<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article article-type="research-article" dtd-version="2.3" xml:lang="EN" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Genet.</journal-id>
<journal-title>Frontiers in Genetics</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Genet.</abbrev-journal-title>
<issn pub-type="epub">1664-8021</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="publisher-id">1252873</article-id>
<article-id pub-id-type="doi">10.3389/fgene.2023.1252873</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Genetics</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Identification of novel <italic>TMEM231</italic> gene splice variants and pathological findings in a fetus with Meckel Syndrome</article-title>
<alt-title alt-title-type="left-running-head">Zhang et al.</alt-title>
<alt-title alt-title-type="right-running-head">
<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3389/fgene.2023.1252873">10.3389/fgene.2023.1252873</ext-link>
</alt-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Zhang</surname>
<given-names>Qian</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2363048/overview"/>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Yang</surname>
<given-names>Shuya</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>&#x2020;</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Chen</surname>
<given-names>Xin</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2395762/overview"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Hongdan</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1632597/overview"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Li</surname>
<given-names>Keyan</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhang</surname>
<given-names>Chaonan</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Liao</surname>
<given-names>Shixiu</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Qin</surname>
<given-names>Litao</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2369931/overview"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Hou</surname>
<given-names>Qiaofang</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Henan Provincial Key Laboratory of Genetic Diseases and Functional Genomics</institution>, <institution>Henan Provincial People&#x2019;s Hospital</institution>, <institution>Medical Genetics Institute of Henan Province</institution>, <institution>People&#x2019;s Hospital of Zhengzhou University</institution>, <institution>Zhengzhou University</institution>, <addr-line>Zhengzhou</addr-line>, <country>China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>National Health Commission Key Laboratory of Birth Defects Prevention</institution>, <institution>Henan Key Laboratory of Population Defects Prevention</institution>, <addr-line>Zhengzhou</addr-line>, <country>China</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>People&#x2019;s Hospital of Henan University</institution>, <institution>Henan University</institution>, <addr-line>Zhengzhou</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>
<bold>Edited by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/649682/overview">Yang Sun</ext-link>, Stanford University, United States</p>
</fn>
<fn fn-type="edited-by">
<p>
<bold>Reviewed by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1071149/overview">Priyanka Upadhyai</ext-link>, Manipal Academy of Higher Education, India</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1364122/overview">Hui Xi</ext-link>, Hunan Provincial Maternal and Child Health Care Hospital, China</p>
</fn>
<corresp id="c001">&#x2a;Correspondence: Litao Qin, <email>litao_qin@zzu.edu.cn</email>; Qiaofang Hou, <email>houqf_2000@163.com</email>
</corresp>
<fn fn-type="equal" id="fn001">
<label>
<sup>&#x2020;</sup>
</label>
<p>These authors have contributed equally to this work and share first authorship</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>06</day>
<month>09</month>
<year>2023</year>
</pub-date>
<pub-date pub-type="collection">
<year>2023</year>
</pub-date>
<volume>14</volume>
<elocation-id>1252873</elocation-id>
<history>
<date date-type="received">
<day>04</day>
<month>07</month>
<year>2023</year>
</date>
<date date-type="accepted">
<day>22</day>
<month>08</month>
<year>2023</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2023 Zhang, Yang, Chen, Wang, Li, Zhang, Liao, Qin and Hou.</copyright-statement>
<copyright-year>2023</copyright-year>
<copyright-holder>Zhang, Yang, Chen, Wang, Li, Zhang, Liao, Qin and Hou</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>
<bold>Background:</bold> Meckel Syndrome (MKS, OMIM &#x23;249000) is a rare and fatal autosomal recessive ciliopathy with high clinical and genetic heterogeneity. MKS shows complex allelism with other related ciliopathies such as Joubert Syndrome (JBTS, OMIM &#x23;213300). In MKS, the formation and function of the primary cilium is defective, resulting in a multisystem disorder including occipital encephalocele, polycystic kidneys, postaxial polydactyly, liver fibrosis, central nervous system malformations and genital anomalies. This study aimed to analyze the genotype of MKS patients and investigate the correlation between genotype and phenotype.</p>
<p>
<bold>Methods:</bold> A nonconsanguineous couple who conceived four times with a fetus affected by multiorgan dysfunction and intrauterine fetal death was studied. Whole exome sequencing (WES) was performed in the proband to identify the potentially pathogenic variant. Sanger sequencing was performed in family members. In silico tools were used to analyse the pathogenicity of the identified variants. cDNA TA-cloning sequencing was performed to validate the effects of intronic variants on mRNA splicing. Quantitative real-time PCR was performed to investigate the effect of the variants on gene expression. Immunofluorescence was performed to observe pathological changes of the primary cilium in kidney tissue from the proband.</p>
<p>
<bold>Results:</bold> Two splice site variants of <italic>TMEM231</italic> (NM_001077418.2, c.583-1G&#x3e;C and c.583-2_588delinsTCCTCCC) were identified in the proband, and the two variants have not been previously reported. The parents were confirmed as carriers. The two variants were predicted to be pathogenic by <italic>in silico</italic> tools and were classified as pathogenic/likely pathogenic variants according to the American College of Medical Genetics and Genomics guideline. cDNA TA cloning analysis showed that both splice site variants caused a deletion of exon 5. RT-PCR revealed that the expression of <italic>TMEM231</italic> was significantly decreased and immunofluorescence showed that the primary cilium was almost absent in the proband&#x2019;s kidney tissue.</p>
<p>
<bold>Conclusion:</bold> We reported the clinical, genetic, molecular and histochemical characterisation of a family affected by MKS. Our findings not only extended the mutation spectrum of the <italic>TMEM231</italic> gene, but also revealed for the first time the pathological aetiology of primary cilia in humans and provide a basis for genetic counselling of the parents to their offspring.</p>
</abstract>
<kwd-group>
<kwd>Meckel Syndrome</kwd>
<kwd>
<italic>TMEM231</italic> gene</kwd>
<kwd>whole exome sequencing</kwd>
<kwd>splicing mutation</kwd>
<kwd>alternative transcription</kwd>
<kwd>primary cilia</kwd>
</kwd-group>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-at-acceptance</meta-name>
<meta-value>Genetics of Common and Rare Diseases</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec sec-type="intro" id="s1">
<title>Introduction</title>
<p>Meckel Syndrome (MKS, OMIM &#x23;249000) is a rare and fatal autosomal recessive ciliopathy with an incidence ranging from 1:13,250 to 1:140,000 (<xref ref-type="bibr" rid="B28">Young et al., 1985</xref>; <xref ref-type="bibr" rid="B27">Yaqoubi and Fatema, 2018</xref>; <xref ref-type="bibr" rid="B11">Lin et al., 2022</xref>). MKS is a highly clinically heterogeneous and multisystem disorder characterised by classic features&#x2014;occipital encephalocele, polycystic kidneys, postaxial polydactyly and other anomalies (including liver fibrosis, central nervous system malformations and genital anomalies) (<xref ref-type="bibr" rid="B13">Logan et al., 2011</xref>; <xref ref-type="bibr" rid="B7">Hartill et al., 2017</xref>; <xref ref-type="bibr" rid="B12">Liu et al., 2021</xref>). The aetiology of MKS is the dysfunction of the primary cilium during early embryogenesis, and mutations in ciliary-associated proteins result in a group of disorders including Meckel Syndrome (MKS, OMIM &#x23;249000), Polycystic kidney disease (PKD, OMIM &#x23;173900), nephronophthisis (NPHP, OMIM &#x23;256100), Bardet-Biedl Syndrome (BBS, OMIM &#x23;209900), Joubert syndrome (JBTS, OMIM &#x23;213300) and Alstrom syndrome (ALMS, OMIM &#x23;203800) (<xref ref-type="bibr" rid="B2">Badano et al., 2006</xref>; <xref ref-type="bibr" rid="B22">Sharma et al., 2008</xref>; <xref ref-type="bibr" rid="B29">Yuan and Sun, 2013</xref>; <xref ref-type="bibr" rid="B15">McConnachie et al., 2021</xref>; <xref ref-type="bibr" rid="B16">Moreno-Leon et al., 2022</xref>).</p>
<p>Seventeen genes are found to be linked with MKS, and the <italic>MKS1</italic> gene mutations cause 16% of MKS cases (<xref ref-type="bibr" rid="B8">Iannicelli et al., 2010</xref>; <xref ref-type="bibr" rid="B21">Shaheen et al., 2013</xref>; <xref ref-type="bibr" rid="B25">Wang et al., 2021</xref>). The <italic>TMEM231</italic> gene, identified in 2013 as a causative gene for MKS, also contributes to JBTS which is another ciliopathy characterised by oculomotor apraxia, abnormal breathing, ataxia, and variable psychomotor developmental delay (<xref ref-type="bibr" rid="B23">Srour et al., 2012</xref>; <xref ref-type="bibr" rid="B21">Shaheen et al., 2013</xref>; <xref ref-type="bibr" rid="B25">Wang et al., 2021</xref>). MKS and JBTS exhibit common clinical features such as polydactyly and renal involvement. A clear clinical diagnosis for MKS is often delayed due to its low frequency and complex phenotype.</p>
<p>With the development of sequencing technologies and the reduction of technology costs, whole-exome sequencing (WES) has been widely applied to reveal the genetic aetiology of congenital diseases, especially in rare diseases with extreme genotypic and phenotypic heterogeneity (<xref ref-type="bibr" rid="B4">Chen et al., 2021</xref>; <xref ref-type="bibr" rid="B17">Pan et al., 2022</xref>; <xref ref-type="bibr" rid="B24">Wang et al., 2022</xref>; <xref ref-type="bibr" rid="B30">Zhang et al., 2022</xref>). Here, we collected a pedigree of four siblings affected by MKS and identified two novel splice site variations of the <italic>TMEM231</italic> gene (NM_001077418.2; c.583-1G&#x3e;C and c.583-2_588delinsTCCTCCC) by WES. We used alternative splicing experiments, mRNA expression detection and immunofluorescence techniques to investigate the correlation between genotypes and phenotypes.</p>
</sec>
<sec sec-type="materials|methods" id="s2">
<title>Materials and methods</title>
<sec id="s2-1">
<title>Participants</title>
<p>The nonconsanguineous couple came for genetic counselling at the Medical Genetics Institute of the Henan Provincial People&#x2019;s Hospital. At 13 weeks, ultrasound revealed that the couple&#x2019;s fourth fetus had intrauterine fetal death and multiorgan dysfunction. Investigation of their family history unveiled that the couple had similar reproductive history on three previous occasions. <xref ref-type="fig" rid="F1">Figure 1A</xref> displays the family pedigree. Clinical investigations, including an ultrasound scan, were carried out in the pertinent clinical departments. The Ethics Committee of the Henan Provincial People&#x2019;s Hospital approved this study (No. 2019-134), and informed consent was obtained from the couple.</p>
<fig id="F1" position="float">
<label>FIGURE 1</label>
<caption>
<p>Pedigree of the family and clinical features of the fetus affected by MKS. <bold>(A)</bold> Pedigree of the family. The affected fetuses are marked with solid triangles. <bold>(B)</bold>, <bold>(C)</bold> and <bold>(D)</bold> Ultrasound examination showed postaxial polydactyly of the feet, occipital encephalocele and bilateral polycystic kidneys. <bold>(E)</bold>, <bold>(F)</bold> Necropsy showed the proband with seven toes of the feet and anencephaly. <bold>(G)</bold> HE staining of kidney tissue from the proband.</p>
</caption>
<graphic xlink:href="fgene-14-1252873-g001.tif"/>
</fig>
</sec>
<sec id="s2-2">
<title>Whole-exome sequencing and data analysis</title>
<p>The genomic DNA (gDNA) was extracted from the peripheral blood of the couple and the fetal skin utilizing the Qiagen genomic DNA isolation kit (Qiagen, Hilden, Germany). WES analysis was carried out on the gDNA of the proband (&#x2161;-4).</p>
<p>The Agilent SureSelect Human ALL Exon Kit v6 (Agilent Technologies, CA, United States) was used following the manufacturer&#x2019;s protocol to generate the WES library. The prepared library was sequenced on the Illumina Nova sequencing platform (Illumina, CA, United States) with an average coverage depth of 100 &#xd7; of the targeted regions, including coding regions and exon-intron boundaries. Alignment of clean reads to the human reference genome (GRCh37) was done using the BWA program and GATK software. Variants were filtered based on their minor allele frequencies (MAF) &#x3c; 1% in the dbSNP (<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/snp">https://www.ncbi.nlm.nih.gov/snp</ext-link>), 1000 Genomes Project (1000&#xa0;GP, <ext-link ext-link-type="uri" xlink:href="https://browser.1000genomes.org">https://browser.1000genomes.org</ext-link>) and Exome Variant Server (EVS, <ext-link ext-link-type="uri" xlink:href="https://evs.gs.washington.edu/EVS">https://evs.gs.washington.edu/EVS</ext-link>) databases. The Human Gene Mutation Database (HGMD, <ext-link ext-link-type="uri" xlink:href="https://www.hgmd.cf.ac.uk/ac/index.php">https://www.hgmd.cf.ac.uk/ac/index.php</ext-link>), ClinVar (<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/clinvar/">https://www.ncbi.nlm.nih.gov/clinvar/</ext-link>). GeneSplicer (<ext-link ext-link-type="uri" xlink:href="http://www.cbcb.umd.edu/software/GeneSplicer/gen_spl.shtml">http://www.cbcb.umd.edu/software/GeneSplicer/gen_spl.shtml</ext-link>) and Human Splicing Finder (<ext-link ext-link-type="uri" xlink:href="http://www.umd.be/HSF">http://www.umd.be/HSF</ext-link>) online software were used to predict and analyse the function of suspected splicing variants. All suspected variants were categorised according to the American College of Medical Genetics and Genomics (ACMG) guideline.</p>
</sec>
<sec id="s2-3">
<title>Sanger sequencing</title>
<p>Sanger sequencing was conducted in the proband and family members to further authenticate the identified variants detected by WES. The primers used for Sanger sequencing are listed in <xref ref-type="table" rid="T1">Table 1</xref> (Primer &#x23;1).</p>
<table-wrap id="T1" position="float">
<label>TABLE 1</label>
<caption>
<p>Primers used in this study.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left">Name</th>
<th align="left">Primers</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td rowspan="2" align="left">Primer &#x23;1</td>
<td align="left">
<italic>TMEM231</italic>-F-5&#x2032;-<italic>CCGCTGAGATAAAGAGGGGT</italic> -3&#x2032;</td>
</tr>
<tr>
<td align="left">
<italic>TMEM231</italic>-R-5&#x2032;-<italic>AAGACAAATCCTGGACAGCAT</italic>-3&#x2032;</td>
</tr>
<tr>
<td rowspan="2" align="left">Primer &#x23;2</td>
<td align="left">
<italic>TMEM231</italic>-mrE3-F-5&#x2032;-<italic>CGTTTCTCCAGTCCTCCTTTC</italic>-3&#x2032;</td>
</tr>
<tr>
<td align="left">
<italic>TMEM231</italic>-mrE5-R:5&#x2032;-<italic>GCTATGGGACACCTTCAGTAAA</italic>-3&#x2032;</td>
</tr>
<tr>
<td rowspan="2" align="left">Primer &#x23;3</td>
<td align="left">M13F-<italic>TGTAAAACGACGGCCAGT</italic>
</td>
</tr>
<tr>
<td align="left">M13R-<italic>CAGGAAACAGCTATGACC</italic>
</td>
</tr>
<tr>
<td rowspan="2" align="left">Primer &#x23;4</td>
<td align="left">
<italic>TMEM231</italic>-mr<italic>E3-F:5&#x2032;- CCC&#x200b;GGG&#x200b;ATC&#x200b;CCA&#x200b;GTT&#x200b;ATA&#x200b;CG-3&#x2032;</italic>
</td>
</tr>
<tr>
<td align="left">
<italic>TMEM231-</italic>mr<italic>E5-R: 5&#x2032;- TTG&#x200b;GGA&#x200b;TCA&#x200b;TTC&#x200b;AGG&#x200b;ACG&#x200b;GTG-3&#x2032;</italic>
</td>
</tr>
<tr>
<td rowspan="2" align="left">Primer &#x23;5</td>
<td align="left">
<italic>&#x3b2;-actin-F-5&#x2032;- CCT&#x200b;TCC&#x200b;TGG&#x200b;GCA&#x200b;TGG&#x200b;AGT&#x200b;C-3&#x2032;</italic>
</td>
</tr>
<tr>
<td align="left">
<italic>&#x3b2;-actin-R-5&#x2032;- TGA&#x200b;TCT&#x200b;TCA&#x200b;TTG&#x200b;TGC&#x200b;TGG&#x200b;GTG-3&#x2032;</italic>
</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2-4">
<title>Total RNA extraction and reverse-transcription</title>
<p>Total RNA was extracted from the whole blood of the couple and different organs from the fetal autopsy body utilizing the TRIzol reagent (Life Technologies, MA, United States). Total RNA was reverse transcribed to cDNA using the Revert Aid First Strand cDNA Synthesis Kit (Thermo Scientific, MA, United States).</p>
</sec>
<sec id="s2-5">
<title>cDNA TA-cloning sequencing</title>
<p>To investigate the function of two putative splice-site mutations, TA cloning sequencing was performed on cDNA from the couple (I-1 and I-2). The PCR products were purified and cloned into pClone007 vector (TsingKe Biotechnology, Beijing, China). The recombinant vectors were transformed into TreliefTM5&#x3b1;-competent cells (TsingKe Biotechnology, Beijing, China) and ten monoclonal colonies were sequenced. The primers are listed in <xref ref-type="table" rid="T1">Table 1</xref> (Primer &#x23;2 and Primer &#x23;3).</p>
</sec>
<sec id="s2-6">
<title>Quantitative real-time PCR</title>
<p>Quantitative real-time PCR (qPCR) was performed to quantify the mRNA expression of <italic>TMEM231</italic> in the heart, kidney, and liver of the proband (&#x2161;-4). qPCR was conducted with SYBR Green qPCR Master Mix (Thermo Fisher, CA, United States) on an Applied Biosystems StepOne Real-Time PCR System (Thermo Scientific, MA, United States). The datasets were processed according to the 2<sup>&#x2212;&#x394;&#x394;CT</sup> method and normalised it to the housekeeping gene <italic>&#x3b2;-actin</italic>. The primers are listed in <xref ref-type="table" rid="T1">Table 1</xref> (Primer &#x23;4 and Primer &#x23;5).</p>
</sec>
<sec id="s2-7">
<title>Data analysis</title>
<p>The data were analysed employing IBM SPSS Statistics 13.0 software. The within-sample analyses were conducted by Student&#x27;s t-tests. The outcomes are demonstrated as mean &#xb1; SEM. A <italic>p</italic>-value of &#x3c;0.05 was deemed statistically significant.</p>
</sec>
<sec id="s2-8">
<title>Immunofluorescence</title>
<p>Kidney tissues from the proband (&#x2161;-4) were fixed in 10% paraformaldehyde and immunofluorescence was performed as a routine protocol. The primary antibody was ARL13B (Proteintech, 1711-1-AP, rabbit, 1:250), a specific marker for primary cilia, and the secondary antibody was anti-rabbit Alexa Fluor 488 (Abcam, ab150077, goat, 1:250). Immunofluorescence images were captured using a scanning microscope system (Nikon, Tokyo, Japan).</p>
</sec>
</sec>
<sec sec-type="results" id="s3">
<title>Results</title>
<sec id="s3-1">
<title>Clinical presentation and family history</title>
<p>The proband (&#x2161;-4) was a fetus conceived naturally, and its ultrasound scan at 13 weeks revealed several anomalies, mainly &#x2460;occipital encephalocele (9.6 mm &#xd7; 7.9&#xa0;mm), &#x2461;bilateral polycystic kidneys, &#x2462;postaxial polydactyly of the hands and feet (<xref ref-type="fig" rid="F1">Figures 1B&#x2013;D</xref>, <xref ref-type="sec" rid="s11">Supplementary Table S1</xref>). The necropsy results of the proband were consistent with the ultrasound findings, revealing anencephaly, bilateral enlarged polycystic kidneys, six fingers of the hands, and seven toes of the feet (<xref ref-type="fig" rid="F1">Figures 1E&#x2013;G</xref>). The histological testing showed thin cortex and glomerular atrophy in the proband&#x2019;s kidneys with no abnormalities in the proband&#x2019;s liver. The third fetus of the couple had similar ultrasound features at 17 weeks, including an occipital encephalocele (23 mm &#xd7; 15&#xa0;mm), bilateral enlarged polycystic kidneys, and bilateral polydactyly (<xref ref-type="sec" rid="s11">Supplementary Figure S1</xref>). A summary of the medical history and clinical features of the four affected siblings is given in <xref ref-type="table" rid="T2">Table 2</xref>.</p>
<table-wrap id="T2" position="float">
<label>TABLE 2</label>
<caption>
<p>Clinical information of the four siblings.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left">Sibling</th>
<th align="center">Occipital encephalocele</th>
<th align="center">Polycystic kidneys</th>
<th align="center">Polydactyly</th>
<th align="center">Bilateral talipes equinovarus</th>
<th align="left">Pregnancy outcomes</th>
<th align="left">Diagnostic time</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">&#x2161;-1</td>
<td align="center">
<bold>&#x2b;</bold>
</td>
<td align="center">
<bold>-</bold>
</td>
<td align="center">
<bold>-</bold>
</td>
<td align="center">
<bold>-</bold>
</td>
<td align="left">Termination</td>
<td align="left">18 Weeks</td>
</tr>
<tr>
<td align="left">&#x2161;-2</td>
<td align="center">
<bold>&#x2b;</bold>
</td>
<td align="center">
<bold>&#x2b;</bold>
</td>
<td align="center">
<bold>-</bold>
</td>
<td align="center">
<bold>-</bold>
</td>
<td align="left">Termination</td>
<td align="left">17 Weeks</td>
</tr>
<tr>
<td align="left">&#x2161;-3</td>
<td align="center">
<bold>&#x2b;</bold>
</td>
<td align="center">
<bold>&#x2b;</bold>
</td>
<td align="center">
<bold>&#x2b;</bold>
</td>
<td align="center">
<bold>-</bold>
</td>
<td align="left">Termination</td>
<td align="left">17 Weeks</td>
</tr>
<tr>
<td align="left">&#x2161;-4</td>
<td align="center">
<bold>&#x2b;</bold>
</td>
<td align="center">
<bold>&#x2b;</bold>
</td>
<td align="center">
<bold>&#x2b;</bold>
</td>
<td align="center">
<bold>&#x2b;</bold>
</td>
<td align="left">Termination</td>
<td align="left">13 Weeks</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>&#x2161;-4 was the proband. Plus sign (&#x2b;) indicates a positive characteristics. Minus sign (&#x2212;) indicates a negative characteristic.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s3-2">
<title>Identified two novel mutations in the <italic>TMEM231</italic> gene by WES and sanger sequencing</title>
<p>To determine the genetic aetiology of this family, WES was performed and two novel heterozygous splice site mutations of the <italic>TMEM231</italic> gene (NM_001077418.2, c.583-1G&#x3e;C and c.583-2_588delinsTCCTCCC) were detected in the proband (&#x2161;-4). These two variants were not recorded in the dbSNP, 1000&#xa0;GP, EVS, ClinVar and HGMD databases. The online software GeneSplicer and Splicing Finder predicted that these two variants would lead to alternative splicing.</p>
<p>Through Sanger sequencing we confirmed that the two mutations were inherited from the proband&#x2019;s father and mother, respectively (<xref ref-type="fig" rid="F2">Figure 2</xref>). Overall, both classical splice site variants were classified as pathogenic according to the ACMG guidelines (PVS1&#x2b;PM2&#x2b;PP4).</p>
<fig id="F2" position="float">
<label>FIGURE 2</label>
<caption>
<p>Identification of mutations in the <italic>TMEM231</italic> gene. <bold>(A)</bold> Pedigree with autosomal recessive MKS of two splice site mutations in this family. &#x2161;:1, &#x2161;:2 and &#x2161;:3 were assumed to be compound heterozygotes of the two splice site mutations. <bold>(B)</bold> Sanger sequencing results of the <italic>TMEM231</italic> gene variants of the proband (&#x2161;-4), the proband&#x2019;s father (I-1) and the proband&#x2019;s mother (I-2).</p>
</caption>
<graphic xlink:href="fgene-14-1252873-g002.tif"/>
</fig>
</sec>
<sec id="s3-3">
<title>Two splice-site mutations caused the same pathogenic alternative transcription</title>
<p>To determine whether these two splice site mutations affected the post-transcriptional cleavage of <italic>TMEM231</italic>, cDNA from whole blood of the proband&#x2019;s parents was amplified and sequenced. The results provided strong evidence for alternative transcript variants for both <italic>TMEM231</italic> variants (<xref ref-type="fig" rid="F3">Figure 3C</xref>, <xref ref-type="sec" rid="s11">Supplementary Figure S3</xref>). Accordingly, TA clone and monoclone sequencing was performed. The abnormal transcript was detected and indicated that the two splice site mutations caused the same skipping of the fifth exon of the <italic>TMEM231</italic> gene (<xref ref-type="fig" rid="F3">Figure 3D</xref>). Alternative transcription resulted in an 82 bp frameshift deletion (c.583_664del, p. Ile195Leufs&#x2a;5) and produced a truncated protein of 198 amino acids (<xref ref-type="fig" rid="F3">Figures 3A, B</xref>).</p>
<fig id="F3" position="float">
<label>FIGURE 3</label>
<caption>
<p>Results of RT-PCR and sequencing of TA clones. <bold>(A)</bold> Schematic representation of the <italic>TMEM231</italic> gene. Asterisks (&#x002A;) indicate the mutation sites. <bold>(B)</bold> Schematic representation of normal and abnormal post-transcriptional splicing of <italic>TMEM231</italic>. These splice site variants resulted in the loss of exon 5, generating a premature stop codon. E1&#x223C;7 indicates exon1&#x223C;7. <bold>(C)</bold> Sanger sequencing results of RT-PCR products from I-1 and I-2. <bold>(D)</bold> TA clone sequencing showed that there were two different transcripts of <italic>TMEM231</italic> in the proband&#x2019;s father (I-1) and mother (I-2).</p>
</caption>
<graphic xlink:href="fgene-14-1252873-g003.tif"/>
</fig>
</sec>
<sec id="s3-4">
<title>These novel splice-site mutations led to decreased mRNA of <italic>TMEM231</italic> and aberrant cilia</title>
<p>To verify whether these novel splice site mutations would cause any change in the expression of <italic>TMEM231 in vivo</italic>, qPCR was performed to detect mRNA levels. The results showed that the expression of <italic>TMEM231</italic> was significantly decreased in tissues from the proband&#x2019;s kidney, heart and liver (<xref ref-type="fig" rid="F4">Figure 4A</xref> and <xref ref-type="sec" rid="s11">Supplementary Figure S2</xref>).</p>
<fig id="F4" position="float">
<label>FIGURE 4</label>
<caption>
<p>These novel splice site mutations resulted in decreased <italic>TMEM231</italic> mRNA and aberrant cilia. <bold>(A)</bold> Expression of <italic>TMEM231</italic> in the proband&#x2019;s kidney. Student&#x2019;s t-test was used for within-sample analysis. Results are expressed as mean &#xb1; SEM, &#x2a;&#x2a;<italic>p</italic> &#x3c; 0.01. <bold>(B)</bold> Localisation of ARL13B in affected and control fetal kidney tissue (1,000&#xd7;). DAPI, for nuclear staining (blue). Alexa-Fluor 488 conjugated secondary antibody was used for ARL13B (green).</p>
</caption>
<graphic xlink:href="fgene-14-1252873-g004.tif"/>
</fig>
<p>Primary cilia are specialised sensory organelles that protrude from the surface of most cell types. B9 is a ciliary complex located at the transition zone (TZ) of primary cilia, and TMEM231 constitutes part of the B9 complex. To investigate whether these splice site mutations affect the structures of primary cilia, ADP-ribosylation factor-like protein 13B (ARL13B, a specific marker of primary cilia) was used as the primary antibody in immunofluorescence. We found that the expression of ARL13B was significantly decreased in the kidney of the proband with cystic renal dysplasia, and primary cilia were almost absent in the renal tubular epithelial cell of the proband (<xref ref-type="fig" rid="F4">Figure 4B</xref>, <xref ref-type="sec" rid="s11">Supplementary Figure S4</xref>).</p>
</sec>
</sec>
<sec sec-type="discussion" id="s4">
<title>Discussion</title>
<p>
<italic>TMEM231</italic> is a causative gene for MKS. It encodes a 36 KD two-pass transmembrane protein that is part of the B9 complex and localises to the base of the ciliary axoneme at the TZ (<xref ref-type="bibr" rid="B5">Chih et al., 2011</xref>). Mutations in mouse <italic>Tmem231</italic> disrupted the ciliary localisation of proteins such as Arl13b and lnpp5e, resulting in the pathogenic features of MKS, and mutations in the <italic>TMEM231</italic> gene were first reported in MKS patients in 2013 (<xref ref-type="bibr" rid="B21">Shaheen et al., 2013</xref>; <xref ref-type="bibr" rid="B19">Roberson et al., 2015</xref>). In this study, we described the clinical features of a Chinese pedigree with four fetuses affected by MKS, and two novel splice site mutations of <italic>TMEM231</italic> (c.583-1G&#x3e;C and c.583-2_588delinsTCCTCCC) were identified in this pedigree by WES.</p>
<p>Only 15 <italic>TMEM231</italic>-associated MKS cases were reported, and 16 variants (8 splice sites, 7 missense and 1 small deletion) were considered as causative mutations (<xref ref-type="sec" rid="s11">Supplementary Table S1</xref>) (<xref ref-type="bibr" rid="B19">Roberson et al., 2015</xref>; <xref ref-type="bibr" rid="B14">Maglic et al., 2016</xref>; <xref ref-type="bibr" rid="B10">Li et al., 2020</xref>; <xref ref-type="bibr" rid="B26">Watson et al., 2020</xref>). The premature stop-gain mutations caused 80% of the MKS cases (12 out of 15). The c.373C&#x3e;G (p.Pro125Ala) mutation was detected in four cases of northern Europeans, suggesting that this site may be a mutation hotspot in the northern European population (<xref ref-type="bibr" rid="B19">Roberson et al., 2015</xref>). The splice site variant of c.583-1G&#x3e;A (NM_001077418.2) was found to cause loss of exon 5, generating a premature stop codon (<xref ref-type="bibr" rid="B14">Maglic et al., 2016</xref>). Our findings on the c.583-1G&#x3e;C and c.583-2_588delinsTCCTCCC variants confirmed that mutations within this splice site region lead to the deletion of exon 5 during post-transcriptional cleavage of <italic>TMEM231</italic>. It is speculated that this site may be another mutation hotspot. Actually, the abnormal transcripts were ambiguously observed in the parents (<xref ref-type="sec" rid="s11">Supplementary Figure S3</xref>) and were not detected in the fetus by agarose gel electrophoresis (data not shown). We propose the following hypotheses: (1) a considerable period of time elapsed between the drug-induced abortion and the collection of the fetal sample, during which RNA degradation occurred; (2) the frameshift effect caused by two splicing mutations led to nonsense-mediated mRNA decay (NMD), resulting in a low abundance of RNA that could not be observed in the fetal sample (<xref ref-type="bibr" rid="B1">Amrani et al., 2004</xref>; <xref ref-type="bibr" rid="B9">Ivanov et al., 2016</xref>).</p>
<p>With the development of next-generation sequencing (NGS), WES has improved the diagnostic rate and increased the knowledge of most disorders (<xref ref-type="bibr" rid="B6">Guo et al., 2022</xref>). In particular, WES is the most common approach to identify the candidate gene and disease-causing variants in patients with extreme genotypic and phenotypic heterogeneity disorders. In this study, WES successfully identified disease-causing mutations in the <italic>TMEM231</italic> gene. Due to the poor ability of NGS based on short-read sequencing to accurately detect gene conversion events and distinguish pseudogenes, Watson et al. stated that new third-generation long-read sequencing technologies should be considered as a routine clinical approach for genetic diagnosis (<xref ref-type="bibr" rid="B26">Watson et al., 2020</xref>). In their study, a splice site mutation and an exon deletion of the <italic>TMEM231</italic> gene were detected in MKS patients by long-read nanopore sequencing. Therefore, next-generation sequencing and third-generation sequencing could complement each other in clinical diagnosis to improve diagnostic yield.</p>
<p>MKS is a rare, highly clinically and genetically heterogeneous disease. To date, the diagnostic criteria remain controversial. Salonen et al. showed that the minimum diagnostic criteria for MKS include &#x2460; polycystic kidneys, &#x2461; fibrotic changes of the liver, &#x2462; occipital encephalocele and &#x2463; malformation of the central nervous system (<xref ref-type="bibr" rid="B20">Salonen, 1984</xref>). All 15 reported MKS patients had abnormal fetal features and had a poor prognosis. Cystic dysplasia was a common manifestation in all patients. Hepatic developmental defects were also a common phenotype, but were not manifested in the fetuses in this study. (<xref ref-type="sec" rid="s11">Supplementary Table S1</xref>). However, liver fibrosis and bile duct proliferation have been reported to occur in only 65.5% of MKS cases (<xref ref-type="bibr" rid="B3">Barisic et al., 2015</xref>). In this study, we described a pedigree with four fetuses affected by MKS. The proband (&#x2161;-4) not only presented the typical features of MKS, but also showed bilateral talipes equinovarus. &#x2161;-3 presented compatible with typical features of MKS, whereas &#x2161;-1 and &#x2161;-2 did not show polydactyly. In addition, the proband (&#x2161;-4) did not have any liver developmental defects at autopsy. MKS also shares clinical features with several cilia-based disorders such as JTBS and BBS. Due to the complexity of MKS phenotypes, accurate diagnosis of MKS is usually difficult and delayed. Therefore, appropriate ancillary examinations and genetic testing are required.</p>
<p>Genotype-phenotype correlations are essential for clinical research. In this study, these two splice site mutations caused different phenotypes in four affected fetuses, and we hypothesised that these mutations would lead to nonsense-mediated mRNA decay (NMD). Although the pathogenesis of MKS caused by mutations in <italic>TMEM231</italic> remains unclear, we have shown that the defective TMEM231 protein results in a developmental defect in primary cilia (<xref ref-type="fig" rid="F4">Figure 4</xref>, <xref ref-type="sec" rid="s11">Supplementary Figure S4</xref>). Accurate splice site recognition is critical for pre-mRNA splicing. RT-PCR followed by Sanger sequencing showed that these two splice site mutations altered the post-transcriptional cleavage of <italic>TMEM231</italic>. TA cloning sequencing revealed the same alternative transcription in this nonconsanguineous couple. Some researchers have used RNA-seq to explore novel splice sites. On the other hand, RNA-seq can also be used to determine the impact of splicing variants on the transcriptome (<xref ref-type="bibr" rid="B18">Parada et al., 2014</xref>). For example, Zhi et al. reported two aberrant transcripts caused by a c.3353 &#x2b; 5C&#x3e;A variant of <italic>MED12</italic> by RNA-seq (<xref ref-type="bibr" rid="B31">Zhi et al., 2022</xref>). Multiple aberrant transcripts caused by transcript splicing may be the reason for the negative genotype-phenotype association in genetic counselling. Although RNA-seq is powerful for detecting different transcripts, the specificity of gene expression in different tissues should be considered before performing RNA-seq.</p>
<p>In conclusion, we reported two novel splice site mutations (c.583-1G&#x3e;C and c.583-2_588delinsTCCTCCC) of <italic>TMEM231</italic> in a Chinese pedigree with four affected fetuses. Considering the clinical phenotype of the pedigree and the functional analysis of two mutations, we believed that all fetuses were affected with MKS and that the mutations were pathogenic mutations causing MKS. The results of RT-PCR and TA clone sequencing showed alternative post-transcriptional cleavage of <italic>TMEM231</italic>, resulting in a deletion of exon 5 and a premature stop codon in <italic>TMEM231</italic> mRNA. The absence of primary cilia in renal tubular epithelial cells partially explained the mechanism by which <italic>TMEM231</italic> gene mutations affect primary cilia development and formation. This study also provided a basis for genetic counselling of this pedigree and extended the mutation spectrum of the <italic>TMEM231</italic> gene for MKS.</p>
</sec>
</body>
<back>
<sec sec-type="data-availability" id="s5">
<title>Data availability statement</title>
<p>The variation data reported in this paper has been deposited in the Genome Variation Map in National Genomics Data Center, China National Center for Bioinformation/Beijing Institute of Genomics, Chinese Academy of Sciences, under accession number GVM000604 that can be publicly accessible at <ext-link ext-link-type="uri" xlink:href="http://bigd.big.ac.cn/gvm/getProjectDetail?project=GVM000604">http://bigd.big.ac.cn/gvm/getProjectDetail?project&#x003D;GVM000604</ext-link>.</p>
</sec>
<sec id="s6">
<title>Ethics statement</title>
<p>Studies involving human participants were reviewed and approved by the Ethics Committee of Henan Provincial People&#x2019;s Hospital. Written informed consent to participate in this study was obtained from the legal guardian/next of kin of the participant.</p>
</sec>
<sec id="s7">
<title>Author contributions</title>
<p>LQ and QH designed the study and revised the article. QZ and SY carried out data curation, methodology and original drafting. XC, HW, KL and CZ carried out the methodology. SL revised the manuscript. All authors contributed to the article and approved the submitted version.</p>
</sec>
<sec id="s8">
<title>Funding</title>
<p>This work is supported by the National Natural Science Foundation of China (81801549); Science and Technology Research Project of Henan Province (201701016); Open Foundation of National Health Commission Key Laboratory of Birth Defects Prevention (ZD202003); Medical Science and Technology Research Project (LHGJ20190593 and 20210051).</p>
</sec>
<ack>
<p>The authors thank the participating patients for their support and cooperation.</p>
</ack>
<sec sec-type="COI-statement" id="s9">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec sec-type="disclaimer" id="s10">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s11">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fgene.2023.1252873/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fgene.2023.1252873/full&#x23;supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="Image3.JPEG" id="SM1" mimetype="application/JPEG" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Image1.JPEG" id="SM2" mimetype="application/JPEG" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Image4.JPEG" id="SM3" mimetype="application/JPEG" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Image2.JPEG" id="SM4" mimetype="application/JPEG" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table2.DOCX" id="SM5" mimetype="application/DOCX" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table1.xlsx" id="SM6" mimetype="application/xlsx" xmlns:xlink="http://www.w3.org/1999/xlink"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Amrani</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Ganesan</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Kervestin</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Mangus</surname>
<given-names>D. A.</given-names>
</name>
<name>
<surname>Ghosh</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Jacobson</surname>
<given-names>A.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>A faux 3&#x2032;-UTR promotes aberrant termination and triggers nonsense-mediated mRNA decay</article-title>. <source>Nature</source> <volume>432</volume>, <fpage>112</fpage>&#x2013;<lpage>118</lpage>. <pub-id pub-id-type="doi">10.1038/nature03060</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Badano</surname>
<given-names>J. L.</given-names>
</name>
<name>
<surname>Mitsuma</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Beales</surname>
<given-names>P. L.</given-names>
</name>
<name>
<surname>Katsanis</surname>
<given-names>N.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>The ciliopathies: an emerging class of human genetic disorders</article-title>. <source>Annu. Rev. Genomics Hum. Genet.</source> <volume>7</volume>, <fpage>125</fpage>&#x2013;<lpage>148</lpage>. <pub-id pub-id-type="doi">10.1146/annurev.genom.7.080505.115610</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Barisic</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Boban</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Loane</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Garne</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Wellesley</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Calzolari</surname>
<given-names>E.</given-names>
</name>
<etal/>
</person-group> (<year>2015</year>). <article-title>Meckel-Gruber syndrome: A population-based study on prevalence, prenatal diagnosis, clinical features, and survival in europe</article-title>. <source>Eur. J. Hum. Genet. EJHG</source> <volume>23</volume> (<issue>6</issue>), <fpage>746</fpage>&#x2013;<lpage>752</lpage>. <pub-id pub-id-type="doi">10.1038/ejhg.2014.174</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Mar</surname>
<given-names>A. Z.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Chai</surname>
<given-names>G.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Whole-exome sequencing reveals rare germline mutations in patients with hemifacial microsomia</article-title>. <source>Front. Genet.</source> <volume>12</volume>, <fpage>580761</fpage>. <pub-id pub-id-type="doi">10.3389/fgene.2021.580761</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chih</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Chinn</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Chalouni</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Komuves</surname>
<given-names>L. G.</given-names>
</name>
<name>
<surname>Hass</surname>
<given-names>P. E.</given-names>
</name>
<etal/>
</person-group> (<year>2011</year>). <article-title>A ciliopathy complex at the transition zone protects the cilia as a privileged membrane domain</article-title>. <source>Nat. Cell Biol.</source> <volume>14</volume> (<issue>1</issue>), <fpage>61</fpage>&#x2013;<lpage>72</lpage>. <pub-id pub-id-type="doi">10.1038/ncb2410</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Guo</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Qin</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Xia</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>L.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>A gonadal mosaicism novel KMT2D mutation identified by haplotype construction and clone sequencing strategy</article-title>. <source>Clin. Chimica Acta; Int. J. Clin. Chem.</source> <volume>531</volume>, <fpage>197</fpage>&#x2013;<lpage>203</lpage>. <pub-id pub-id-type="doi">10.1016/j.cca.2022.04.008</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hartill</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Szymanska</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Sharif</surname>
<given-names>S. M.</given-names>
</name>
<name>
<surname>Wheway</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Johnson</surname>
<given-names>C. A.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Meckel-Gruber syndrome: an update on diagnosis, clinical management, and research advances</article-title>. <source>Front. Pediatr.</source> <volume>5</volume>, <fpage>244</fpage>. <pub-id pub-id-type="doi">10.3389/fped.2017.00244</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Iannicelli</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Brancati</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Mougou-Zerelli</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Mazzotta</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Thomas</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Elkhartoufi</surname>
<given-names>N.</given-names>
</name>
<etal/>
</person-group> (<year>2010</year>). <article-title>Novel TMEM67 mutations and genotype-phenotype correlates in meckelin-related ciliopathies</article-title>. <source>Hum. Mutat.</source> <volume>31</volume> (<issue>5</issue>), <fpage>E1319</fpage>&#x2013;<lpage>E1331</lpage>. <pub-id pub-id-type="doi">10.1002/humu.21239</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ivanov</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Mikhailova</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Eliseev</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Yeramala</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Sokolova</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Susorov</surname>
<given-names>D.</given-names>
</name>
<etal/>
</person-group> (<year>2016</year>). <article-title>PABP enhances release factor recruitment and stop codon recognition during translation termination</article-title>. <source>Nucleic Acids Res.</source> <volume>44</volume>, <fpage>7766</fpage>&#x2013;<lpage>7776</lpage>. <pub-id pub-id-type="doi">10.1093/nar/gkw635</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Fu</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Xiao</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>D.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Genetic tests aid in counseling of fetuses with cerebellar vermis defects</article-title>. <source>Prenat. Diagn.</source> <volume>40</volume> (<issue>10</issue>), <fpage>1228</fpage>&#x2013;<lpage>1238</lpage>. <pub-id pub-id-type="doi">10.1002/pd.5732</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lin</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Ma</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Sun</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Xiang</surname>
<given-names>Y.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>Case report: preimplantation genetic testing for meckel syndrome induced by novel compound heterozygous mutations of MKS1</article-title>. <source>Front. Genet.</source> <volume>13</volume>, <fpage>843931</fpage>. <pub-id pub-id-type="doi">10.3389/fgene.2022.843931</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Qian</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Shen</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Gong</surname>
<given-names>D.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Structure of the human meckel-gruber protein meckelin</article-title>. <source>Sci. Adv.</source> <volume>7</volume> (<issue>45</issue>), <fpage>eabj9748</fpage>. <pub-id pub-id-type="doi">10.1126/sciadv.abj9748</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Logan</surname>
<given-names>C. V.</given-names>
</name>
<name>
<surname>Abdel-Hamed</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Johnson</surname>
<given-names>C. A.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Molecular genetics and pathogenic mechanisms for the severe ciliopathies: insights into neurodevelopment and pathogenesis of neural tube defects</article-title>. <source>Mol. Neurobiol.</source> <volume>43</volume> (<issue>1</issue>), <fpage>12</fpage>&#x2013;<lpage>26</lpage>. <pub-id pub-id-type="doi">10.1007/s12035-010-8154-0</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Maglic</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Stephen</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Malicdan</surname>
<given-names>M. C. V.</given-names>
</name>
<name>
<surname>Guo</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Fischer</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Konzman</surname>
<given-names>D.</given-names>
</name>
<etal/>
</person-group> (<year>2016</year>). <article-title>TMEM231 gene conversion associated with Joubert and meckel-gruber syndromes in the same family</article-title>. <source>Hum. Mutat.</source> <volume>37</volume> (<issue>11</issue>), <fpage>1144</fpage>&#x2013;<lpage>1148</lpage>. <pub-id pub-id-type="doi">10.1002/humu.23054</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>McConnachie</surname>
<given-names>D. J.</given-names>
</name>
<name>
<surname>Stow</surname>
<given-names>J. L.</given-names>
</name>
<name>
<surname>Mallett</surname>
<given-names>A. J.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Ciliopathies and the kidney: A review</article-title>. <source>Am. J. Kidney Dis. Official J. Natl. Kidney Found.</source> <volume>77</volume> (<issue>3</issue>), <fpage>410</fpage>&#x2013;<lpage>419</lpage>. <pub-id pub-id-type="doi">10.1053/j.ajkd.2020.08.012</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Moreno-Leon</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Quezada-Ramirez</surname>
<given-names>M. A.</given-names>
</name>
<name>
<surname>Bilsbury</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Kiss</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Guerin</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Khanna</surname>
<given-names>H.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Prenatal phenotype analysis and mutation identification of a fetus with meckel gruber syndrome</article-title>. <source>Front. Genet.</source> <volume>13</volume>, <fpage>982127</fpage>. <pub-id pub-id-type="doi">10.3389/fgene.2022.982127</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pan</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Ma</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Teng</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Liang</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>L.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Whole-exome sequencing identifies genetic variants of hearing loss in 113 Chinese families</article-title>. <source>Clin. Chimica Acta; Int. J. Clin. Chem.</source> <volume>532</volume>, <fpage>53</fpage>&#x2013;<lpage>60</lpage>. <pub-id pub-id-type="doi">10.1016/j.cca.2022.05.020</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Parada</surname>
<given-names>G. E.</given-names>
</name>
<name>
<surname>Munita</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Cerda</surname>
<given-names>C. A.</given-names>
</name>
<name>
<surname>Gysling</surname>
<given-names>K.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>A comprehensive survey of non-canonical splice sites in the human transcriptome</article-title>. <source>Nucleic Acids Res.</source> <volume>42</volume> (<issue>16</issue>), <fpage>10564</fpage>&#x2013;<lpage>10578</lpage>. <pub-id pub-id-type="doi">10.1093/nar/gku744</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Roberson</surname>
<given-names>E. C.</given-names>
</name>
<name>
<surname>Dowdle</surname>
<given-names>W. E.</given-names>
</name>
<name>
<surname>Ozanturk</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Garcia-Gonzalo</surname>
<given-names>F. R.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Halbritter</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2015</year>). <article-title>TMEM231, mutated in orofaciodigital and Meckel syndromes, organizes the ciliary transition zone</article-title>. <source>J. Cell Biol.</source> <volume>209</volume> (<issue>1</issue>), <fpage>129</fpage>&#x2013;<lpage>142</lpage>. <pub-id pub-id-type="doi">10.1083/jcb.201411087</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Salonen</surname>
<given-names>R.</given-names>
</name>
</person-group> (<year>1984</year>). <article-title>The meckel syndrome: clinicopathological findings in 67 patients</article-title>. <source>Am. J. Med. Genet.</source> <volume>18</volume> (<issue>4</issue>), <fpage>671</fpage>&#x2013;<lpage>689</lpage>. <pub-id pub-id-type="doi">10.1002/ajmg.1320180414</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shaheen</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Ansari</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Mardawi</surname>
<given-names>E. A.</given-names>
</name>
<name>
<surname>Alshammari</surname>
<given-names>M. J.</given-names>
</name>
<name>
<surname>Alkuraya</surname>
<given-names>F. S.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Mutations in TMEM231 cause Meckel-Gruber syndrome</article-title>. <source>J. Med. Genet.</source> <volume>50</volume> (<issue>3</issue>), <fpage>160</fpage>&#x2013;<lpage>162</lpage>. <pub-id pub-id-type="doi">10.1136/jmedgenet-2012-101431</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sharma</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Berbari</surname>
<given-names>N. F.</given-names>
</name>
<name>
<surname>Yoder</surname>
<given-names>B. K.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Ciliary dysfunction in developmental abnormalities and diseases</article-title>. <source>Curr. Top. Dev. Biol.</source> <volume>85</volume>, <fpage>371</fpage>&#x2013;<lpage>427</lpage>. <pub-id pub-id-type="doi">10.1016/S0070-2153(08)00813-2</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Srour</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Hamdan</surname>
<given-names>F. F.</given-names>
</name>
<name>
<surname>Schwartzentruber</surname>
<given-names>J. A.</given-names>
</name>
<name>
<surname>Patry</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Ospina</surname>
<given-names>L. H.</given-names>
</name>
<name>
<surname>Shevell</surname>
<given-names>M. I.</given-names>
</name>
<etal/>
</person-group> (<year>2012</year>). <article-title>Mutations in TMEM231 cause Joubert syndrome in French Canadians</article-title>. <source>J. Med. Genet.</source> <volume>49</volume> (<issue>10</issue>), <fpage>636</fpage>&#x2013;<lpage>641</lpage>. <pub-id pub-id-type="doi">10.1136/jmedgenet-2012-101132</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Luo</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Mei</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Shen</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>M.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>Whole exome sequencing identified novel ARMC9 variations in two cases with Joubert syndrome</article-title>. <source>Front. Genet.</source> <volume>13</volume>, <fpage>817153</fpage>. <pub-id pub-id-type="doi">10.3389/fgene.2022.817153</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Y.-X.</given-names>
</name>
<name>
<surname>Luo</surname>
<given-names>F.-M.</given-names>
</name>
<name>
<surname>Dong</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>Y.-L.</given-names>
</name>
<name>
<surname>Fan</surname>
<given-names>L.-L.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>A novel homozygous variant of TMEM231 in a case with hypoplasia of the cerebellar vermis and polydactyly</article-title>. <source>Front. Pediatr.</source> <volume>9</volume>, <fpage>774575</fpage>. <pub-id pub-id-type="doi">10.3389/fped.2021.774575</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Watson</surname>
<given-names>C. M.</given-names>
</name>
<name>
<surname>Dean</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Camm</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Bates</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Carr</surname>
<given-names>I. M.</given-names>
</name>
<name>
<surname>Gardiner</surname>
<given-names>C. A.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Long-read nanopore sequencing resolves a TMEM231 gene conversion event causing Meckel-Gruber syndrome</article-title>. <source>Hum. Mutat.</source> <volume>41</volume> (<issue>2</issue>), <fpage>525</fpage>&#x2013;<lpage>531</lpage>. <pub-id pub-id-type="doi">10.1002/humu.23940</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yaqoubi</surname>
<given-names>H. N. A.</given-names>
</name>
<name>
<surname>Fatema</surname>
<given-names>N.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Meckel Gruber syndrome associated with anencephaly-an unusual reported case</article-title>. <source>Oxf. Med. Case Rep.</source> <volume>2018</volume> (<issue>2</issue>), <fpage>omx092</fpage>. <pub-id pub-id-type="doi">10.1093/omcr/omx092</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Young</surname>
<given-names>I. D.</given-names>
</name>
<name>
<surname>Rickett</surname>
<given-names>A. B.</given-names>
</name>
<name>
<surname>Clarke</surname>
<given-names>M.</given-names>
</name>
</person-group> (<year>1985</year>). <article-title>High incidence of Meckel&#x27;s syndrome in Gujarati Indians</article-title>. <source>J. Med. Genet.</source> <volume>22</volume> (<issue>4</issue>), <fpage>301</fpage>&#x2013;<lpage>304</lpage>. <pub-id pub-id-type="doi">10.1136/jmg.22.4.301</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yuan</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Sun</surname>
<given-names>Z.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Expanding horizons: ciliary proteins reach beyond cilia</article-title>. <source>Annu. Rev. Genet.</source> <volume>47</volume>, <fpage>353</fpage>&#x2013;<lpage>376</lpage>. <pub-id pub-id-type="doi">10.1146/annurev-genet-111212-133243</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Hao</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Qin</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Kumar Dey</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>Whole exome sequencing identified a homozygous novel mutation in SUOX gene causes extremely rare autosomal recessive isolated sulfite oxidase deficiency</article-title>. <source>Clin. Chimica Acta; Int. J. Clin. Chem.</source> <volume>532</volume>, <fpage>115</fpage>&#x2013;<lpage>122</lpage>. <pub-id pub-id-type="doi">10.1016/j.cca.2022.06.005</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhi</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Pu</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Cui</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Dong</surname>
<given-names>Y.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>Identification of two aberrant transcripts by RNA sequencing for a novel variant c.3354 &#x2b; 5 G &#x3e; A of MED12 in a Chinese girl with non-syndromic intellectual disability</article-title>. <source>Clin. Chimica Acta; Int. J. Clin. Chem.</source> <volume>532</volume>, <fpage>137</fpage>&#x2013;<lpage>144</lpage>. <pub-id pub-id-type="doi">10.1016/j.cca.2022.05.023</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>