acad. Sci. U.S.A.</source> <volume>112</volume>, <fpage>3570</fpage>&#x2013;<lpage>3575</lpage>. <pub-id pub-id-type="doi">10.1073/pnas.1420294112</pub-id>
</citation>
</ref>
<ref id="B87">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xue</surname>
<given-names>L.-J.</given-names>
</name>
<name>
<surname>Tsai</surname>
<given-names>C.-J.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>AGEseq: Analysis of genome editing by sequencing</article-title>. <source>Mol. Plant</source> <volume>8</volume>, <fpage>1428</fpage>&#x2013;<lpage>1430</lpage>. <pub-id pub-id-type="doi">10.1016/j.molp.2015.06.001</pub-id>
</citation>
</ref>
<ref id="B88">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zafar</surname>
<given-names>S. A.</given-names>
</name>
<name>
<surname>Zaidi</surname>
<given-names>S. S.-E.-A.</given-names>
</name>
<name>
<surname>Gaba</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Singla-Pareek</surname>
<given-names>S. L.</given-names>
</name>
<name>
<surname>Dhankher</surname>
<given-names>O. P.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>X.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Engineering abiotic stress tolerance via CRISPR/Cas-mediated genome editing</article-title>. <source>J. Exp. Bot.</source> <volume>71</volume>, <fpage>470</fpage>&#x2013;<lpage>479</lpage>. <pub-id pub-id-type="doi">10.1093/jxb/erz476</pub-id>
</citation>
</ref>
<ref id="B89">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zetsche</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Gootenberg</surname>
<given-names>J. S.</given-names>
</name>
<name>
<surname>Abudayyeh</surname>
<given-names>O. O.</given-names>
</name>
<name>
<surname>Slaymaker</surname>
<given-names>I. M.</given-names>
</name>
<name>
<surname>Makarova</surname>
<given-names>K. S.</given-names>
</name>
<name>
<surname>Essletzbichler</surname>
<given-names>P.</given-names>
</name>
<etal/>
</person-group> (<year>2015</year>). <article-title>Cpf1 is a single RNA-guided endonuclease of a Class 2 CRISPR-Cas system</article-title>. <source>Cell</source> <volume>163</volume>, <fpage>759</fpage>&#x2013;<lpage>771</lpage>. <pub-id pub-id-type="doi">10.1016/j.cell.2015.09.038</pub-id>
</citation>
</ref>
<ref id="B90">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zetsche</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Strecker</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Abudayyeh</surname>
<given-names>O. O.</given-names>
</name>
<name>
<surname>Gootenberg</surname>
<given-names>J. S.</given-names>
</name>
<name>
<surname>Scott</surname>
<given-names>D. A.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>F.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>A survey of genome editing activity for 16 Cas12a orthologs</article-title>. <source>Keio J. Med.</source> <volume>69</volume>, <fpage>59</fpage>&#x2013;<lpage>65</lpage>. <pub-id pub-id-type="doi">10.2302/kjm.2019-0009-OA</pub-id>
</citation>
</ref>
<ref id="B91">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhou</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Jacobs</surname>
<given-names>T. B.</given-names>
</name>
<name>
<surname>Xue</surname>
<given-names>L.-J.</given-names>
</name>
<name>
<surname>Harding</surname>
<given-names>S. A.</given-names>
</name>
<name>
<surname>Tsai</surname>
<given-names>C.-J.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Exploiting SNPs for biallelic CRISPR mutations in the outcrossing woody perennial <italic>Populus</italic> reveals 4-coumarate:CoA ligase specificity and redundancy</article-title>. <source>New Phytol.</source> <volume>208</volume>, <fpage>298</fpage>&#x2013;<lpage>301</lpage>. <pub-id pub-id-type="doi">10.1111/nph.13470</pub-id>
</citation>
</ref>
<ref id="B92">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhu</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Liang</surname>
<given-names>C.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>CRISPR-DT: Designing gRNAs for the CRISPR-cpf1 system with improved target efficiency and specificity</article-title>. <source>Bioinformatics</source> <volume>35</volume>, <fpage>2783</fpage>&#x2013;<lpage>2789</lpage>. <pub-id pub-id-type="doi">10.1093/bioinformatics/bty1061</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>