<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article article-type="research-article" dtd-version="2.3" xml:lang="EN" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Genet.</journal-id>
<journal-title>Frontiers in Genetics</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Genet.</abbrev-journal-title>
<issn pub-type="epub">1664-8021</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="publisher-id">1083976</article-id>
<article-id pub-id-type="doi">10.3389/fgene.2023.1083976</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Genetics</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Indian Red Jungle fowl reveals a genetic relationship with South East Asian Red Jungle fowl and Indian native chicken breeds as evidenced through whole mitochondrial genome sequences</article-title>
<alt-title alt-title-type="left-running-head">Kanakachari et al.</alt-title>
<alt-title alt-title-type="right-running-head">
<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3389/fgene.2023.1083976">10.3389/fgene.2023.1083976</ext-link>
</alt-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Kanakachari</surname>
<given-names>M.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1419903/overview"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Chatterjee</surname>
<given-names>R. N.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Reddy</surname>
<given-names>M. R.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Dange</surname>
<given-names>M.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Bhattacharya</surname>
<given-names>T. K.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1304635/overview"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>
<bold>1</bold>
</sup>
<institution>ICAR-Directorate of Poultry Research</institution>, <addr-line>Hyderabad</addr-line>, <country>India</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>EVA.4 Unit</institution>, <institution>Faculty of Forestry and Wood Sciences</institution>, <institution>Czech University of Life Sciences Prague</institution>, <addr-line>Prague</addr-line>, <country>Czechia</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>
<bold>Edited by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1223638/overview">Guillermo Giovambattista</ext-link>, CONICET Institute of Veterinary Genetics (IGEVET), Argentina</p>
</fn>
<fn fn-type="edited-by">
<p>
<bold>Reviewed by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/302711/overview">Ranjit Singh Kataria</ext-link>, National Bureau of Animal Genetic Resources (NBAGR), India</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/556541/overview">Xiaolong Yuan</ext-link>, South China Agricultural University, China</p>
</fn>
<corresp id="c001">&#x2a;Correspondence: T. K. Bhattacharya, <email>bhattacharyatk@gmail.com</email>
</corresp>
</author-notes>
<pub-date pub-type="epub">
<day>09</day>
<month>08</month>
<year>2023</year>
</pub-date>
<pub-date pub-type="collection">
<year>2023</year>
</pub-date>
<volume>14</volume>
<elocation-id>1083976</elocation-id>
<history>
<date date-type="received">
<day>29</day>
<month>10</month>
<year>2022</year>
</date>
<date date-type="accepted">
<day>18</day>
<month>07</month>
<year>2023</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2023 Kanakachari, Chatterjee, Reddy, Dange and Bhattacharya.</copyright-statement>
<copyright-year>2023</copyright-year>
<copyright-holder>Kanakachari, Chatterjee, Reddy, Dange and Bhattacharya</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>
<bold>Background:</bold> Native chickens are dispersed in a wide geographical range and have hereditary assets that are kept by farmers for various purposes. Mitochondrial DNA (mtDNA) is a widely utilized marker in molecular studies because of its quick advancement, matrilineal legacy, and simple molecular structure.</p>
<p>
<bold>Method and Results:</bold> We performed NGS sequencing to investigate mitochondrial genomes and to evaluate the hereditary connections, diversity, and measure of gene stream estimation in Indian native chicken breeds and Red Jungle fowl. The chicken breeds were genotyped using the <italic>D-loop</italic> region and 23 haplotypes were identified. When compared to Indian native breeds, more haplotypes were identified in the NADH dehydrogenase subunits, <italic>Cytochrome c oxidase</italic>, <italic>Cytochrome b</italic>, <italic>ATP synthase subunit 6</italic>, and <italic>Ribosomal RNA genes</italic>. The phylogenetic examination indicated that the analyzed chicken breeds were divided into six significant clades, namely A, B, C, D, E, and F, of which the F clade indicated the domestication of chicken breeds in India. Additionally, our work affirmed that the Indian Red Jungle Fowl is the origin for both reference Red Jungle Fowl as well as all Indian breeds, which is reflected in the dendrogram as well as network analysis based on the whole mtDNA and <italic>D-loop</italic> region. Indian Red Jungle Fowl is distributed as an outgroup, suggesting that this ancestry was reciprocally monophyletic.</p>
<p>
<bold>Conclusion:</bold> The mtDNA sequences of Indian native chickens provided novel insights into adaptation mechanisms and the significance of important mtDNA variations in understanding the maternal lineages of native birds.</p>
</abstract>
<kwd-group>
<kwd>chicken</kwd>
<kwd>mitochondrial DNA</kwd>
<kwd>next-generation sequencing</kwd>
<kwd>SNPs</kwd>
<kwd>mutations and variants</kwd>
<kwd>molecular phylogeny</kwd>
</kwd-group>
<contract-sponsor id="cn001">Science and Engineering Research Board<named-content content-type="fundref-id">10.13039/501100001843</named-content>
</contract-sponsor>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-at-acceptance</meta-name>
<meta-value>Livestock Genomics</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1">
<title>Introduction</title>
<p>Modern-day chicken breeds mostly evolved from Red Jungle fowl (RJF), which is evident from archeological discoveries (<xref ref-type="bibr" rid="B13">Darwin, 1868</xref>; <xref ref-type="bibr" rid="B7">Beebe, 1918</xref>; <xref ref-type="bibr" rid="B12">Danforth, 1958</xref>; <xref ref-type="bibr" rid="B50">Morejohn, 1968</xref>; <xref ref-type="bibr" rid="B19">Fumihito et al., 1994</xref>). There are also some reports on the contribution of other Jungle fowl in evolving many breeds across the Globe (<xref ref-type="bibr" rid="B15">Eriksson et al., 2008</xref>; <xref ref-type="bibr" rid="B36">Lawal, 2017</xref>). However, according to the available data, it is unclear when and where the first domestication of chickens took place (<xref ref-type="bibr" rid="B87">Zeuner, 1963</xref>; <xref ref-type="bibr" rid="B11">Crawford, 1984</xref>; <xref ref-type="bibr" rid="B80">West and Zhou, 1988</xref>; <xref ref-type="bibr" rid="B20">Fumihito et al., 1996</xref>; <xref ref-type="bibr" rid="B42">Liu et al., 2006</xref>; <xref ref-type="bibr" rid="B82">Xiang et al., 2014</xref>; <xref ref-type="bibr" rid="B58">Peters et al., 2015</xref>). In early 3,200 BC, chicken domestication was observed in the Indus valley, and accepted as the epicenter of chicken domestication (<xref ref-type="bibr" rid="B87">Zeuner, 1963</xref>). Wild RJF can be found in the forests of South East Asia and India; when people domesticated the chicken and spread it to different parts of the world, the genome landscape of domestic chickens was molded by natural and artificial selection, bringing about a wide range of breeds and ecotypes (<xref ref-type="bibr" rid="B42">Liu et al., 2006</xref>; <xref ref-type="bibr" rid="B69">Stevens, 1991</xref>; <xref ref-type="bibr" rid="B59">Peterson and Brisbin, 1999</xref>; <xref ref-type="bibr" rid="B68">Silva et al., 2009</xref>; <xref ref-type="bibr" rid="B22">Gifford-Gonzalez and Hanotte, 2011</xref>; <xref ref-type="bibr" rid="B51">Mwacharo et al., 2011</xref>). The domestic chicken has broad phenotypic variations. However, the RJF lack the phenotypic variations that would be the result of domestication, for example, plumage color and other morphological characteristics, behavioral and production traits, adaptation to different agro-ecosystems, and rigid human selection for production as well as aesthetic qualities (<xref ref-type="bibr" rid="B65">Sch&#xfc;tz et al<italic>.,</italic> 2001</xref>; <xref ref-type="bibr" rid="B33">Keeling et al., 2004</xref>; <xref ref-type="bibr" rid="B75">Tixier-Boichard et al., 2011</xref>). Following domestication, large-scale breeding programs have resulted in more than sixty chicken breeds representing four particular genealogies: egg-type, game, meat-type, and bantamweight (<xref ref-type="bibr" rid="B48">Moiseyeva et al., 2003</xref>). According to the taxonomy, the genus <italic>Gallus</italic> is composed of four species: <italic>G. gallus</italic> (Red Jungle Fowl), <italic>G. lafayettei</italic> (Lafayette&#x2019;s Jungle Fowl), <italic>G. varius</italic> (Green Jungle Fowl), and <italic>G. sonneratii</italic> (Grey Jungle Fowl). At present, RJF has five sub-species based on phenotypic traits and geographic distribution of the populations: <italic>G. g. gallus</italic> (South East Asia RJF), <italic>G. g. spadiceus</italic>, <italic>G. g. bankiva</italic>, <italic>G. g. murghi</italic> (Indian RJF) and <italic>G. g. jabouillei</italic> (<xref ref-type="bibr" rid="B55">Niu et al., 2002</xref>). The domestic chicken is considered either a subspecies of RJF (<italic>G. g. domesticus</italic>) or a separate species, <italic>G. domesticus</italic>. Scientists are concerned about the genetic integrity and conservation status of the wild RJF and those held in avicultural assortments. It was revealed that the domestic chicken is hybridized with the wild RJF, resulting in the erosion of the genetic purity of the wild birds (<xref ref-type="bibr" rid="B59">Peterson and Brisbin, 1999</xref>; <xref ref-type="bibr" rid="B8">Brisbin et al., 2002</xref>; <xref ref-type="bibr" rid="B54">Nishibori et al., 2005</xref>). Because the previous examinations depend on phenotypic characters, small samples were utilized for DNA investigations. Mitochondrial <italic>D-loop</italic> sequence phylogeny and nuclear gene analyses demonstrated conceivable hybridization between GJF-RJF/domestic birds (<xref ref-type="bibr" rid="B54">Nishibori et al., 2005</xref>). Based on these reports, the evaluation of the genetic uniqueness of Indian RJFs is significant for conservation and population studies.</p>
<p>In the study of chicken hereditary diversity, microsatellites have been effectively utilized (<xref ref-type="bibr" rid="B28">Karsli and Balc&#x131;o&#x11f;lu, 2019</xref>). For examining the hereditary connections between chicken populations, hereditary assorted diversity estimates utilizing the exceptionally polymorphic variable number of tandem repeat loci have yielded reliable and precise data. Over the previous decade, the utilization of maternally inherited mitochondrial DNA (mtDNA), particularly its complete displacement-loop (<italic>D-loop</italic>) region, has expanded. To track genetic information about chicken ancestral breeds, demonstrating the phylogenetic relationship, genetic distance, and variability within and between populations, one of the most significant and remarkable molecular tools, the nucleotide sequence of the mitochondrial <italic>D-loop</italic> region, is used (<xref ref-type="bibr" rid="B49">Moore, 1995</xref>; <xref ref-type="bibr" rid="B53">Nishibori, 2004</xref>). The mtDNA or an explicit part of mtDNA (e.g. <italic>D-loop</italic>) sequencing gives precise data on evolution and hereditary diversity (<xref ref-type="bibr" rid="B19">Fumihito et al., 1994</xref>; <xref ref-type="bibr" rid="B14">Di Lorenzo et al., 2015</xref>). The <italic>D-loop</italic> region evolves much faster than different areas of the mtDNA and does not encode a protein. A variation study was done utilizing the mtDNA <italic>D-loop</italic> region and <italic>HVI</italic> domain of 397 bp fragments for 398 African native chickens from 12 countries; 12.59% polymorphic sites were discovered (<xref ref-type="bibr" rid="B47">Mobegi, 2006</xref>). Likewise, 25 individuals from six native Chinese chicken populations recorded polymorphic variation rates between the range of 7.05% and 5.54%, respectively (<xref ref-type="bibr" rid="B55">Niu et al., 2002</xref>; <xref ref-type="bibr" rid="B43">Liu et al., 2004</xref>). However, there are no reports on Indian native chickens at the mitochondrial genomic level. Examining native chickens at the mitochondrial genomic level can explain the mitochondrial genomic premise of their disparities and the particular attributes of indigenous chickens can be accurately investigated. The comprehension of phylogeography will clarify the demographic history, origin, and extension of chicken species. To defeat the issue of parallel mutations and lineage exchange between different populaces, network analysis has enhanced phylogenetic trees (<xref ref-type="bibr" rid="B4">Bandelt et al., 1999</xref>). India is a huge nation that contains a unique scope of altitudes and climates, meaning native chickens have an astounding genetic diversity. As indicated by ICAR-NBAGR, India has 19 indigenous breeds: <italic>Ankaleshwar</italic>, <italic>Aseel</italic>, <italic>Busra</italic>, <italic>Chittagong</italic> (<italic>Malay</italic>), <italic>Danki</italic>, <italic>Daothigir</italic>, <italic>Ghagus</italic>, <italic>Harringhata Black</italic>, <italic>Kadaknath</italic>, <italic>Kalasthi</italic>, <italic>Kashmir Favorolla</italic>, <italic>Miri</italic>, <italic>Nicobari</italic>, <italic>Punjab Brown</italic>, <italic>Tellichery</italic>, <italic>Mewari</italic>, <italic>Kaunayen chicken</italic>, <italic>Hansli</italic>, and <italic>Uttara</italic> (Mogilicherla et al., 2022). There is a need to characterize native chicken lines at the molecular level to enact protection and improvement activities to benefit the nation. With the extended focus on genetic preservation, remarkable alleles may be helpful when making choices to keep up with native varieties. Therefore, the current examination aims to assess the hereditary divergence between twenty-two native Asian breeds and seven native Indian chicken breeds (i.e. <italic>Aseel</italic>, <italic>Ghagus</italic>, <italic>Nicobari Brown</italic>, <italic>Tellicherry</italic>, <italic>Kadaknath</italic>, <italic>Haringhata Black</italic>, and <italic>Red Jungle Fowl</italic>) utilizing mtDNA NGS sequence data.</p>
</sec>
<sec sec-type="materials|methods" id="s2">
<title>Materials and methods</title>
<sec id="s2-1">
<title>Experimental birds and sample collection</title>
<p>The seven Indian native chicken breeds, namely <italic>Aseel</italic>, <italic>Ghagus</italic>, <italic>Nicobari brown</italic>, <italic>Kadaknath</italic>, <italic>Tellicherry</italic>, <italic>Haringhata black</italic>, and <italic>Red Jungle fowl</italic>, were studied. Blood samples of five female birds each of <italic>Aseel</italic>, <italic>Ghagus</italic>, <italic>Nicobari brown</italic>, <italic>Nicobari black</italic>, and <italic>Kadaknath</italic> were collected from the experimental farms of Directorate of Poultry Research, Hyderabad while samples of <italic>H. black</italic> and <italic>Red Jungle fowl</italic> were collected from the experimental farms of WBUAFS, West Bengal and CSKHPKVV, Palampur, respectively. The blood samples of <italic>Tellicherry</italic> were collected from the local farmers of Kerala state (<xref ref-type="fig" rid="F1">Figure 1</xref>; <xref ref-type="table" rid="T1">Tables 1</xref>, <xref ref-type="table" rid="T2">2</xref>). The blood samples of each breed (five individual birds) were pooled and stored at &#x2212;80&#xb0;C. The DNA was extracted from pooled blood samples according to the lab-standard phenol-chloroform extraction method (<xref ref-type="bibr" rid="B63">Sambrook and Russell, 2001</xref>). The experiment was approved by the Institute Animal Ethics Advisory Committee (IAEC) ICAR-Directorate of Poultry Research, Hyderabad, India.</p>
<fig id="F1" position="float">
<label>FIGURE 1</label>
<caption>
<p>Geographic distribution of native Indian chicken breeds used in the current study.</p>
</caption>
<graphic xlink:href="fgene-14-1083976-g001.tif"/>
</fig>
<table-wrap id="T1" position="float">
<label>TABLE 1</label>
<caption>
<p>Information on the native Indian chicken breeds used in the current study.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th colspan="7" align="center">Poultry Breeds and Codes List</th>
</tr>
<tr>
<th align="center">S.No.</th>
<th align="center">Livestock Species</th>
<th align="center">Species Code</th>
<th align="center">Breed Name</th>
<th align="center">Breed Code</th>
<th align="center">Home tract</th>
<th align="center">Accession number</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left"/>
<td align="center">Fowl</td>
<td align="center">16</td>
<td align="left"/>
<td align="left"/>
<td align="left"/>
<td align="left"/>
</tr>
<tr>
<td align="center">1</td>
<td rowspan="7" colspan="2" align="center">Indigenous</td>
<td align="left">Aseel</td>
<td align="left">F010</td>
<td align="left">Chhattisgarh, Orissa and Andhra Pradesh</td>
<td align="left">INDIA_CHICKEN_2615_ASEEL_12002</td>
</tr>
<tr>
<td align="center">2</td>
<td align="left">Ghagus</td>
<td align="left">F070</td>
<td align="left">Andhra Pradesh and Karnataka</td>
<td align="left">INDIA_CHICKEN_0108_GHAGUS_12007</td>
</tr>
<tr>
<td align="center">3</td>
<td align="left">Harringhata Black</td>
<td align="left">F080</td>
<td align="left">West Bengal</td>
<td align="left">INDIA_CHICKEN_2100_HARRINGHATABLA CK_12008</td>
</tr>
<tr>
<td align="center">4</td>
<td align="left">Kadaknath</td>
<td align="left">F090</td>
<td align="left">Madhya Pradesh</td>
<td align="left">INDIA_CHICKEN_1000_KADAKNATH_1200 9</td>
</tr>
<tr>
<td align="center">5</td>
<td align="left">Nicobari Brown</td>
<td align="left">F140</td>
<td align="left">Andaman &#x26; Nicobar</td>
<td align="left">INDIA_CHICKEN_3300_NICOBARI_12013</td>
</tr>
<tr>
<td align="center">7</td>
<td align="left">Tellichery</td>
<td align="left">F160</td>
<td align="left">Kerala</td>
<td align="left">INDIA_CHICKEN_0900_TELLICHERY_12015</td>
</tr>
<tr>
<td align="center">8</td>
<td align="left">Indian Red Jungle Fowl</td>
<td align="left">&#x2014;</td>
<td align="left">&#x2014;</td>
<td align="left">&#x2014;</td>
</tr>
</tbody>
</table>
</table-wrap>
<table-wrap id="T2" position="float">
<label>TABLE 2</label>
<caption>
<p>Characteristic features of native Indian chicken breeds used in the current study.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th rowspan="2" align="center">S.No.</th>
<th rowspan="2" align="center">Breed Name</th>
<th colspan="2" align="center">Weight (Avg Kg)</th>
<th rowspan="2" align="center">Plumage Type</th>
<th rowspan="2" align="center">Plumage Pattern</th>
<th rowspan="2" align="center">Plumage Colour</th>
<th rowspan="2" align="center">Comb Type</th>
<th rowspan="2" align="center">Skin Colour</th>
<th rowspan="2" align="center">Shank Colour</th>
<th rowspan="2" align="center">Egg Shell Colour</th>
<th rowspan="2" align="center">Visible Character</th>
<th rowspan="2" align="center">Main use</th>
</tr>
<tr>
<th align="left">Male</th>
<th align="left">Female</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">1</td>
<td align="left">Aseel</td>
<td align="left">4</td>
<td align="left">2.59</td>
<td align="left">Normal</td>
<td align="center">Patchy</td>
<td align="center">Red, Black</td>
<td align="center">Pea</td>
<td align="left">Yellow</td>
<td align="left">Yellow</td>
<td align="left">Brown</td>
<td align="center">Small but firmly set comb. Bright red ear lobes. Long and slender face devoid of feathers. The general feathering is close, scanty and almost absent on the brest. The plumage has practically no fluff and the feathers are tough.</td>
<td align="center">Socio-Cultural-Game/Fighting; Food-meat</td>
</tr>
<tr>
<td align="left">2</td>
<td align="left">Ghagus</td>
<td align="left">2.16</td>
<td align="left">1.43</td>
<td align="left">Normal</td>
<td align="center">Patchy</td>
<td align="center">Brown</td>
<td align="center">Pea or single</td>
<td align="left">White</td>
<td align="left">Yellow</td>
<td align="left">Light Brown</td>
<td align="center">Cocks have shinning bluish black feathers on breast, tail and thighs. Neck is covered with golden feathers. Throat in some cases is loose and hanging. Wattles are small and red in colour. Ear lobes are mostly red.</td>
<td align="center">Food - meat, eggs</td>
</tr>
<tr>
<td align="left">3</td>
<td align="left">Harringhata Black</td>
<td align="left">1.284</td>
<td align="left">1.121</td>
<td align="left">Normal</td>
<td align="center">Self-Black</td>
<td align="center">Black</td>
<td align="center">Single</td>
<td align="left">White</td>
<td align="left">Grey</td>
<td align="left">Light Brown</td>
<td align="center">&#x2014;</td>
<td align="center">Food-Meat, eggs</td>
</tr>
<tr>
<td align="left">4</td>
<td align="left">Kadaknath</td>
<td align="left">1.6</td>
<td align="left">1.125</td>
<td align="left">Normal</td>
<td align="center">&#x2014;</td>
<td align="center">Ranges from silver to gold spangled to blue balck</td>
<td align="center">&#x2014;</td>
<td align="left">Dark grey</td>
<td align="left">Grey</td>
<td align="left">Light Brown</td>
<td align="center">The colour of day old chicks is bluish to black with irregular dark stripes over the back. In the adults, comb, wattles and tongue are purple. The shining blue tinge of the ear lobes adds to its unique features.</td>
<td align="center">Food - meat; Socio-cultural - religious ceremonies</td>
</tr>
<tr>
<td align="left">5</td>
<td align="left">Nicobari Brown</td>
<td align="left">1.8</td>
<td align="left">1.3</td>
<td align="left">Normal</td>
<td align="center">Solid</td>
<td align="center">Black</td>
<td align="center">Single</td>
<td align="left">Dark grey</td>
<td align="left">Grey</td>
<td align="left">Light Brown</td>
<td align="center">The birds are short legged. Shank length at 10 weeks of age varies from 3.50 to 3.85 cm.</td>
<td align="center">Food - Eggs and Mea</td>
</tr>
<tr>
<td align="left">6</td>
<td align="left">Tellichery</td>
<td align="left">1.62</td>
<td align="left">1.24</td>
<td align="left">Normal</td>
<td align="center">Solid</td>
<td align="center">Black with shining bluish tinge</td>
<td align="center">Single</td>
<td align="left">Grey</td>
<td align="left">Blackish grey</td>
<td align="left">Light Brown</td>
<td align="center">Shining bluish tinge on hackle, back and tail. Comb is red and large in size. It is erect in cocks and drooping on the rear side in hens. Wattles are red in colour. Ear lobe is mostly red in colour. Eye ring is blackish red. Beak is blackish.</td>
<td align="center">Food - meat, eggs</td>
</tr>
<tr>
<td align="left">7</td>
<td align="left">Indian Red Jungle Fowl</td>
<td align="left">2.04</td>
<td align="left">1.36</td>
<td align="left">Normal</td>
<td align="center">Solid</td>
<td align="center">Bright orange and black</td>
<td align="center">Single</td>
<td align="left">White</td>
<td align="left">Yellow</td>
<td align="left">White</td>
<td align="center">Feathered shank, bunch of feather on head (crown structure) in about 18 % birds</td>
<td align="center">Egg, meat and socio-cultural</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2-2">
<title>Primer designing</title>
<p>Primer designing, library preparation, and sequencing were performed at Genotypic Technology&#x2019;s Genomics facility. Eight primer pairs were designed to cover the entire mitochondrial genome. About 10&#xa0;ng of DNA was taken for PCR to amplify explicit products 2&#x2013;3&#xa0;kb in size. All the products (five individual birds&#x2019; pooled DNA PCR samples) were checked using a 1% Agarose gel (<xref ref-type="sec" rid="s13">Supplementary Figure S1</xref>). All products were pooled in equal amounts for sonication utilizing Covaris S220.</p>
</sec>
<sec id="s2-3">
<title>DNA template library preparation and sequencing by Ion PGM&#x2122; sequencer</title>
<p>Library Preparation was done following the Ion Torrent protocol outlined in the Ion plus fragment library kit (ThermoFisher Scientific, United States, &#x23; 4471252). Approximately 500&#xa0;ng of fragmented and cleaned DNA was taken for library preparation. End-repair and adapter ligation was done and the samples were barcoded in this progression. The samples were cleaned utilizing AMPure XP beads. Samples were size-chosen utilizing a 2% low melting agarose gel. The gel-purified samples were amplified for the enrichment of adapter-ligated fragments as per the protocol. The amplified products were cleaned using AMPure XP beads and quantified using Qubit Fluorometer and then run on Bioanalyzer High sensitivity DNA Assay to assess the quality of the library. The purified libraries were then used to prepare clonally amplified templated Ion Sphere&#x2122; Particles (ISPs) for sequencing on an Ion PGM&#x2122; Chip to obtain the essential data coverage. Sequencing was performed on an Ion PGM&#x2122; sequencer at Genotypic Technology&#x2019;s Genomics facility, in Bengaluru, India.</p>
</sec>
<sec id="s2-4">
<title>Quality control for reads and analysis</title>
<p>The samples were sequenced with Ion PGM Sequencer and analyzed with Torrent suite v 3.6. Once the base-calling was done, the raw reads underwent the in-built process of trimming and filtering to obtain only high-quality reads. Trimming was performed to evacuate any undesired base calls, adapter sequences, and lower-quality reads at the 3&#x2032;end of the reads. Filtering at the next step removed reads judged to contain low-quality base calls. These two steps ensured the reads taken were of high quality; the clean reads were used for the subsequent analyses. The raw reads obtained were aligned to the reference <italic>Gallus gallus</italic> mitochondria (NC_001323.1) with the TMAP algorithm. The variants were detected using the inbuilt plugin Variant caller (V4.0) of TS.</p>
</sec>
<sec id="s2-5">
<title>Validation of mtDNA genes with gene-specific primers</title>
<p>The mtDNA gene-specific primers were designed using IDT oligo analyzer software (<xref ref-type="table" rid="T3">Table 3</xref>). The mtDNA genes were amplified using the Prima-96&#x2122; Thermal Cycler (HIMEDIA). PCR amplification was performed in a 25&#xa0;&#x3bc;L volume containing 1&#xa0;&#x3bc;L of DNA template, 2.5&#xa0;&#x3bc;L of 10 &#xd7; PCR buffer with Mg<sup>2&#x2b;</sup>, 2.5&#xa0;&#x3bc;L of dNTP mixture (2.5&#xa0;mM each), 1.25&#xa0;&#x3bc;L of each primer (10&#xa0;&#x3bc;M), 0.5&#xa0;&#x3bc;L of Taq DNA polymerase (5&#xa0;U/&#x3bc;L), and 16&#xa0;&#x3bc;L of nuclease-free water. The PCR conditions were as follows: 95&#xb0;C for 10 min; followed by 35 cycles of 94&#xb0;C for 30&#xa0;s, 53/58&#xb0;C for 30 s, and 72&#xb0;C for 45&#xa0;s; and a final extension at 72&#xb0;C for 10&#xa0;min. The PCR products were detected on 2% agarose gel electrophoresis.</p>
<table-wrap id="T3" position="float">
<label>TABLE 3</label>
<caption>
<p>The PCR primers for segmental amplification of chicken mtDNA genes.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="center">S. No.</th>
<th align="center">Gene name</th>
<th align="center">mtDNA position</th>
<th align="center">Primer sequences (5&#x2032;-3&#x2032;)</th>
<th align="center">Tm (<sup>o</sup>C)</th>
<th align="center">Amplification size (bp)</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td rowspan="2" align="center">1</td>
<td rowspan="2" align="center">D-loop</td>
<td rowspan="2" align="center">270-336</td>
<td align="left">F: GAATGGTTACCGGACATAAAC</td>
<td align="center">50</td>
<td rowspan="2" align="center">67</td>
</tr>
<tr>
<td align="left">R: CCATTCATAGTTAGGTGACTT</td>
<td align="center">49</td>
</tr>
<tr>
<td rowspan="2" align="center">2</td>
<td rowspan="2" align="center">ND4</td>
<td rowspan="2" align="center">11366-11530</td>
<td align="left">F: CCTTGTACCTATTCTAATACTG</td>
<td align="center">47.5</td>
<td rowspan="2" align="center">165</td>
</tr>
<tr>
<td align="left">R: CATACTCTTGCCCACAGCC</td>
<td align="center">55.9</td>
</tr>
<tr>
<td rowspan="2" align="center">3</td>
<td rowspan="2" align="center">D-loop</td>
<td rowspan="2" align="center">216-436</td>
<td align="left">F: CTCATTTACCCTCCCCATAA</td>
<td align="center">50</td>
<td rowspan="2" align="center">221</td>
</tr>
<tr>
<td align="left">R: GTTGCTGATCTCTCGTGAG</td>
<td align="center">51</td>
</tr>
<tr>
<td rowspan="2" align="center">4</td>
<td rowspan="2" align="center">COX1</td>
<td rowspan="2" align="center">8050-8341</td>
<td align="left">F: TATTCATCGTCTGAGAAGCCT</td>
<td align="center">53.1</td>
<td rowspan="2" align="center">292</td>
</tr>
<tr>
<td align="left">R: TGGTTGGCCATGTGAGATG</td>
<td align="center">55.3</td>
</tr>
<tr>
<td rowspan="2" align="center">5</td>
<td rowspan="2" align="center">ND2</td>
<td rowspan="2" align="center">6008-6177</td>
<td align="left">F: ATTAACCGGCTTCATGCCAG</td>
<td align="center">55.7</td>
<td rowspan="2" align="center">170</td>
</tr>
<tr>
<td align="left">R: TTATGTGGTTTGATGAGTTGG</td>
<td align="center">50.7</td>
</tr>
<tr>
<td rowspan="2" align="center">6</td>
<td rowspan="2" align="center">rRNA</td>
<td rowspan="2" align="center">1996-2157</td>
<td align="left">F: AGGTCAAGGTATAGCCTATGA</td>
<td align="center">50</td>
<td rowspan="2" align="center">162</td>
</tr>
<tr>
<td align="left">R: GTATGTACGTGCCTCAGAG</td>
<td align="center">51</td>
</tr>
<tr>
<td rowspan="2" align="center">7</td>
<td rowspan="2" align="center">ND2</td>
<td rowspan="2" align="center">5529-5853</td>
<td align="left">F: ATATTAACAATAGCAATCGCAAC</td>
<td align="center">49.7</td>
<td rowspan="2" align="center">325</td>
</tr>
<tr>
<td align="left">R: AGGTGAGAATAGTGAGTTGTG</td>
<td align="center">51.8</td>
</tr>
<tr>
<td rowspan="2" align="center">8</td>
<td rowspan="2" align="center">ND4</td>
<td rowspan="2" align="center">12476-12796</td>
<td align="left">F: AACACAAACTACGAACGGAT</td>
<td align="center">48</td>
<td rowspan="2" align="center">321</td>
</tr>
<tr>
<td align="left">R: TATGAGAAGATGTTCTCGAG</td>
<td align="center">48</td>
</tr>
<tr>
<td rowspan="2" align="center">9</td>
<td rowspan="2" align="center">rRNA</td>
<td rowspan="2" align="center">3916-4253</td>
<td align="left">F: TCAACTGCCAAGAACCCCC</td>
<td align="center">57.8</td>
<td rowspan="2" align="center">338</td>
</tr>
<tr>
<td align="left">R: GATTGGCTCTTTAATGAATAGT</td>
<td align="center">48.3</td>
</tr>
<tr>
<td rowspan="2" align="center">10</td>
<td rowspan="2" align="center">CYTB</td>
<td rowspan="2" align="center">15115-15391</td>
<td align="left">F: CAATACGGCTGACTCATCCA</td>
<td align="center">52</td>
<td rowspan="2" align="center">277</td>
</tr>
<tr>
<td align="left">R: CTCAGGCTCACTCTACTAG</td>
<td align="center">51</td>
</tr>
<tr>
<td rowspan="2" align="center">11</td>
<td rowspan="2" align="center">D-loop</td>
<td rowspan="2" align="center">1150-1623</td>
<td align="left">F: CACTTAACTCCCCTCACAAG</td>
<td align="center">52</td>
<td rowspan="2" align="center">474</td>
</tr>
<tr>
<td align="left">R: TAGCTGGTGCAGATAACATG</td>
<td align="center">50</td>
</tr>
<tr>
<td rowspan="2" align="center">12</td>
<td rowspan="2" align="center">ND5</td>
<td rowspan="2" align="center">14683-15016</td>
<td align="left">F: CCTCAATCCTCCTACATACT</td>
<td align="center">50.4</td>
<td rowspan="2" align="center">333</td>
</tr>
<tr>
<td align="left">R: ACAGACTGCTAATAGGGAGC</td>
<td align="center">53.8</td>
</tr>
<tr>
<td rowspan="2" align="center">13</td>
<td rowspan="2" align="center">CYTB</td>
<td rowspan="2" align="center">14996-15477</td>
<td align="left">F: GCTCCCTATTAGCAGTCTGT</td>
<td align="center">52</td>
<td rowspan="2" align="center">482</td>
</tr>
<tr>
<td align="left">R: GATAGTAATACCTGCGATTGC</td>
<td align="center">50</td>
</tr>
<tr>
<td rowspan="2" align="center">14</td>
<td rowspan="2" align="center">D-loop</td>
<td rowspan="2" align="center">369-470</td>
<td align="left">F: ACCCATTTGGTTATGCTCGC</td>
<td align="center">52</td>
<td rowspan="2" align="center">101</td>
</tr>
<tr>
<td align="left">R: TGAGACTGGTCATGAAGTAC</td>
<td align="center">50</td>
</tr>
<tr>
<td rowspan="2" align="center">15</td>
<td rowspan="2" align="center">tRNA</td>
<td rowspan="2" align="center">6512-6625</td>
<td align="left">F: CCCGGCACACTTTAGTGTG</td>
<td align="center">53</td>
<td rowspan="2" align="center">114</td>
</tr>
<tr>
<td align="left">R: TGAAGCGTTAGGCTGTAGTC</td>
<td align="center">52</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2-6">
<title>Phylogenetic and molecular evolution analysis</title>
<p>To investigate the evolutionary relationships, a phylogenetic examination was performed using the total mitochondrial DNA and <italic>D-loop</italic> region sequences of seven native Indian chicken breeds along with twenty-two native Asian chicken breeds. Each of the sequence datasets was aligned by Clustal X and analyzed by neighbor-joining (N-J) in MEGA 10.0, and bootstrap analysis was performed with 1000 replications (<xref ref-type="bibr" rid="B9">Buehler and Baker, 2003</xref>; <xref ref-type="bibr" rid="B74">Thompson et al., 1997</xref>; <xref ref-type="bibr" rid="B35">Kumar et al., 2004</xref>). For building a neighbor-joining phylogenetic tree, Kimura&#x2019;s two-parameters model was used for calculating the genetic distance of the haplotypes.</p>
</sec>
<sec id="s2-7">
<title>Haplotypes diversity</title>
<p>Network analysis was used for haplotype diversity illustrated using NETWORK 10.1 (<xref ref-type="bibr" rid="B4">Bandelt et al., 1999</xref>). In chickens, population indices include several segregation sites (<italic>S</italic>), number of haplotypes (<italic>H</italic>), haplotype diversity (Hd), and nucleotide diversity (&#x03C0;), determined by the mtDNA <italic>D-loop</italic> sequences&#x2019; diversity and elucidated by the sequence polymorphism and the content of genetic variability (<xref ref-type="bibr" rid="B52">Nei, 1987</xref>). The DnaSP software version 10.1 was used for analysis and the alignment gaps arising from a deletion event were excluded from the calculations (<xref ref-type="bibr" rid="B61">Rozas et al., 2003</xref>). Between two sequences, the average number of nucleotide differences per site, known as nucleotide diversity (&#x03C0;), was defined as &#x03C0; &#x3d; <italic>n</italic>/(<italic>n</italic> &#x2212;1) &#x3a3;<sub>ij</sub>
<italic>x</italic>
<sub>
<italic>i</italic>
</sub>
<italic>x</italic>
<sub>
<italic>j</italic>
</sub>
<italic>x</italic>
<sub>
<italic>ij</italic>
</sub> or &#x03C0; &#x3d; &#x3a3;&#x03C0;<sub>
<italic>ij</italic>
</sub>/<italic>nc</italic> [<italic>n</italic> &#x3d; number of DNA sequences examined; <italic>x</italic>
<sub>
<italic>i</italic>
</sub> and <italic>x</italic>
<sub>
<italic>j</italic>
</sub> &#x3d; frequencies of the <italic>i</italic>th and <italic>j</italic>th type of DNA sequences; &#x03C0;<sub>
<italic>ij</italic>
</sub> &#x3d; proportion of nucleotides in the respective types of DNA sequences; and <italic>nc</italic> &#x3d; total number of sequence comparisons] (<xref ref-type="bibr" rid="B52">Nei, 1987</xref>). According to the Nei formula, the average heterozygosity or haplotype diversity, &#x210e;, is defined [&#x210e; &#x3d; 2<italic>n</italic> (1&#x2014;&#x3a3;<italic>xi</italic>2)/(2<italic>n</italic>&#x2014;1); <italic>xi</italic> &#x3d; frequency of haplotype and <italic>n</italic> &#x3d; sample size] (<xref ref-type="bibr" rid="B52">Nei, 1987</xref>). The gene or haplotype frequencies were used for assessing the level of genetic differentiation among the population. The <italic>F</italic>st and <italic>N</italic>st significant tests by Arlequin software version 2.000 were used to explore the population&#x2019;s genetic structure (<xref ref-type="bibr" rid="B81">Wright, 1951</xref>; <xref ref-type="bibr" rid="B16">Excoffier et al., 1992</xref>; <xref ref-type="bibr" rid="B64">Schneider et al., 2000</xref>).</p>
</sec>
</sec>
<sec sec-type="results" id="s3">
<title>Results</title>
<p>The proposed whole mtDNA sequence analysis was effectively used to characterize the seven indigenous Indian chickens along with twenty-two native Asian chickens. The blood samples were collected and mtDNA was extracted from seven Indian native chicken breeds: <italic>Aseel</italic>, <italic>Ghagus</italic>, <italic>Nicobari Brown</italic>, <italic>Tellichery</italic>, <italic>Kadaknath</italic>, <italic>Haringhata Black</italic>, and <italic>Red Jungle Fowl</italic>. We successfully amplified mtDNA using an amplification method and NGS sequencing was done using an Ion PGM&#x2122; sequencer at Genotypic Technology&#x2019;s Genomics facility. We obtained 757073, 89859, 105503, 50617, 15764, 264309, and 36685 sequencing reads from seven Indian native chickens, respectively (<xref ref-type="table" rid="T4">Table 4</xref>; <xref ref-type="sec" rid="s13">Supplementary Table S1</xref>). The assembled complete mitochondrial genomes for seven Indian native chickens were submitted to Genbank under accession numbers, KP211418.1, KP211419.1, KP211422.1, KP211424.1, KP211425.1, KP211420.1, and KP211423.1 for <italic>Aseel</italic>, <italic>Ghagus</italic>, <italic>Nicobari Brown</italic>, <italic>Tellichery</italic>, <italic>Kadaknath</italic>, <italic>Haringhata Black</italic>, and <italic>Indian Red Jungle Fowl</italic>, respectively.</p>
<table-wrap id="T4" position="float">
<label>TABLE 4</label>
<caption>
<p>Sequencing reads obtained from seven Indian native breeds.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left"/>
<th align="center">Aseel</th>
<th align="center">Ghagus</th>
<th align="center">Nicobari brown</th>
<th align="center">Tellicherry</th>
<th align="center">Kadaknath</th>
<th align="center">Haringhata black</th>
<th align="center">Indian Red Jungle fowl</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">Total number of reads</td>
<td align="center">757073</td>
<td align="center">89859</td>
<td align="center">105503</td>
<td align="center">50617</td>
<td align="center">15764</td>
<td align="center">264309</td>
<td align="center">36685</td>
</tr>
<tr>
<td align="left">Number of mapped reads</td>
<td align="center">734474</td>
<td align="center">87336</td>
<td align="center">103692</td>
<td align="center">49407</td>
<td align="center">15224</td>
<td align="center">257435</td>
<td align="center">35693</td>
</tr>
<tr>
<td align="left">Average base coverage depth</td>
<td align="center">6303</td>
<td align="center">593</td>
<td align="center">799</td>
<td align="center">387.1</td>
<td align="center">90.22</td>
<td align="center">1672</td>
<td align="center">278.3</td>
</tr>
<tr>
<td align="left">Uniformity of base coverage (%)</td>
<td align="center">84.15</td>
<td align="center">76.81</td>
<td align="center">81.78</td>
<td align="center">61.88</td>
<td align="center">68.34</td>
<td align="center">88.98</td>
<td align="center">71.18</td>
</tr>
<tr>
<td align="left">Genome base coverage at 1x (%)</td>
<td align="center">100.00</td>
<td align="center">100</td>
<td align="center">100</td>
<td align="center">100</td>
<td align="center">99.68</td>
<td align="center">100</td>
<td align="center">100</td>
</tr>
<tr>
<td align="left">Genome base coverage at 20x (%)</td>
<td align="center">100.00</td>
<td align="center">99.87</td>
<td align="center">99.57</td>
<td align="center">91.16</td>
<td align="center">65.31</td>
<td align="center">100</td>
<td align="center">91.12</td>
</tr>
</tbody>
</table>
</table-wrap>
<p>The complete length of mtDNA of Indian local chickens was 16,775 bp. Like most vertebrates, it contains a common structure, including 2 <italic>rRNA</italic> genes, 22 <italic>tRNA</italic> genes, 12 protein-coding genes, and 1 <italic>D-loop</italic> region (<xref ref-type="bibr" rid="B38">Lin et al., 2016</xref>; <xref ref-type="bibr" rid="B23">Gu and Li, 2020</xref>). The four nucleotides&#x2019; (i.e., A, T, G, and C) overall composition of assessed mtDNA was 30.26%, 23.76%, 32.48%, and 13.50%, in the order G &#x3e; A &#x3e; T &#x3e; C, respectively. The inception codons for all the coding proteins was ATG, aside from <italic>COX1</italic> which is GTG (<xref ref-type="table" rid="T5">Table 5</xref>). The heavy (H) strand of mtDNA encoded all the mtDNA genes and the light (L) strand encoded four sorts of <italic>tRNA</italic> genes and <italic>ND6</italic> genes. Every one of these genes had 15 spaces in the length of 2&#x2013;227&#xa0;bp and had 3 overlaps in the length of 1-8 bp. These genes had three sorts of termination codons, namely TAA, TAG, and TGA. The &#x201c;T&#x2013; &#x2013; &#x201c; is the 5&#x2032;terminal of the adjoining gene (<xref ref-type="bibr" rid="B3">Anderson et al., 1981</xref>). The lengths of the two <italic>rRNA</italic> genes were 976&#xa0;bp and 1621&#xa0;bp. Among 12 protein-coding genes, the longest one was the <italic>ND5</italic> gene (1818&#xa0;bp) and the most limited one was the <italic>ND4L</italic> gene (297&#xa0;bp). As seen in other types of chicken, four <italic>tRNA</italic> genes were circulated in protein-coding genes, varying from 66 to 135&#xa0;bp in size (<xref ref-type="bibr" rid="B86">Yu et al., 2016</xref>; <xref ref-type="bibr" rid="B40">Liu et al., 2016a</xref>; <xref ref-type="bibr" rid="B41">Liu et al., 2016b</xref>; <xref ref-type="bibr" rid="B39">Lin et al., 2019</xref>). The <italic>D-loop</italic> region was situated among <italic>ND6</italic> and <italic>rRNA</italic> with a length of 1227 bp (<xref ref-type="table" rid="T5">Table 5</xref>; <xref ref-type="sec" rid="s13">Supplementary Table S2</xref>).</p>
<table-wrap id="T5" position="float">
<label>TABLE 5</label>
<caption>
<p>Organization of the mitochondrial genome of seven native Indian chickens.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th rowspan="2" align="center">Gene name</th>
<th colspan="2" align="center">Position</th>
<th align="center">Size</th>
<th colspan="2" align="center">Codon</th>
<th rowspan="2" align="center">Anticodon</th>
<th rowspan="2" align="center">Strand</th>
<th rowspan="2" align="center">Space/Overlap&#x2b;</th>
</tr>
<tr>
<th align="center">Start</th>
<th align="center">End</th>
<th align="left"/>
<th align="center">Start</th>
<th align="center">Stop</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">D-loop</td>
<td align="center">1</td>
<td align="center">1227</td>
<td align="center">1227</td>
<td align="left"/>
<td align="left"/>
<td align="left"/>
<td align="left"/>
<td align="left"/>
</tr>
<tr>
<td align="left">rRNA</td>
<td align="center">1297</td>
<td align="center">2272</td>
<td align="center">976</td>
<td align="left"/>
<td align="left"/>
<td align="left"/>
<td align="center">H</td>
<td align="center">70</td>
</tr>
<tr>
<td align="left">rRNA</td>
<td align="center">2346</td>
<td align="center">3966</td>
<td align="center">1621</td>
<td align="left"/>
<td align="left"/>
<td align="left"/>
<td align="center">H</td>
<td align="center">74</td>
</tr>
<tr>
<td align="left">ND1</td>
<td align="center">4050</td>
<td align="center">5024</td>
<td align="center">975</td>
<td align="center">ATG</td>
<td align="center">TAA</td>
<td align="left"/>
<td align="center">H</td>
<td align="center">84</td>
</tr>
<tr>
<td align="left">ND2</td>
<td align="center">5241</td>
<td align="center">6281</td>
<td align="center">1041</td>
<td align="center">ATG</td>
<td align="center">TAG</td>
<td align="left"/>
<td align="center">H</td>
<td align="center">217</td>
</tr>
<tr>
<td align="left">tRNA-Cys</td>
<td align="center">6508</td>
<td align="center">6573</td>
<td align="center">66</td>
<td align="left"/>
<td align="left"/>
<td align="center">GCA</td>
<td align="center">L</td>
<td align="center">227</td>
</tr>
<tr>
<td align="left">COX1</td>
<td align="center">6645</td>
<td align="center">8132</td>
<td align="center">1488</td>
<td align="center">ATG</td>
<td align="center">T--</td>
<td align="left"/>
<td align="center">H</td>
<td align="center">72</td>
</tr>
<tr>
<td align="left">tRNA-Ser</td>
<td align="center">8124</td>
<td align="center">8258</td>
<td align="center">135</td>
<td align="left"/>
<td align="left"/>
<td align="center">UGA/GCU</td>
<td align="center">L</td>
<td align="center">&#x2212;8</td>
</tr>
<tr>
<td align="left">tRNA-Asp</td>
<td align="center">8261</td>
<td align="center">8329</td>
<td align="center">69</td>
<td align="left"/>
<td align="left"/>
<td align="center">GUC</td>
<td align="center">L</td>
<td align="center">3</td>
</tr>
<tr>
<td align="left">COX2</td>
<td align="center">8331</td>
<td align="center">9014</td>
<td align="center">684</td>
<td align="center">ATG</td>
<td align="center">TAA</td>
<td align="left"/>
<td align="center">H</td>
<td align="center">2</td>
</tr>
<tr>
<td align="left">ATP6</td>
<td align="center">9240</td>
<td align="center">9923</td>
<td align="center">884</td>
<td align="left"/>
<td align="left"/>
<td align="left"/>
<td align="center">H</td>
<td align="center">226</td>
</tr>
<tr>
<td align="left">COX3</td>
<td align="center">9923</td>
<td align="center">10706</td>
<td align="center">784</td>
<td align="center">ATG</td>
<td align="center">T--</td>
<td align="left"/>
<td align="center">H</td>
<td align="center">&#x2212;1</td>
</tr>
<tr>
<td align="left">ND3</td>
<td align="center">10776</td>
<td align="center">11126</td>
<td align="center">351</td>
<td align="center">ATG</td>
<td align="center">TAA</td>
<td align="left"/>
<td align="center">H</td>
<td align="center">70</td>
</tr>
<tr>
<td align="left">ND4L</td>
<td align="center">11196</td>
<td align="center">11492</td>
<td align="center">297</td>
<td align="center">ATG</td>
<td align="center">TAA</td>
<td align="left"/>
<td align="center">H</td>
<td align="center">70</td>
</tr>
<tr>
<td align="left">ND4</td>
<td align="center">11486</td>
<td align="center">12863</td>
<td align="center">1378</td>
<td align="center">ATG</td>
<td align="center">T--</td>
<td align="left"/>
<td align="center">H</td>
<td align="center">&#x2212;6</td>
</tr>
<tr>
<td align="left">ND5</td>
<td align="center">13071</td>
<td align="center">14888</td>
<td align="center">1818</td>
<td align="center">ATG</td>
<td align="center">TAA</td>
<td align="left"/>
<td align="center">H</td>
<td align="center">208</td>
</tr>
<tr>
<td align="left">CYTB</td>
<td align="center">14893</td>
<td align="center">16035</td>
<td align="center">1143</td>
<td align="center">ATG</td>
<td align="center">TAA</td>
<td align="left"/>
<td align="center">H</td>
<td align="center">5</td>
</tr>
<tr>
<td align="left">tRNA-Pro</td>
<td align="center">16108</td>
<td align="center">16177</td>
<td align="center">70</td>
<td align="left"/>
<td align="left"/>
<td align="center">UGG</td>
<td align="center">L</td>
<td align="center">73</td>
</tr>
<tr>
<td align="left">ND6</td>
<td align="center">16184</td>
<td align="center">16705</td>
<td align="center">522</td>
<td align="center">ATG</td>
<td align="center">TAA</td>
<td align="left"/>
<td align="center">L</td>
<td align="center">7</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>T&#x2013;&#x2212;means incomplete termination codon; Negative numbers indicate overlapping nucleotides.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<sec id="s3-1">
<title>Pattern of mtDNA <italic>D-Loop</italic> variability</title>
<p>The 1227 bp mtDNA <italic>D-loop</italic> fluctuation design uncovered large variations between nucleotides 235 and 1209. In seven local Indian chicken breeds, eight haplotypes were related to variation at 28 destinations, and 8.33% of them were polymorphic (<xref ref-type="fig" rid="F2">Figure 2</xref>). The total arrangement uncovered exceptionally high changeability in the mtDNA <italic>D-loop</italic> region between 164&#x2013;360 bases; this variation comprises 23.5% of the seven successions. This rate is incredibly high contrasted with the other local chicken varieties at 5.54%&#x2013;7.05% (<xref ref-type="bibr" rid="B55">Niu et al., 2002</xref>; <xref ref-type="bibr" rid="B43">Liu et al., 2004</xref>). This high pace of mtDNA <italic>D-loop</italic> variation might be credited to the relocation of birds all through the nation and diverse topographical districts in India. The base composition of the native Indian chicken breeds mtDNA <italic>D-loop</italic> shows that A&#x2b;T grouping content was 60.39% while G&#x2b;C was 39.61% (<xref ref-type="bibr" rid="B62">Ruokonen and Kvist, 2002</xref>).</p>
<fig id="F2" position="float">
<label>FIGURE 2</label>
<caption>
<p>Pattern of mtDNA <italic>D-loop</italic> variability. Nucleotide polymorphisms were observed in the <italic>D-loop</italic> region of seven native Indian chicken sequences. Vertically oriented numbers indicate the site position and the sequences shown are only the variable sites. Dots (.) indicate identity with the reference sequence and different base letters denote substitution.</p>
</caption>
<graphic xlink:href="fgene-14-1083976-g002.tif"/>
</fig>
</sec>
<sec id="s3-2">
<title>Sequence variation and haplotype distribution</title>
<p>Multiple sequence alignment was performed for seven native Indian chicken varieties and recognized eight haplotypes. The alignment of <italic>D-loop</italic> sequences was finished with a <italic>gallus</italic> reference sequence (NC_001323.1) utilizing Clustal-X. The accompanying domains and motifs were examined at the 5&#x2032;end of the D-loop. Two units of invariant tetradecamer 5&#x2032;- AACTATGAATGGTT-3&#x2032; were distinguished at positions 264 to 277 and 325 to 338. An interfered with thymine string (TTTTATTTTTTAA) was observed as conserved in all the individuals contemplated. There was likewise an intrusion of poly-C sequence (5&#x2032;- CCCCCCCTTTCCCC-3&#x2032;), which is generally conserved, and downstream to this there was a preserved sequence known as poly-G (5&#x2032;-AGGGGGGGT-3&#x2032;). Two moderated 5&#x2032;- TACAT-3&#x2032; and 5&#x2032;- TATAT-3&#x2032; were likewise found in all individuals. There were nine TATAT motifs and four TACAT found inside the <italic>D-loop</italic> and were, thus, conserved. The initial 163 base sets adjoining <italic>tRNA</italic> Glu were seen as exceptionally conserved in all individuals. The nucleotide replacements found in the nine variable haplotypes contained one G/T and two C/A transversions and the rest were all changes of which four were A/G transitions and seven were C/T transitions. This exhibits a solid predisposition towards transition. The C/T substitutions are more normal than the A/G substitution (<xref ref-type="table" rid="T6">Table 6</xref>).</p>
<table-wrap id="T6" position="float">
<label>TABLE 6</label>
<caption>
<p>Each entry is the probability of substitution (r) from one base (row) to another base (column). Substitution pattern and rates were estimated under the <xref ref-type="bibr" rid="B72">Tamura and Nei. (1993)</xref> model (<xref ref-type="bibr" rid="B72">Tamura and Nei, 1993</xref>). Rates of different transitional substitutions are shown in bold and those of transversionsal substitutions are shown in italics. Relative values of instantaneous r should be considered when evaluating them. For simplicity, sum of r values is made equal to 100, The nucleotide frequencies are A &#x3d; 30.26%, T/U &#x3d; 23.76%, C &#x3d; 32.48%, and G &#x3d; 13.50%. For estimating ML values, a tree topology was automatically computed. The maximum Log likelihood for this computation was &#x2212;23504.716. This analysis involved 9 nucleotide sequences. Codon positions included were 1st &#x2b; 2nd &#x2b; 3rd &#x2b; Noncoding. There were a total of 16775 positions in the final dataset. Evolutionary analyses were conducted in MEGA X (<xref ref-type="bibr" rid="B34">Kumar et al., 2018</xref>).</p>
</caption>
<table>
<thead valign="top">
<tr>
<th colspan="5" align="center">Maximum likelihood estimate of substitution matrix</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="center" style="background-color:#c6c7c9">
</td>
<td align="center" style="background-color:#c6c7c9">A</td>
<td align="center" style="background-color:#c6c7c9">T/U</td>
<td align="center" style="background-color:#c6c7c9">C</td>
<td align="center" style="background-color:#c6c7c9">G</td>
</tr>
<tr>
<td align="center">A</td>
<td align="center">-</td>
<td align="center">1.28</td>
<td align="center">1.75</td>
<td align="center">13.47</td>
</tr>
<tr>
<td align="center">T/U</td>
<td align="center">1.63</td>
<td align="center">-</td>
<td align="center">26.33</td>
<td align="center">0.73</td>
</tr>
<tr>
<td align="center">C</td>
<td align="center">1.63</td>
<td align="center">19.26</td>
<td align="center">-</td>
<td align="center">0.73</td>
</tr>
<tr>
<td align="center">G</td>
<td align="center">30.18</td>
<td align="center">1.28</td>
<td align="center">1.75</td>
<td align="center">-</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s3-3">
<title>Genetic distance among seven native Indian chicken breeds</title>
<p>The genetic distances within and between the seven native Indian chicken breeds were analyzed using the DnaSP program 10.1 (<xref ref-type="table" rid="T7">Table 7</xref>). The genetic distance within the seven chicken breeds was 0.000655&#x2013;16.173895. Indian <italic>RJF</italic> chickens had the most noteworthy within-breed genetic distance, while <italic>Ghagus</italic> chickens had the least. Between the breeds, the genetic distance estimates went from 0.000655 to 16.188613. The genetic distance between the breeds was most noteworthy for Indian <italic>RJF</italic> and <italic>Tellicherry</italic> chickens, while it was least for <italic>Ghagus</italic> and <italic>Aseel</italic> chickens. An incredible number of variants and SNPs were recognized in <italic>Nicobari Brown</italic> and a minimal number of variants and SNPs were distinguished in <italic>Tellicherry</italic> and <italic>Kadaknath</italic>, respectively. The most number of INDELs were distinguished in <italic>Kadaknath</italic> and the least number of INDELs were recognized in <italic>Tellicherry</italic> (<xref ref-type="table" rid="T8">Table 8</xref>).</p>
<table-wrap id="T7" position="float">
<label>TABLE 7</label>
<caption>
<p>Genetic distance between each pair among the seven Indian native chicken breeds.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="center">Breed</th>
<th align="center">Aseel</th>
<th align="center">Ghagus</th>
<th align="center">Nicobari brown</th>
<th align="center">Tellicherry</th>
<th align="center">Kadaknath</th>
<th align="center">Haringhata black</th>
<th align="center">Indian Red Jungle fowl</th>
<th align="center">Reference Red Jungle fowl</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">Aseel</td>
<td align="left"/>
<td align="left"/>
<td align="left"/>
<td align="left"/>
<td align="left"/>
<td align="left"/>
<td align="left"/>
<td align="left"/>
</tr>
<tr>
<td align="left">Ghagus</td>
<td align="center">0.000655</td>
<td align="left"/>
<td align="left"/>
<td align="left"/>
<td align="left"/>
<td align="left"/>
<td align="left"/>
<td align="left"/>
</tr>
<tr>
<td align="left">Nicobari brown</td>
<td align="center">0.003525</td>
<td align="center">0.003344</td>
<td align="left"/>
<td align="left"/>
<td align="left"/>
<td align="left"/>
<td align="left"/>
<td align="left"/>
</tr>
<tr>
<td align="left">Tellicherry</td>
<td align="center">0.002028</td>
<td align="center">0.001729</td>
<td align="center">0.003045</td>
<td align="left"/>
<td align="left"/>
<td align="left"/>
<td align="left"/>
<td align="left"/>
</tr>
<tr>
<td align="left">Kadaknath</td>
<td align="center">0.001132</td>
<td align="center">0.001073</td>
<td align="center">0.003225</td>
<td align="center">0.001730</td>
<td align="left"/>
<td align="left"/>
<td align="left"/>
<td align="left"/>
</tr>
<tr>
<td align="left">Haringhata black</td>
<td align="center">0.001371</td>
<td align="center">0.001192</td>
<td align="center">0.003464</td>
<td align="center">0.001789</td>
<td align="center">0.001073</td>
<td align="left"/>
<td align="left"/>
<td align="left"/>
</tr>
<tr>
<td align="left">Indian Red Jungle Fowl</td>
<td align="center">16.173895</td>
<td align="center">16.138058</td>
<td align="center">16.175363</td>
<td align="center">16.188613</td>
<td align="center">16.182522</td>
<td align="center">16.123728</td>
<td align="left"/>
<td align="left"/>
</tr>
<tr>
<td align="left">Reference Red Jungle Fowl</td>
<td align="center">0.002267</td>
<td align="center">0.002447</td>
<td align="center">0.003165</td>
<td align="center">0.002507</td>
<td align="center">0.002088</td>
<td align="center">0.002447</td>
<td align="center">16.154633</td>
<td align="left"/>
</tr>
</tbody>
</table>
</table-wrap>
<table-wrap id="T8" position="float">
<label>TABLE 8</label>
<caption>
<p>The number of variants, SNPs and INDELs identified in seven Indian chicken mitochondrial genome.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="center">Sample ID</th>
<th align="center">Total number of variants</th>
<th align="center">Number of SNPs</th>
<th align="center">Number of INDELs</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">Aseel</td>
<td align="center">43</td>
<td align="center">43</td>
<td align="center">9</td>
</tr>
<tr>
<td align="left">Ghagus</td>
<td align="center">56</td>
<td align="center">46</td>
<td align="center">10</td>
</tr>
<tr>
<td align="left">Nicobari brown</td>
<td align="center">61</td>
<td align="center">52</td>
<td align="center">9</td>
</tr>
<tr>
<td align="left">Tellicherry</td>
<td align="center">42</td>
<td align="center">35</td>
<td align="center">7</td>
</tr>
<tr>
<td align="left">Kadaknath</td>
<td align="center">46</td>
<td align="center">21</td>
<td align="center">25</td>
</tr>
<tr>
<td align="left">Haringhata black</td>
<td align="center">54</td>
<td align="center">41</td>
<td align="center">13</td>
</tr>
<tr>
<td align="left">Indian Red Jungle Fowl</td>
<td align="center">43</td>
<td align="center">34</td>
<td align="center">9</td>
</tr>
<tr>
<td align="left">Total</td>
<td align="center">345</td>
<td align="center">272</td>
<td align="center">82</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s3-4">
<title>Phylogenetic analysis of the haplotypes</title>
<p>An N-J tree indicated that the examined Asian native breeds and Indian local varieties were separated into six significant clades: A, B, C, D, E, and F. The native Indian breeds are situated at the base of the tree (<xref ref-type="fig" rid="F3">Figure 3</xref>). This N-J tree produced from the total mitochondrial DNA of twenty-two native Asian breeds and seven local Indian varieties has comparative geographies. The clades A to E shared the native Asian breeds but clade F shared only native Indian breeds. Along these lines, our outcomes affirmed that <italic>Kadaknath</italic>-<italic>H. black</italic> and <italic>Aseel</italic>-<italic>Ghagus</italic> breeds have a nearby hereditary relationship. In addition, the N-J tree is generated from the <italic>NADH dehydrogenase subunit</italic> genes, <italic>cytochrome c oxidase subunit</italic> genes, mitochondrial encoded <italic>ATP synthase membrane subunit 6</italic> gene, <italic>cytochrome b</italic> gene, and <italic>ribosomal RNA</italic> genes. The results showed a close hereditary relationship with <italic>Aseel</italic>-<italic>Ghagus</italic> and <italic>Nicobari brown</italic>-Reference <italic>RJF</italic> (<xref ref-type="fig" rid="F5">Figures 5</xref>&#x2013;<xref ref-type="fig" rid="F8">8</xref>).</p>
<fig id="F3" position="float">
<label>FIGURE 3</label>
<caption>
<p>An N-J tree was constructed using MEGA 10.1 software. Phylogenetic analysis based on mtDNA <italic>D-loop</italic> region <bold>(A)</bold> and complete mtDNA genome sequences <bold>(B)</bold> of seven Indian native breads along with reference <italic>RJF</italic> mtDNA and twenty-two native Asian breeds sequences. The mtDNA genome sequences were obtained from the NGS sequencing and submitted in NCBI (Accession numbers: Aseel-KP211418.1; Ghagus-KP211419.1; Haringhata Black-KP211420.1; Kadaknath-KP211425.1; Nicobari Brown-KP211422.1; Indian Red Jungle Fowl-KP211423.1; Tellichery-KP211424.1). The numbers at the nodes represent the percentage bootstrap values for interior branches after 1000 replications.</p>
</caption>
<graphic xlink:href="fgene-14-1083976-g003.tif"/>
</fig>
</sec>
<sec id="s3-5">
<title>Network analysis</title>
<p>Median-joining networks were drawn for the eight haplotypes identified from the seven Indian native chickens along with reference <italic>RJF</italic> mtDNA, based on the variable characters of the complete alignment using the computer program NETWORK 10.1 (<xref ref-type="bibr" rid="B4">Bandelt et al., 1999</xref>). The results showed that the mtDNA sequence of Indian Red Jungle Fowl has the highest frequencies and this haplotype is connected to the frequencies of other haplotypes, forming star-like connections. It was also observed that there are mutational links to eight haplotypes with five median vectors (mv)&#x2217; separating clades (<xref ref-type="fig" rid="F4">Figure 4</xref>). The median-joining network examination was completed with the haplotypes from the native Indian breeds. The outcomes show that, out of the seven recognized native breeds haplotypes, just two breeds haplotypes i.e. <italic>Kadaknath</italic> and <italic>Haringhata</italic> black, showed uniqueness and fell into a different clade separated from other breeds. Also, median-joining networks were drawn for mtDNA structural genes, such as <italic>NADH dehydrogenase subunit</italic> genes, <italic>cytochrome c oxidase subunit</italic> genes, mitochondrial encoded <italic>ATP synthase membrane subunit 6</italic> gene, <italic>cytochrome b</italic> gene, and <italic>ribosomal RNA</italic> genes. The results showed that three breeds of haplotype i.e. <italic>Indian RJF</italic>, <italic>Kadaknath</italic>, and <italic>H. black</italic>, have uniqueness (<xref ref-type="fig" rid="F5">Figures 5</xref>&#x2013;<xref ref-type="fig" rid="F8">8</xref>).</p>
<fig id="F4" position="float">
<label>FIGURE 4</label>
<caption>
<p>A median-joining network was produced by the network software 10.1 for eight haplotypes of native Indian chicken breeds along with reference mtDNA based on the polymorphic site of the mtDNA <italic>D-loop</italic> region <bold>(A)</bold> and complete mtDNA sequences <bold>(B)</bold>. The area of each yellow circle is proportional to the frequency of the corresponding haplotype. The pink dots illustrate median vectors (mv) and the numbers on each link line represent mutated positions.</p>
</caption>
<graphic xlink:href="fgene-14-1083976-g004.tif"/>
</fig>
<fig id="F5" position="float">
<label>FIGURE 5</label>
<caption>
<p>An N-J tree was constructed using MEGA 10.1 software. Phylogenetic analysis <bold>(A, C, E, G, I, K, and M)</bold> based on mtDNA <italic>NADH dehydrogenase</italic> subunit gene sequences of seven native Indian breeds along with reference <italic>RJF</italic>. The numbers at the nodes represent the percentage of bootstrap values for interior branches after 1,000 replications. A median-joining network was produced by the network software 10.1 for Indian native chicken breeds along with reference mtDNA based on polymorphic site of the mtDNA <italic>NADH dehydrogenase</italic> genes <bold>(B, D, F, H, J, L, and N)</bold>. The area of each yellow circle is proportional to the frequency of the corresponding haplotype. The pink dots illustrate median vectors (mv) and the numbers on each link line represent mutated positions.</p>
</caption>
<graphic xlink:href="fgene-14-1083976-g005.tif"/>
</fig>
<fig id="F6" position="float">
<label>FIGURE 6</label>
<caption>
<p>An N-J tree was constructed using MEGA 10.1 software. Phylogenetic analysis <bold>(A,C,E)</bold> based on mtDNA <italic>Cytochrome c oxidase subunit</italic> gene sequences of seven native Indian breeds along with reference <italic>RJF</italic>. The numbers at the nodes represent the percentage of bootstrap values for interior branches after 1000 replications. A median-joining network was produced by the network software 10.1 for native Indian chicken breeds along with reference mtDNA based on the polymorphic site of the mtDNA <italic>Cytochrome c oxidase subunit</italic> genes <bold>(B,D,F)</bold>. The area of each yellow circle is proportional to the frequency of the corresponding haplotype. The pink dots illustrate median vectors (mv) and the numbers on each link line represent mutated positions.</p>
</caption>
<graphic xlink:href="fgene-14-1083976-g006.tif"/>
</fig>
<fig id="F7" position="float">
<label>FIGURE 7</label>
<caption>
<p>An N-J tree was constructed using MEGA 10.1 software. Phylogenetic analysis <bold>(A,C)</bold> based on mtDNA <italic>ATP synthase membrane subunit 6</italic> and <italic>Cytochrome b</italic> gene sequences of seven native Indian breeds along with reference <italic>RJF</italic>. The numbers at the nodes represent the percentage of bootstrap values for interior branch after 1000 replications. A median-joining network was produced by the network software 10.1 for native Indian chicken breeds along with reference mtDNA based on the polymorphic site of the mtDNA <italic>ATP synthase membrane subunit 6</italic> and <italic>Cytochrome b</italic> genes <bold>(B,D)</bold>. The area of each yellow circle is proportional to the frequency of the corresponding haplotype. The pink dots illustrate median vectors (mv) and the numbers on each link line represent mutated positions.</p>
</caption>
<graphic xlink:href="fgene-14-1083976-g007.tif"/>
</fig>
<fig id="F8" position="float">
<label>FIGURE 8</label>
<caption>
<p>An N-J tree was constructed using MEGA 10.1 software. Phylogenetic analysis <bold>(A,C)</bold> based on mtDNA <italic>Ribosomal RNA</italic> 1 and 2 gene sequences of seven native Indian breeds along with reference <italic>RJF</italic>. The numbers at the nodes represent the percentage of bootstrap values for interior branches after 1000 replications. A median-joining network was produced by the network software 10.1 for native Indian chicken breeds along with reference mtDNA based on the polymorphic site of the mtDNA <italic>Ribosomal RNA</italic> 1 and 2 genes <bold>(B,D)</bold>. The area of each yellow circle is proportional to the frequency of the corresponding haplotype. The pink dots illustrate median vectors (mv) and the numbers on each link line represent mutated positions.</p>
</caption>
<graphic xlink:href="fgene-14-1083976-g008.tif"/>
</fig>
</sec>
<sec id="s3-6">
<title>The mtDNA genes validation</title>
<p>Genomic DNA was extracted from blood samples of seven native Indian chicken breeds and mtDNA genes were validated by PCR using gene-specific primers. PCR was able to amplify the segmental mtDNA region from all seven native breeds. Each expected PCR-amplified product demonstrated the sign band of approximately 67&#x2013;482&#xa0;bp in length on 2% agarose gel (<xref ref-type="table" rid="T3">Table 3</xref>; <xref ref-type="sec" rid="s13">Supplementary Figures S2, S3</xref>). The Aseel-specific <italic>ND4</italic> primers (12476&#x2013;12796 region) amplified all the breeds except <italic>Ghagus</italic>, whereas <italic>Aseel rRNA</italic>-specific primers (3916&#x2013;4253 region) amplified all the breeds except <italic>Ghagus</italic> and <italic>H. black</italic>. The <italic>Ghagus</italic>-specific <italic>ND4</italic> primers (11366&#x2013;11530 region) amplified <italic>Indian RJF</italic>, <italic>Nicobari</italic>, <italic>Kadaknath</italic>, and <italic>Ghagus</italic> but did not amplify <italic>Aseel</italic>, <italic>H. black</italic>, and <italic>Tellicherry</italic>, whereas <italic>Ghagus rRNA</italic>-specific primers (1996&#x2013;2157 region) amplified all the breeds except <italic>Tellicherry</italic>. The <italic>Kadaknath COX1</italic> specific primers (8050&#x2013;8341 region) amplified all the breeds except <italic>Tellicherry</italic>.</p>
</sec>
</sec>
<sec sec-type="discussion" id="s4">
<title>Discussion</title>
<p>It is hypothesized that chickens (<italic>Gallus gallus domesticus</italic>) were domesticated from wild jungle fowls in Southeast Asia approximately 10,000 years ago (<xref ref-type="bibr" rid="B1">Ahmed et al., 2017</xref>). Native fowl extinction can be improved by modifying cultivation, taking care of the chickens, and better prosperity spread. However, selection and crossbreeding can be used for genetic improvement. Aside from conventional breeding, molecular breeding techniques (Microsatellite markers and SNPs), functional genomics, gene silencing, and genome editing techniques can be used to improve the quality of traits in chickens. Microsatellite markers, SSCP, and sequencing techniques can be used to distinguish proof of polymorphism on genes and assessment of the impact of polymorphism on growth traits in chickens. Molecular genetics has given a few useful assets to exploit the extraordinary abundance of polymorphism at the DNA level, for example, DNA-based genetic markers. The advantage of mtDNA is that it is present in higher copy numbers within the cells and thus can be recovered even from highly degraded specimens (<xref ref-type="bibr" rid="B20">Fumihito et al., 1996</xref>). For species identification, forensic studies, and anthropological and evolutionary research, the mitochondrial genome SNPs are assuming a significant role (<xref ref-type="bibr" rid="B84">Yacoub and Fathi, 2013</xref>). In 2016, single nucleotide polymorphism was observed, and eleven SNPs in the <italic>D-loop</italic> region of chicken mitochondrial DNA were reported (<xref ref-type="bibr" rid="B27">Jia et al., 2016</xref>).</p>
<p>To set up a phylogenetic relationship, studies were conducted on domestic fowl, different RJF subspecies, and other jungle fowls. In 1994, an investigation proposed that <italic>G.g. gallus</italic> is a major or sole contributor to a single domestication event, and three further species of <italic>RJF</italic> mtDNA <italic>D-loop</italic> region sequences were taken for phylogenetic analysis. This proved <italic>G.g. gallus</italic> is the real matriarchic origin of all the domestic poultry (<xref ref-type="bibr" rid="B19">Fumihito et al., 1994</xref>; <xref ref-type="bibr" rid="B20">Fumihito et al., 1996</xref>). In 2009, two ribosomal genes (<italic>12S rRNA</italic> and <italic>16S rRNA</italic>) were used to study the genetic divergence between Indian RJF (<italic>G.g. murghi</italic>), Gallus gallus subspecies (<italic>G.g. spadicus</italic>, <italic>G.g. gallus,</italic> and <italic>G.g. bankiva</italic>) including <italic>G.g. domesticus</italic> (domestic fowl), and three other Gallus species (<italic>G. varius</italic>, <italic>G. lafayetei</italic>, and <italic>G. sonneratii</italic>) and found that, compared to other jungle fowls, <italic>G.g. murghi</italic> was closer to <italic>Gallus gallus</italic> subspecies, however between Indian <italic>RJF</italic> and other <italic>RJF</italic> subspecies, the divergence was very low (<xref ref-type="bibr" rid="B24">Gupta et al., 2009</xref>). Furthermore, the study found no noticeable contrasts between <italic>G.g. spadicus</italic> and <italic>G.g. gallus</italic> yet <italic>G.g. bankiva</italic> showed contrasts with both the genetic and phylogenetic relationships among these species (<xref ref-type="bibr" rid="B78">Ulfah et al., 2016</xref>). Recent studies confirmed multiple domestications of Indian and other domestic chickens and provided evidence for the domestication of Indian birds from <italic>G.g. spadiceus</italic>, <italic>G.g. gallus</italic>, and <italic>G.g. murghi</italic> (<xref ref-type="bibr" rid="B31">Kanginakudru et al., 2008</xref>; <xref ref-type="bibr" rid="B45">Mekchay et al., 2014</xref>; <xref ref-type="bibr" rid="B44">Maw et al., 2015</xref>). These studies avoided the two different subspecies of red jungle fowl i.e. <italic>G.g. murghi</italic> and <italic>G.g. jabouillei</italic>, however, they provided a framework for genetic studies in wild jungle fowls and native and domestic chicken breeds. Considering solid confirmations of the domestication of chicken in the Indus valley, it might be interesting to contemplate the genetic relatedness between <italic>Indian RJF</italic> and other <italic>RJF</italic> subspecies including <italic>G.g. domesticus</italic> and other jungle fowls (<xref ref-type="bibr" rid="B32">Kawabe et al., 2014</xref>).</p>
<p>Indian <italic>RJFs</italic> are widely distributed across 51 &#xd7; 10<sup>5</sup>&#xa0;km<sup>2</sup> in 21 states of India (<xref ref-type="bibr" rid="B17">Fernandes et al., 2009</xref>; Mogilicherla et al., 2022) (<xref ref-type="fig" rid="F1">Figure 1</xref>). We were more interested to explore the phylogenetic relationship of Indian <italic>RJF</italic> with reference <italic>RJF</italic> and native Asian breeds along with other native Indian breeds and understand the contribution of Indian <italic>RJF</italic>, <italic>G.&#xa0;g. murghi</italic>, to the domestication event. Hence, in the present study, seven native Indian breeds (<italic>Aseel</italic>, <italic>Ghagus</italic>, <italic>Nicobari brown</italic>, <italic>Kadaknath</italic>, <italic>Tellicherry</italic>, <italic>H. black</italic>, and <italic>Indian Red Jungle fowl</italic>) and twenty-two native Asian breeds were used to study the nucleotide sequence variation in complete mtDNA and the most variable region of mtDNA <italic>D-loop</italic> region to build up the phylogenetic relationship among the Indian breeds (<xref ref-type="table" rid="T1">Table 1</xref>; <xref ref-type="table" rid="T2">Table 2</xref>). Currently, no sequence data is accessible from these seven native Indian breeds. However, one of these breeds is likely to have been a contributor to one of the earliest known chicken domestication events, for example in the Mohanjo-Daro Indus valley.</p>
<p>The preserved traits like Struthioniformes, Falconiformes, and Sphenisciformes have been depicted across a variety of avian species (<xref ref-type="bibr" rid="B25">Haring et al., 2001</xref>; <xref ref-type="bibr" rid="B79">Wani et al., 2014</xref>). The Indian indigenous chicken <italic>D-loop</italic> area sequence has cytosines and guanine strings close to each other, making the advancement of a consistent hairpin structure possible (<xref ref-type="bibr" rid="B60">Quinn and Wilson, 1993</xref>). In all neighborhood chickens of India, the conserved sequence motifs of TACAT and TATAT were found. Such subjects are depicted as termination-associated sequence segments (TASs) with mtDNA synthesis (<xref ref-type="bibr" rid="B18">Foran et al., 1988</xref>). Both <italic>Galliformes</italic> and mammals have TASs, which may propose a strong auxiliary capacity of the <italic>D-loop</italic> area of the two genera, while the lack of variety in TASs among the <italic>Galliformes</italic> may be a direct result of the particular utilitarian constraints. The eight haplotypes recognized from the Indian indigenous chicken and the phylogenetic examination spoke to the formative associations.</p>
<p>A large number of the investigations on domestic chicken origins have focused on the <italic>D-Loop</italic>; there were additionally a few examinations concentrating on mitochondrial genomics to analyze domestic chicken origins (<xref ref-type="bibr" rid="B46">Miao et al., 2013</xref>). Kauai feral chicken mitochondrial phylogenies (<italic>D-loop</italic> and whole mtDNA) revealed two different clades within their samples (<xref ref-type="bibr" rid="B21">Gering et al., 2015</xref>). Maybe the reason for the difference was that the samples for the examination were different between the whole mtDNA phylogeny and mtDNA <italic>D-loop</italic> phylogeny. We found that the mitochondrial phylogenies (<italic>D-loop</italic> and whole Mt genome) uncovered a few clades, and their examination re-evaluated the worldwide mtDNA profiles of chickens and encouraged our study of the settlement in India.</p>
<p>From the mtDNA examination, we saw that Indian <italic>RJF</italic> is the origin of reference <italic>RJF</italic> as well as Indian breeds (i.e. <italic>Aseel</italic>, <italic>Ghagus</italic>, <italic>Nicobari brown</italic>, <italic>Kadaknath</italic>, <italic>H. black</italic>, and <italic>Tellicherry</italic>). The reference <italic>RJF</italic> is closely related to the Indian reference <italic>RJF</italic>, which, in turn, has contributed to the genetic makeup of six native Indian breeds. This is likewise true for the Indian chicken, which originated from independent domestication from Indian <italic>RJF</italic> and likely from other <italic>RJF</italic> species. Curiously, the mixing of various Indian breeds with Indian <italic>RJF</italic> could explain how the current-day Asiatic chicken may have originated from various ancestors through numerous domestication events and such multi-origin breeds could still be seen in a single geographical location. This is in agreement with the current-day perceptions of native Japanese chickens that originated from various regions (<xref ref-type="bibr" rid="B56">Oka et al., 2007</xref>). However, all the breeds aside from Indian <italic>RJF</italic> form a solitary group, suggesting a common ancestor for these birds, including jungle fowls and domestic birds. The separation of the Indian <italic>RJF</italic> from the main group of breeds shows the possibility of a speciation event. Our examination uncovered that the Indian breeds are relatively pure with uncommon hybridization with reference <italic>RJF</italic>. In the current investigation of Indian breeds, we did not come across recognizable hybridization at least in the recent past, as shown by a clear separation of Indian <italic>RJF</italic> clades from reference <italic>RJF</italic> in mtDNA-based phylogeny. All these results indicate the genetic integrity of the Indian <italic>RJF</italic>.</p>
<p>In high-altitude birds, hypoxia is an unavoidable environmental stress; in natural selection, every step of aerobic respiration had to be experienced to improve the adaptability to hypoxia (<xref ref-type="bibr" rid="B2">Altshuler and Dudley, 2006</xref>; <xref ref-type="bibr" rid="B67">Scott, 2011</xref>; <xref ref-type="bibr" rid="B66">Scott and Milsom, 2006</xref>). Mitochondria play an important role in aerobic respiration through oxidative phosphorylation, because the majority of produced cell ATP is consumed for cellular oxygen uptake (<xref ref-type="bibr" rid="B10">Chandel and Schumacker, 2000</xref>; <xref ref-type="bibr" rid="B83">Xu et al., 2007</xref>). To determine the role of mitochondrial genes in high-altitude adaptation, six high-altitude Phasianidae birds and 16 low-altitude relatives&#x2019; mitochondrial genomes were analyzed, and four lineages were found for this high-altitude habitat (<xref ref-type="bibr" rid="B89">Zhou et al., 2014</xref>). Their results strongly suggest that the adaptive evolution of mitochondrial genes, i.e. <italic>ND2</italic>, <italic>ND4</italic>, and <italic>ATP6,</italic> played a critical role during the independent acclimatization to high altitude by galliform birds. In Tibet, a chicken breed was found to have a missense mutation in the <italic>MT-ND5</italic> subunit of the <italic>NADH dehydrogenase</italic> gene for high-altitude adaptation (<xref ref-type="bibr" rid="B5">Bao et al., 2007</xref>). To explore the regulatory mechanisms for hypoxia adaptability, the <italic>ATP-6</italic> gene was sequenced from 28 Tibetan chickens and 29 Chinese domestic chickens; six SNPs were detected (<xref ref-type="bibr" rid="B88">Zhao et al., 2015</xref>). In high-altitude adaption, <italic>cytochrome c oxidase</italic> (<italic>COX</italic>) was the key mitochondrial gene and plays an important role in oxidative phosphorylation regulation and oxygen sensing transfer. For identifying the <italic>COX</italic> gene SNP, the Tibet Chicken and four lowland chicken breeds (Dongxiang Chicken, Silky Chicken, Hubbard ISA White broiler, and Leghorn layer) were used and 13 haplotypes were defined for the 14 SNPs. It was concluded that the significant difference in <italic>MT-CO3</italic> gene mutation might have a relationship with the high-altitude adaptation (<xref ref-type="bibr" rid="B6">Bao et al., 2008</xref>). <italic>MT-CO3</italic> gene was sequenced by using 125 Tibetan chickens and 144 Chinese domestic chickens; eight SNPs were identified, and were defined into nine haplotypes. They found positive and negative haplotype associations with high-altitude adaptation (<xref ref-type="bibr" rid="B70">Sun et al., 2013</xref>). However, the <italic>MT-COI</italic> gene was sequenced from 29 Tibetan chickens and 30 Chinese domestic chickens, and nine SNPs were detected (<xref ref-type="bibr" rid="B88">Zhao et al., 2015</xref>). In our study, <italic>ND3</italic>, <italic>ND4</italic>, <italic>ND5</italic>, <italic>ATP6</italic>, <italic>COX1</italic>, and <italic>COX2</italic> showed high-altitude lineages between <italic>Nicobari brown</italic> and Reference <italic>RJF</italic> birds which may help chickens to evolve to adapt to Nicobari Island environments (<xref ref-type="fig" rid="F5">Figures 5</xref>&#x2013;<xref ref-type="fig" rid="F8">8</xref>).</p>
<p>mtDNA mutations contribute to enclosing both tissue-specific and multiple-system disorders in human diseases (<xref ref-type="bibr" rid="B73">Taylor and Turnbull, 2005</xref>; <xref ref-type="bibr" rid="B77">Tuppen et al., 2010</xref>). The spindle-associated chromosomal exchange did not show antagonistic consequences for fertilization on subsequent embryo/fetal development in the rhesus monkey (<xref ref-type="bibr" rid="B71">Tachibana et al., 2009</xref>). Subsequently, this method may speak to another dependable restorative way to deal with the transmission of mtDNA mutations in influenced families. Mitochondrial heterogeneity is the presence of at least two kinds of mitochondrial (mt) DNA in the same individual/tissue/cell and it is firmly related to animal health and disease. In mtDNA, <italic>ND2</italic> is a protein-coding gene and it partakes in the mitochondrial respiratory chain and oxidative phosphorylation. In cloned sequencing of the <italic>ND2</italic> region, numerous potential heteroplasmic locales were recognized, which possibly reflected bountiful heteroplasmy in the chicken mitochondrial genome (<xref ref-type="bibr" rid="B85">Yang et al., 2020</xref>). These outcomes give a significant reference for further research on heteroplasmy in chicken mitochondria. Recently, an examination utilized complete mtDNA from <italic>tuberculosis</italic> patients&#x2019; blood samples and explored the conceivable mtDNA variations (<xref ref-type="bibr" rid="B76">Tonsing et al., 2020</xref>). Twenty-eight non-synonymous variants were found and most of the variations lie in the <italic>D-loop</italic> of the non-protein-coding region of the mitochondrial DNA. Runting and stunting syndrome (RSS) generally happens early in life and causes low body weight and extensive economic losses in the commercial broiler industry (<xref ref-type="bibr" rid="B30">Kang et al., 2012</xref>). In sex-linked dwarf (SLD) chickens, the RSS is related to mitochondria dysfunction, and mutations in the TWNK gene are one reason for mtDNA exhaustion (<xref ref-type="bibr" rid="B37">Li et al., 2019</xref>; <xref ref-type="bibr" rid="B26">Hu et al., 2020</xref>). We recommend that mutations in the mitochondrial genome should be validated further to fully understand their relationship with animal diseases.</p>
</sec>
<sec id="s5">
<title>Limitations of the work</title>
<p>Deep sampling using the NGS technique offers a straightforward, high-throughput, and cost-effective platform for effectively detecting and measuring mitochondrial heteroplasmy in complete mitochondrial genomes. The main limitation of this research is that only seven native Indian breeds were used. Nevertheless, the information that was collected will be useful in finding heteroplasmy in various chicken breeds both domestically and internationally.</p>
</sec>
<sec sec-type="conclusion" id="s6">
<title>Conclusion</title>
<p>In summary, the eight haplotypes of the native chicken population showed a relatively rich genetic pool, and molecular information on genetic diversity revealed may help in developing genetic improvement and conservation strategies to better utilize precious genetic reserves. The phylogenetic relationship of native Indian chicken breeds using entire mtDNA and D-loop sequences showed that the South East Asian <italic>RJF</italic> is distant from the Indian <italic>RJF</italic> but genetically close to the Indian breeds, whereas the Indian <italic>Aseel</italic> breed was more closely related to the reference <italic>RJF</italic> than the Indian <italic>RJF</italic>. The grouping of Indian <italic>RJF</italic> separated from Indian native chickens and the presence of subcontinent explicit haplogroups gives additional proof for an independent domestication event of chickens in the subcontinent. For high-altitude hypoxic adaptation, it is important to improve the efficiency of oxygen usage instead of enhancing oxygen uptake and transport. Thus, in natural selection, the mitochondrial genome encoded 12 essential structural genes (6 <italic>NADH dehydrogenase</italic> genes, <italic>cytochrome b subunit</italic>, 3 <italic>cytochrome c oxidase</italic>, and <italic>ATP synthase subunit</italic>), which must have mutated during adaptation to high-altitude hypoxic conditions.</p>
</sec>
</body>
<back>
<sec sec-type="data-availability" id="s7">
<title>Data availability statement</title>
<p>The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/<xref ref-type="sec" rid="s13">Supplementary Material</xref>.</p>
</sec>
<sec id="s8">
<title>Ethics statement</title>
<p>The animal study was reviewed and approved by Institute Animal Ethics Committee.</p>
</sec>
<sec id="s9">
<title>Author contributions</title>
<p>MK analyzed the data and prepared the draft manuscript. TB developed the idea, planned the research work, carried out the wet lab experiment, and edited the draft. RC analyzed the data and prepared the tables and graphs, MR collected the samples of chicken breeds and MD isolated DNA samples. All authors contributed to the article and approved the submitted version.</p>
</sec>
<sec id="s10">
<title>Funding</title>
<p>The work was funded by the Department of Science and Technology (SERB) (Project No. CRG/2018/002246), the Government of India.</p>
</sec>
<ack>
<p>The authors acknowledge the WBUAFS, West Bengal, and CSKHPKVV, Palampur for providing blood samples to carry out the research work. The corresponding author also extends thanks and gratitude to the Department of Science and Technology (SERB), Government of India (Project No. CRG/2018/002246) for providing financial support to carry out the research work.</p>
</ack>
<sec sec-type="COI-statement" id="s11">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec sec-type="disclaimer" id="s12">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s13">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fgene.2023.1083976/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fgene.2023.1083976/full&#x23;supplementary-material</ext-link>
</p>
<supplementary-material>
<label>SUPPLEMENTARY FIGURE S1</label>
<caption>
<p>PCR products are loaded on 1% agarose gel. Samples A1-A11-<italic>Aseel</italic>; A13-A23-<italic>Ghagus</italic>; B1-B11-<italic>Nicobari brown</italic>; B13-B23-<italic>Nicobari black</italic>; C1-C11-<italic>Tellichery</italic>; C13-C23-<italic>Kadaknath</italic>; D1-D11-<italic>Haringhata</italic>; D13-D23-<italic>Red Jungle Fowl</italic>; A12, B12, C12, D12 are ladder.</p>
</caption>
</supplementary-material>
<supplementary-material>
<label>SUPPLEMENTARY FIGURE S2</label>
<caption>
<p>Validation of mtDNA <italic>D-loop </italic>
<bold>(A)</bold> and <italic>NADH dehydrogenase</italic> gene <bold>(B)</bold> regions with <italic>D-loop</italic> and <italic>NADH</italic> gene-specific primers, respectively. F-Female; M-Male; 1-100 bp DNA ladder; 2-negative control; 3- Indian <italic>RJF</italic>; 4- <italic>Nicobari</italic>; 5- <italic>Kadaknath</italic>; 6- <italic>Ghagus</italic>; 7- <italic>Aseel</italic>; 8- <italic>Haringhata black</italic>; 9- <italic>Tellicherry</italic>.</p>
</caption>
</supplementary-material>
<supplementary-material>
<label>SUPPLEMENTARY FIGURE S3</label>
<caption>
<p>Validation of mtDNA <italic>COX1</italic>, <italic>tRNA</italic>, <italic>rRNA</italic>, and <italic>CYTB</italic> gene regions with gene-specific primers, respectively. F-Female; M-Male; 1-100 bp DNA ladder; 2-negative control; 3- Indian <italic>RJF</italic>; 4- <italic>Nicobari</italic>; 5- <italic>Kadaknath</italic>; 6- <italic>Ghagus</italic>; 7- <italic>Aseel</italic>; 8- <italic>Haringhata black</italic>; 9- <italic>Tellicherry</italic>.</p>
</caption>
</supplementary-material>
<supplementary-material>
<label>SUPPLEMENTARY TABLE S1</label>
<caption>
<p>Single nucleotide variants (SNVs) called in whole mtDNA sequencing analysis of samples from seven native Indian chicken breeds. The results from sequencing 500ng total mtDNA extracted from whole blood.</p>
</caption>
</supplementary-material>
<supplementary-material>
<label>SUPPLEMENTARY TABLE S2</label>
<caption>
<p>Organization of the mitochondrial genome in seven native Indian chicken breeds.</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="Image3.tif" id="SM1" mimetype="application/tif" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Image2.tif" id="SM2" mimetype="application/tif" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Image1.tif" id="SM3" mimetype="application/tif" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table1.doc" id="SM4" mimetype="application/doc" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table2.doc" id="SM5" mimetype="application/doc" xmlns:xlink="http://www.w3.org/1999/xlink"/>
</sec>
<sec id="s14">
<title>Abbreviations</title>
<p>
<italic>ATP6</italic>, mitochondrial encoded ATP synthase membrane subunit 6; <italic>COX1</italic>, cytochrome c oxidase subunit I; <italic>COX2</italic>, cytochrome c oxidase subunit II; <italic>COX3</italic>, cytochrome c oxidase subunit III; <italic>CYTB</italic>, Cytochrome b; INDELs, Insertions, and deletions; ICAR-NBAGR, Indian council for the agricultural research-National bureau of animal genetic resources; mtDNA, Mitochondrial DNA, NGS, Next generation sequencing; <italic>NAD1</italic>, NADH dehydrogenase subunit 1; <italic>NAD2</italic>, NADH dehydrogenase subunit 2; <italic>NAD3</italic>, NADH dehydrogenase subunit 3; <italic>NAD4</italic>, NADH dehydrogenase subunit 4; <italic>NAD5</italic>, NADH dehydrogenase subunit 5; <italic>NAD6</italic>, NADH dehydrogenase subunit 6; OXPHOS, oxidative phosphorylation; RJF, Red Jungle Fowl; rRNA, Ribosomal RNA; RSS, Runting and stunting syndrome; SNP, Single-nucleotide polymorphism; SEA, South East Asia; SLD, sex-linked dwarf; TWNK, Twinkle mtDNA helicase.</p>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ahmed</surname>
<given-names>S. U.</given-names>
</name>
<name>
<surname>Shukla</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Das</surname>
<given-names>H.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Molecular Characterization of Mitochondrial D Loop of Indian Red Jungle Fowl</article-title>. <source>Int. J. Livest. Res.</source> <volume>7</volume> (<issue>6</issue>), <fpage>1</fpage>&#x2013;<lpage>152</lpage>. <pub-id pub-id-type="doi">10.5455/ijlr.20170423033604</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Altshuler</surname>
<given-names>D. L.</given-names>
</name>
<name>
<surname>Dudley</surname>
<given-names>R.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>The physiology and biomechanics of avian flight at high altitude</article-title>. <source>Integr. Comp. Biol.</source> <volume>46</volume>, <fpage>62</fpage>&#x2013;<lpage>71</lpage>. <pub-id pub-id-type="doi">10.1093/icb/icj008</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Anderson</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Bankier</surname>
<given-names>A. T.</given-names>
</name>
<name>
<surname>Barrell</surname>
<given-names>B. G.</given-names>
</name>
<name>
<surname>de Bruijn</surname>
<given-names>M. H.</given-names>
</name>
<name>
<surname>Coulson</surname>
<given-names>A. R.</given-names>
</name>
<name>
<surname>Drouin</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>1981</year>). <article-title>Sequence and organization of the human mitochondrial genome</article-title>. <source>Nature</source> <volume>290</volume> (<issue>5806</issue>), <fpage>457</fpage>&#x2013;<lpage>465</lpage>. <pub-id pub-id-type="doi">10.1038/290457a0</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bandelt</surname>
<given-names>H. J.</given-names>
</name>
<name>
<surname>Forster</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Rohl</surname>
<given-names>A.</given-names>
</name>
</person-group> (<year>1999</year>). <article-title>Median-joining networks for inferring intraspecific phylogenies</article-title>. <source>Mol. Biol. Evol.</source> <volume>16</volume> (<issue>1</issue>), <fpage>37</fpage>&#x2013;<lpage>48</lpage>. <pub-id pub-id-type="doi">10.1093/oxfordjournals.molbev.a026036</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bao</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>C.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Association of MT-ND5 gene variation with mitochondrial respiratory control ratio and NADH dehydrogenase activity in Tibet chicken embryos</article-title>. <source>Anim. Genet.</source> <volume>38</volume>, <fpage>514</fpage>&#x2013;<lpage>516</lpage>. <pub-id pub-id-type="doi">10.1111/j.1365-2052.2007.01622.x</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bao</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>C.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Sequencing and alignment of mitochondrial genomes of Tibetan chicken and two lowland chicken breeds</article-title>. <source>Sci. China Life Sci.</source> <volume>51</volume>, <fpage>47</fpage>&#x2013;<lpage>51</lpage>. <pub-id pub-id-type="doi">10.1007/s11427-008-0005-0</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Beebe</surname>
<given-names>W.</given-names>
</name>
</person-group> (<year>1918</year>). <source>Monograph of the Pheasants</source>. <publisher-loc>London, UK</publisher-loc>: <publisher-name>New York Zoological Society</publisher-name>.</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Brisbin</surname>
<given-names>I. L.</given-names>
</name>
<name>
<surname>Peterson</surname>
<given-names>A. T.</given-names>
</name>
<name>
<surname>Okimoto</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Amato</surname>
<given-names>R. G.</given-names>
</name>
</person-group> (<year>2002</year>). <article-title>Characterization of the genetic status of populations of red jungle fowl</article-title>. <source>J. Bombay Nat. Hist. Soc.</source> <volume>99</volume>, <fpage>217</fpage>&#x2013;<lpage>223</lpage>.</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Buehler</surname>
<given-names>D. M.</given-names>
</name>
<name>
<surname>Baker</surname>
<given-names>A. J.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Characterization of the red knot (Calidris canutus) mitochondrial control region</article-title>. <source>Genome</source> <volume>46</volume> (<issue>4</issue>), <fpage>565</fpage>&#x2013;<lpage>572</lpage>. <pub-id pub-id-type="doi">10.1139/g03-034</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chandel</surname>
<given-names>N. S.</given-names>
</name>
<name>
<surname>Schumacker</surname>
<given-names>P. T.</given-names>
</name>
</person-group> (<year>2000</year>). <article-title>Cellular oxygen sensing by mitochondria: old questions, new insight</article-title>. <source>J. Appl. Physiol.</source> <volume>88</volume>, <fpage>1880</fpage>&#x2013;<lpage>1889</lpage>. <pub-id pub-id-type="doi">10.1152/jappl.2000.88.5.1880</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Crawford</surname>
<given-names>R.</given-names>
</name>
</person-group> (<year>1984</year>). &#x201c;<article-title>Domestic fowl</article-title>,&#x201d; in <source>Evolution of Domesticated Animals</source>. Editor <person-group person-group-type="editor">
<name>
<surname>Mason</surname>
<given-names>L. L.</given-names>
</name>
</person-group> (<publisher-loc>London</publisher-loc>: <publisher-name>Longman</publisher-name>), <fpage>298</fpage>&#x2013;<lpage>311</lpage>.</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Danforth</surname>
<given-names>C. H.</given-names>
</name>
</person-group> (<year>1958</year>). <article-title>Gallus sonnerati and the domestic fowl</article-title>. <source>J. Hered.</source> <volume>49</volume>, <fpage>167</fpage>&#x2013;<lpage>170</lpage>. <pub-id pub-id-type="doi">10.1093/oxfordjournals.jhered.a106797</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Darwin</surname>
<given-names>C.</given-names>
</name>
</person-group> (<year>1868</year>). <source>The Variation of Animals and Plants Under Domestication</source>. <publisher-loc>London, UK</publisher-loc>: <publisher-name>John Murray</publisher-name>.</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Di Lorenzo</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Ceccobelli</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Panella</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Attard</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Lasagna</surname>
<given-names>E.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>The role of mitochondrial DNA to determine the origin of domestic chicken</article-title>. <source>World&#x27;s Poult. Sci. J.</source> <volume>71</volume> (<issue>2</issue>), <fpage>311</fpage>&#x2013;<lpage>318</lpage>. <pub-id pub-id-type="doi">10.1017/S0043933915000318</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Eriksson</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Larson</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Gunnarsson</surname>
<given-names>U.</given-names>
</name>
<name>
<surname>Bed&#x27;Hom</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Tixier-Boichard</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Str&#xf6;mstedt</surname>
<given-names>L.</given-names>
</name>
<etal/>
</person-group> (<year>2008</year>). <article-title>Identification of the yellow skin gene reveals a hybrid origin of the domestic chicken</article-title>. <source>PLoS Genet</source> <volume>4</volume>, <fpage>e1000010</fpage>. <pub-id pub-id-type="doi">10.1371/journal.pgen.1000010</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Excoffier</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Smouse</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Quattro</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>1992</year>). <article-title>Analysis of molecular variance inferred from metric distances among DNA haplotypes: application to human mitochondrial DNA restriction data</article-title>. <source>Genetics</source> <volume>131</volume> (<issue>2</issue>), <fpage>479</fpage>&#x2013;<lpage>491</lpage>. <pub-id pub-id-type="doi">10.1093/genetics/131.2.479</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fernandes</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Mukesh</surname>
<given-names>S. S.</given-names>
</name>
<name>
<surname>Sathyakumar</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Kaul</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Kalsi</surname>
<given-names>R. S.</given-names>
</name>
<name>
<surname>Sharma</surname>
<given-names>D.</given-names>
</name>
</person-group> (<year>2009</year>). <article-title>Conservation of red junglefowl Gallus gallus in India</article-title>. <source>Int. J. Galli. Conserv.</source> <volume>1</volume>, <fpage>94</fpage>&#x2013;<lpage>101</lpage>.</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Foran</surname>
<given-names>D. R.</given-names>
</name>
<name>
<surname>Hixson</surname>
<given-names>J. E.</given-names>
</name>
<name>
<surname>Brown</surname>
<given-names>W. M.</given-names>
</name>
</person-group> (<year>1988</year>). <article-title>Comparisons of ape and human sequences that regulate mitochondrial DNA transcription and D-loop DNA synthesis</article-title>. <source>Nucleic Acids Res</source> <volume>16</volume> (<issue>13</issue>), <fpage>5841</fpage>&#x2013;<lpage>5861</lpage>. <pub-id pub-id-type="doi">10.1093/nar/16.13.5841</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fumihito</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Miyake</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Sumi</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Takada</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Ohno</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Kondo</surname>
<given-names>N.</given-names>
</name>
</person-group> (<year>1994</year>). <article-title>One subspecies of the red junglefowl (Gallus gallus gallus) suffices as the matriarchic ancestor of all domestic breeds</article-title>. <source>Proc. Natl. Acad. Sci. U. S. A.</source> <volume>91</volume> (<issue>26</issue>), <fpage>12505</fpage>&#x2013;<lpage>12509</lpage>. <pub-id pub-id-type="doi">10.1073/pnas.91.26.12505</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fumihito</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Miyake</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Takada</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Shingu</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Endo</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Gojobori</surname>
<given-names>T.</given-names>
</name>
<etal/>
</person-group> (<year>1996</year>). <article-title>Monophyletic origin and unique dispersal patterns of domestic fowls</article-title>. <source>Proc. Natl. Acad. Sci. U. S. A.</source> <volume>93</volume> (<issue>13</issue>), <fpage>6792</fpage>&#x2013;<lpage>6795</lpage>. <pub-id pub-id-type="doi">10.1073/pnas.93.13.6792</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gering</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Johnsson</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Willis</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Getty</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Wright</surname>
<given-names>D.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Mixed ancestry and admixture in Kauai&#x27;s feral chickens: invasion of domestic genes into ancient Red Junglefowl reservoirs</article-title>. <source>Mol. Ecol.</source> <volume>24</volume> (<issue>9</issue>), <fpage>2112</fpage>&#x2013;<lpage>24</lpage>. <pub-id pub-id-type="doi">10.1111/mec.13096</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gifford-Gonzalez</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Hanotte</surname>
<given-names>O.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Domesticating animals in Africa: implications of genetic and archaeological findings</article-title>. <source>J. World Prehist.</source> <volume>24</volume>, <fpage>1</fpage>&#x2013;<lpage>23</lpage>. <pub-id pub-id-type="doi">10.1007/s10963-010-9042-2</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Next-generation sequencing of the complete mitochondrial genome of the Piao chicken (Gallus gallus)</article-title>. <source>Mit. DNA Part B</source> <volume>5</volume> (<issue>3</issue>), <fpage>2870</fpage>&#x2013;<lpage>2871</lpage>. <pub-id pub-id-type="doi">10.1080/23802359.2020.1791755</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gupta</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Mathew</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Shukla</surname>
<given-names>S. J. K.</given-names>
</name>
<name>
<surname>Mehra</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Mehra</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Sharma</surname>
<given-names>A.</given-names>
</name>
<etal/>
</person-group> (<year>2009</year>). <article-title>Mitochondrial DNA variation within and between the Gallus species</article-title>. <source>Asian J. Microbiol. Biotechnol. Environ. Sci.</source> <volume>11</volume> (<issue>4</issue>), <fpage>717</fpage>&#x2013;<lpage>721</lpage>.</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Haring</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Kruckenhauser</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Gamauf</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Riesing</surname>
<given-names>M. J.</given-names>
</name>
<name>
<surname>Pinsker</surname>
<given-names>W.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>The complete sequence of the mitochondrial genome of Buteo buteo (Aves, Accipitridae) indicates an early split in the phylogeny of raptors</article-title>. <source>Mol. Biol. Evol.</source> <volume>18</volume> (<issue>10</issue>), <fpage>1892</fpage>&#x2013;<lpage>904</lpage>. <pub-id pub-id-type="doi">10.1093/oxfordjournals.molbev.a003730</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hu</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Liao</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Wei</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>D.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Mutation of TWNK Gene Is One of the Reasons of Runting and Stunting Syndrome Characterized by mtDNA Depletion in Sex-Linked Dwarf Chicken</article-title>. <source>Front. Cell Dev. Biol.</source> <volume>8</volume>, <fpage>581</fpage>. <pub-id pub-id-type="doi">10.3389/fcell.2020.00581</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jia</surname>
<given-names>X-X.</given-names>
</name>
<name>
<surname>Tang</surname>
<given-names>X-J.</given-names>
</name>
<name>
<surname>Lu</surname>
<given-names>J-X.</given-names>
</name>
<name>
<surname>Fan</surname>
<given-names>Y-F.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>D-W.</given-names>
</name>
<name>
<surname>Tang</surname>
<given-names>M-J.</given-names>
</name>
<etal/>
</person-group> (<year>2016</year>). <article-title>The investigation of genetic diversity and evolution of Daweishan Mini chicken based on the complete mitochondrial (mt) DNA D-loop region sequence</article-title>. <source>Mit. DNA Part A</source> <volume>27</volume> (<issue>4</issue>), <fpage>3001</fpage>&#x2013;<lpage>3004</lpage>. <pub-id pub-id-type="doi">10.3109/19401736.2015.1060478</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Karsli</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Balc&#x131;o&#x11f;lu</surname>
<given-names>M. S.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Genetic characterization and population structure of six brown layer pure lines using microsatellite markers</article-title>. <source>Asian-Australas. J. Anim. Sci.</source> <volume>32</volume> (<issue>1</issue>), <fpage>49</fpage>&#x2013;<lpage>57</lpage>. <pub-id pub-id-type="doi">10.5713/ajas.17.0870</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kanakachari</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Rahman</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Chatterjee</surname>
<given-names>R. N.</given-names>
</name>
<name>
<surname>Bhattacharya</surname>
<given-names>T. K.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Signature of Indian native chicken breeds: a perspective</article-title>. <source>World&#x27;s Poult. Sci. J.</source> <volume>78</volume> (<issue>2</issue>), <fpage>421</fpage>&#x2013;<lpage>445</lpage>. <pub-id pub-id-type="doi">10.1080/00439339.2022.2026201</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kang</surname>
<given-names>K. I.</given-names>
</name>
<name>
<surname>El-Gazzar</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Sellers</surname>
<given-names>H. S.</given-names>
</name>
<name>
<surname>Dorea</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Williams</surname>
<given-names>S. M.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>T.</given-names>
</name>
<etal/>
</person-group> (<year>2012</year>). <article-title>Investigation into the aetiology of runting and stunting syndrome in chickens</article-title>. <source>Avian Pathol</source> <volume>41</volume> (<issue>1</issue>), <fpage>41</fpage>&#x2013;<lpage>50</lpage>. <pub-id pub-id-type="doi">10.1080/03079457.2011.632402</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kanginakudru</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Metta</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Jakati</surname>
<given-names>R. D.</given-names>
</name>
<name>
<surname>Nagaraju</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Genetic evidence from Indian red jungle fowl corroborates multiple domestication of modern day chicken</article-title>. <source>BMC Evol. Biol.</source> <volume>8</volume>, <fpage>174</fpage>&#x2013;<lpage>178</lpage>. <pub-id pub-id-type="doi">10.1186/1471-2148-8-174</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kawabe</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Worawut</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Taura</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Shimogiri</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Nishida</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Okamoto</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Genetic Diversity of mtDNA D-loop Polymorphisms in Laotian Native Fowl Populations</article-title>. <source>Asian-Australas. J. Anim. Sci.</source> <volume>27</volume> (<issue>1</issue>), <fpage>19</fpage>&#x2013;<lpage>23</lpage>. <pub-id pub-id-type="doi">10.5713/ajas.2013.13443</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Keeling</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Andersson</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Sch&#xfc;tz</surname>
<given-names>K. E.</given-names>
</name>
<name>
<surname>Kerje</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Fredriksson</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Carlborg</surname>
<given-names>&#xd6;.</given-names>
</name>
<etal/>
</person-group> (<year>2004</year>). <article-title>Chicken genomics: feather-pecking and victim pigmentation</article-title>. <source>Nature</source> <volume>431</volume>, <fpage>645</fpage>&#x2013;<lpage>646</lpage>. <pub-id pub-id-type="doi">10.1038/431645a</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kumar</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Stecher</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Knyaz</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Tamura</surname>
<given-names>K.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>MEGA X: molecular evolutionary genetics analysis across computing platforms</article-title>. <source>Mol. Biol. Evol.</source> <volume>35</volume>, <fpage>1547</fpage>&#x2013;<lpage>1549</lpage>. <pub-id pub-id-type="doi">10.1093/molbev/msy096</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kumar</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Tamura</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Nei</surname>
<given-names>M.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment</article-title>. <source>Brief. Bioinformatics</source> <volume>5</volume> (<issue>2</issue>), <fpage>150</fpage>&#x2013;<lpage>163</lpage>. <pub-id pub-id-type="doi">10.1093/bib/5.2.150</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="thesis">
<person-group person-group-type="author">
<name>
<surname>Lawal</surname>
<given-names>R. A.</given-names>
</name>
</person-group> (<year>2017</year>). &#x201c;<article-title>Signatures of Selection and Introgression in the Genus Gallus</article-title>,&#x201d;. <comment>Ph.D. thesis</comment> (<publisher-loc>Nottingham</publisher-loc>: <publisher-name>University of Nottingham</publisher-name>).</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Luo</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Luo</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>B.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Runting and stunting syndrome is associated with mitochondrial dysfunction in sex-linked dwarf chicken</article-title>. <source>Front. Genet.</source> <volume>10</volume>, <fpage>1337</fpage>. <pub-id pub-id-type="doi">10.3389/fgene.2019.01337</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lin</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Cao</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>G. T.</given-names>
</name>
<name>
<surname>Qiu</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>G. B.</given-names>
</name>
<name>
<surname>Dai</surname>
<given-names>Q. Z.</given-names>
</name>
<etal/>
</person-group> (<year>2016</year>). <article-title>The complete mitochondrial genome of the Xupu goose</article-title>. <source>Mit. DNA Part A</source> <volume>27</volume> (<issue>2</issue>), <fpage>1010</fpage>&#x2013;<lpage>1011</lpage>. <pub-id pub-id-type="doi">10.3109/19401736.2014.926528</pub-id>
</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lin</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>G. T.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>Y. H.</given-names>
</name>
<name>
<surname>Yan</surname>
<given-names>H. F.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Lu</surname>
<given-names>B.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Removal of bisphenol A from aqueous solution via host-guest interactions based on beta-cyclodextrin grafted cellulose bead</article-title>. <source>Braz. J. Poult. Sci.</source> <volume>21</volume>, <fpage>1</fpage>&#x2013;<lpage>9</lpage>. <pub-id pub-id-type="doi">10.1016/j.ijbiomac.2019.08.116</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname>
<given-names>L. L.</given-names>
</name>
<name>
<surname>Xie</surname>
<given-names>H. B.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Y. S.</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>Q. F.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>J. H.</given-names>
</name>
</person-group> (<year>2016a</year>). <article-title>The complete mitochondrial genome of the Xuefeng black-boned chicken</article-title>. <source>Mit. DNA Part A</source> <volume>27</volume> (<issue>1</issue>), <fpage>30</fpage>&#x2013;<lpage>31</lpage>. <pub-id pub-id-type="doi">10.3109/19401736.2013.869679</pub-id>
</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname>
<given-names>L. L.</given-names>
</name>
<name>
<surname>Xie</surname>
<given-names>H. B.</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>Q. F.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>S. P.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>J. H.</given-names>
</name>
</person-group> (<year>2016b</year>). <article-title>Determination and analysis of the complete mitochondrial genome sequence of Taoyuan chicken</article-title>. <source>Mit. DNA part A</source> <volume>27</volume> (<issue>1</issue>), <fpage>371</fpage>&#x2013;<lpage>372</lpage>. <pub-id pub-id-type="doi">10.3109/19401736.2014.895991</pub-id>
</citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname>
<given-names>Y. P.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>G. S.</given-names>
</name>
<name>
<surname>Yao</surname>
<given-names>Y. G.</given-names>
</name>
<name>
<surname>Miao</surname>
<given-names>Y. W.</given-names>
</name>
<name>
<surname>Luikart</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Baig</surname>
<given-names>M.</given-names>
</name>
<etal/>
</person-group> (<year>2006</year>). <article-title>Multiple maternal origins of chickens: out of the Asian jungles</article-title>. <source>Mol. Phylogenet. Evol.</source> <volume>38</volume> (<issue>1</issue>), <fpage>12</fpage>&#x2013;<lpage>19</lpage>. <pub-id pub-id-type="doi">10.1016/j.ympev.2005.09.014</pub-id>
</citation>
</ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname>
<given-names>Z. G.</given-names>
</name>
<name>
<surname>Lei</surname>
<given-names>C. Z.</given-names>
</name>
<name>
<surname>Luo</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Ding</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>G. H.</given-names>
</name>
<name>
<surname>Chang</surname>
<given-names>H.</given-names>
</name>
<etal/>
</person-group> (<year>2004</year>). <article-title>Genetic variability of mtDNA sequences in Chinese native chicken breeds</article-title>. <source>Asian-Australs. J. Anim. Sci.</source> <volume>17</volume> (<issue>7</issue>), <fpage>903</fpage>&#x2013;<lpage>909</lpage>. <pub-id pub-id-type="doi">10.5713/ajas.2004.903</pub-id>
</citation>
</ref>
<ref id="B44">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Maw</surname>
<given-names>A. A.</given-names>
</name>
<name>
<surname>Kawabe</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Shimogiri</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Rerkamnuaychoke</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Kawamoto</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Masuda</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2015</year>). <article-title>Genetic diversity and population structure in native chicken populations from Myanmar, Thailand and Laos by using 102 indels markers</article-title>. <source>Asian-Australas. J. Anim. Sci.</source> <volume>8</volume> (<issue>1</issue>), <fpage>14</fpage>&#x2013;<lpage>19</lpage>. <pub-id pub-id-type="doi">10.5713/ajas.14.0212</pub-id>
</citation>
</ref>
<ref id="B45">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mekchay</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Supakankul</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Assawamakin</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Wilantho</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Chareanchim</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Tongsima</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Population structure of four Thai indigenous chicken breeds</article-title>. <source>BMC Genet</source> <volume>15</volume>, <fpage>40</fpage>&#x2013;<lpage>45</lpage>. <pub-id pub-id-type="doi">10.1186/1471-2156-15-40</pub-id>
</citation>
</ref>
<ref id="B46">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Miao</surname>
<given-names>Y. W.</given-names>
</name>
<name>
<surname>Peng</surname>
<given-names>M. S.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>G. S.</given-names>
</name>
<name>
<surname>Ouyang</surname>
<given-names>Y. N.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Z. Y.</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>N.</given-names>
</name>
<etal/>
</person-group> (<year>2013</year>). <article-title>Chicken domestication: an updated perspective based on mitochondrial genomes</article-title>. <source>Heredity</source> <volume>110</volume> (<issue>3</issue>), <fpage>277</fpage>&#x2013;<lpage>282</lpage>. <pub-id pub-id-type="doi">10.1038/hdy.2012.83</pub-id>
</citation>
</ref>
<ref id="B47">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Mobegi</surname>
<given-names>V. A.</given-names>
</name>
</person-group> (<year>2006</year>). <source>Genetic characterization of African chicken using mitochondrial DNA D-loop sequences [M.S. thesis]</source>. <publisher-loc>Nairobi, Kenya</publisher-loc>: <publisher-name>University of Nairobi</publisher-name>.</citation>
</ref>
<ref id="B48">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Moiseyeva</surname>
<given-names>I. G.</given-names>
</name>
<name>
<surname>Romanov</surname>
<given-names>M. N.</given-names>
</name>
<name>
<surname>Nikiforov</surname>
<given-names>A. A.</given-names>
</name>
<name>
<surname>Sevastyanova</surname>
<given-names>A. A.</given-names>
</name>
<name>
<surname>Semyenova</surname>
<given-names>S. K.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Evolutionary relationships of Red Jungle Fowl and chicken breeds</article-title>. <source>Genet. Sel. Evol.</source> <volume>35</volume> (<issue>4</issue>), <fpage>403</fpage>&#x2013;<lpage>423</lpage>. <pub-id pub-id-type="doi">10.1186/1297-9686-35-5-403</pub-id>
</citation>
</ref>
<ref id="B49">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Moore</surname>
<given-names>W. S.</given-names>
</name>
</person-group> (<year>1995</year>). <article-title>Inferring phylogenies from mtDNA variation: mitochondrial&#x2010;gene trees versus nuclear&#x2010;gene trees</article-title>. <source>Evolution</source> <volume>49</volume> (<issue>4</issue>), <fpage>718</fpage>&#x2013;<lpage>726</lpage>. <pub-id pub-id-type="doi">10.1111/j.1558-5646.1995.tb02308.x</pub-id>
</citation>
</ref>
<ref id="B50">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Morejohn</surname>
<given-names>G. V.</given-names>
</name>
</person-group> (<year>1968</year>). <article-title>Breakdown of isolation mechanisms in two species of captive junglefowl (Gallus gallus and Gallus sonneratii)</article-title>. <source>Evolution</source> <volume>22</volume>, <fpage>576</fpage>&#x2013;<lpage>582</lpage>. <pub-id pub-id-type="doi">10.1111/j.1558-5646.1968.tb03993.x</pub-id>
</citation>
</ref>
<ref id="B51">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mwacharo</surname>
<given-names>J. M.</given-names>
</name>
<name>
<surname>Bj&#xf8;rnstad</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Mobegi</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Nomura</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Hanada</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Amano</surname>
<given-names>T.</given-names>
</name>
<etal/>
</person-group> (<year>2011</year>). <article-title>Mitochondrial DNA reveals multiple introductions of domestic chicken in East Africa</article-title>. <source>Mol. Phylogenet. Evol.</source> <volume>58</volume>, <fpage>374</fpage>&#x2013;<lpage>382</lpage>. <pub-id pub-id-type="doi">10.1016/j.ympev.2010.11.027</pub-id>
</citation>
</ref>
<ref id="B52">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Nei</surname>
<given-names>M.</given-names>
</name>
</person-group> (<year>1987</year>). <source>Molecular Evolution Genetics</source>. <publisher-loc>New York, USA</publisher-loc>: <publisher-name>Columbia University Press</publisher-name>.</citation>
</ref>
<ref id="B53">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nishibori</surname>
<given-names>M.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>Complete sequence of mitochondrial D-loop region of red jungle fowls (Gallus gallus) and their genetic diversity in Myanmar and its neighbor countries</article-title>. <source>Report of the Society for Researches on Native Livestock</source> <volume>21</volume>, <fpage>213</fpage>&#x2013;<lpage>223</lpage>.</citation>
</ref>
<ref id="B54">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nishibori</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Shimogiri</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Hayashi</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Yasue</surname>
<given-names>H.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>Molecular evidence for hybridization of species in the genus Gallus except for Gallus varius</article-title>. <source>Anim. Genet.</source> <volume>36</volume> (<issue>5</issue>), <fpage>367</fpage>&#x2013;<lpage>375</lpage>. <pub-id pub-id-type="doi">10.1111/j.1365-2052.2005.01318.x</pub-id>
</citation>
</ref>
<ref id="B55">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Niu</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Fu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Luo</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Ruan</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>X-P.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>G.</given-names>
</name>
<etal/>
</person-group> (<year>2002</year>). <article-title>The origin and genetic diversity of Chinese native chicken breeds</article-title>. <source>Biochem. Genet.</source> <volume>40</volume> (<issue>5-6</issue>), <fpage>163</fpage>&#x2013;<lpage>174</lpage>. <pub-id pub-id-type="doi">10.1023/a:1015832108669</pub-id>
</citation>
</ref>
<ref id="B56">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Oka</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Ino</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Nomura</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Kawashima</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Kuwayama</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Hanada</surname>
<given-names>H.</given-names>
</name>
<etal/>
</person-group> (<year>2007</year>). <article-title>Analysis of mtDNA sequences shows Japanese native chickens have multiple origins</article-title>. <source>Anim. Genet.</source> <volume>38</volume> (<issue>3</issue>), <fpage>287</fpage>&#x2013;<lpage>293</lpage>. <pub-id pub-id-type="doi">10.1111/j.1365-2052.2007.01604.x</pub-id>
</citation>
</ref>
<ref id="B57">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Padhi</surname>
<given-names>M. K.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Importance of indigenous breeds of chicken for rural economy and their improvements for higher production performance</article-title>. <source>Scientifica</source> <volume>2016</volume>, <fpage>2604685</fpage>. <pub-id pub-id-type="doi">10.1155/2016/2604685</pub-id>
</citation>
</ref>
<ref id="B58">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Peters</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Lebrasseur</surname>
<given-names>O.</given-names>
</name>
<name>
<surname>Best</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Miller</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Fothergill</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Dobney</surname>
<given-names>K.</given-names>
</name>
<etal/>
</person-group> (<year>2015</year>). <article-title>Questioning new answers regarding Holocene chicken domestication in China</article-title>. <source>Proc. Natl. Acad. Sci. U. S. A.</source> <volume>12</volume>, <fpage>E2415</fpage>. <pub-id pub-id-type="doi">10.1073/pnas.1503579112</pub-id>
</citation>
</ref>
<ref id="B59">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Peterson</surname>
<given-names>A. T.</given-names>
</name>
<name>
<surname>Brisbin</surname>
<given-names>I. L.</given-names>
</name>
</person-group> (<year>1999</year>). <article-title>Genetic endangerment of wild red jungle fowl (Gallus gallus)?</article-title>. <source>Bird Conserv. Int.</source> <volume>9</volume>, <fpage>387</fpage>&#x2013;<lpage>394</lpage>. <pub-id pub-id-type="doi">10.1017/S0959270900002148</pub-id>
</citation>
</ref>
<ref id="B60">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Quinn</surname>
<given-names>T. W.</given-names>
</name>
<name>
<surname>Wilson</surname>
<given-names>A. C.</given-names>
</name>
</person-group> (<year>1993</year>). <article-title>Sequence evolution in and around the mitochondrial control region in birds</article-title>. <source>J. Mol. Evol.</source> <volume>37</volume> (<issue>4</issue>), <fpage>417</fpage>&#x2013;<lpage>425</lpage>. <pub-id pub-id-type="doi">10.1007/BF00178871</pub-id>
</citation>
</ref>
<ref id="B61">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rozas</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Sanchez-DelBarrio</surname>
<given-names>J. C.</given-names>
</name>
<name>
<surname>Messeguer</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Rozas</surname>
<given-names>R.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>DnaSP, DNA polymorphism analyses by the coalescent and other methods</article-title>. <source>Bioinformatics</source> <volume>19</volume> (<issue>18</issue>), <fpage>2496</fpage>&#x2013;<lpage>2497</lpage>. <pub-id pub-id-type="doi">10.1093/bioinformatics/btg359</pub-id>
</citation>
</ref>
<ref id="B62">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ruokonen</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Kvist</surname>
<given-names>L.</given-names>
</name>
</person-group> (<year>2002</year>). <article-title>Structure and evolution of the avian mitochondrial control region</article-title>. <source>Mol. Phylogenet. Evol.</source> <volume>23</volume> (<issue>3</issue>), <fpage>422</fpage>&#x2013;<lpage>432</lpage>. <pub-id pub-id-type="doi">10.1016/S1055-7903(02)00021-0</pub-id>
</citation>
</ref>
<ref id="B63">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Sambrook</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Russell</surname>
<given-names>D. W.</given-names>
</name>
</person-group> (<year>2001</year>). <source>Molecular cloning: A laboratory manual</source>. <edition>3rd</edition>. <publisher-loc>New York, NY</publisher-loc>: <publisher-name>Cold Spring Harbor Laboratory Press, Cold Spring Harbor</publisher-name>.</citation>
</ref>
<ref id="B64">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Schneider</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Roessli</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Excoffier</surname>
<given-names>L.</given-names>
</name>
</person-group> (<year>2000</year>). <source>Arlequin Version 2.000: Software for Population Genetics and Data Analysis</source>. <publisher-loc>Geneva, Switzerland</publisher-loc>: <publisher-name>Genetics and Biometry Laboratory, University of Geneva</publisher-name>, <fpage>1</fpage>&#x2013;<lpage>11</lpage>.</citation>
</ref>
<ref id="B65">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sch&#xfc;tz</surname>
<given-names>K. E.</given-names>
</name>
<name>
<surname>Forkman</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Jensen</surname>
<given-names>P.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>Domestication effects on foraging strategy, social behaviour, and different fear responses: a comparison between the red junglefowl (Gallus gallus) and a modern layer strain</article-title>. <source>Appl. Anim. Behav. Sci.</source> <volume>74</volume>, <fpage>1</fpage>&#x2013;<lpage>14</lpage>. <pub-id pub-id-type="doi">10.1016/S0168-1591(01)00156-3</pub-id>
</citation>
</ref>
<ref id="B66">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Scott</surname>
<given-names>G. R.</given-names>
</name>
<name>
<surname>Milsom</surname>
<given-names>W. K.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Flying high: A theoretical analysis of the factors limiting exercise performance in birds at altitude</article-title>. <source>Respir. Physiol. Neurobiol.</source> <volume>154</volume>, <fpage>284</fpage>&#x2013;<lpage>301</lpage>. <pub-id pub-id-type="doi">10.1016/j.resp.2006.02.012</pub-id>
</citation>
</ref>
<ref id="B67">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Scott</surname>
<given-names>G. R.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Elevated performance: the unique physiology of birds that fly at high altitudes</article-title>. <source>J. Exp. Biol.</source> <volume>214</volume>, <fpage>2455</fpage>&#x2013;<lpage>2462</lpage>. <pub-id pub-id-type="doi">10.1242/jeb.052548</pub-id>
</citation>
</ref>
<ref id="B68">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Silva</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Guan</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Ho-Shing</surname>
<given-names>O.</given-names>
</name>
<name>
<surname>Jones</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Hui</surname>
<given-names>D.</given-names>
</name>
<etal/>
</person-group> (<year>2009</year>). <article-title>Mitochondrial DNA-based analysis of genetic variation and relatedness among Sri Lankan indigenous chickens and the Ceylon junglefowl (Gallus lafayetti)</article-title>. <source>Anim. Genet.</source> <volume>40</volume> (<issue>1</issue>), <fpage>1</fpage>&#x2013;<lpage>9</lpage>. <pub-id pub-id-type="doi">10.1111/j.1365-2052.2008.01783.x</pub-id>
</citation>
</ref>
<ref id="B69">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Stevens</surname>
<given-names>L.</given-names>
</name>
</person-group> (<year>1991</year>). <source>Genetic and evolution of the domestic fowl</source>. <publisher-loc>New York, NY</publisher-loc>: <publisher-name>Cambridge University Press</publisher-name>.</citation>
</ref>
<ref id="B70">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sun</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Zhong</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>S. Y.</given-names>
</name>
<name>
<surname>Yao</surname>
<given-names>Y. G.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Y. P.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Association between MT-CO3 haplotypes and high-altitude adaptation in Tibetan chicken</article-title>. <source>Gene</source> <volume>529</volume>, <fpage>131</fpage>&#x2013;<lpage>137</lpage>. <pub-id pub-id-type="doi">10.1016/j.gene.2013.06.075</pub-id>
</citation>
</ref>
<ref id="B71">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tachibana</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Sparman</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Sritanaudomchai</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Ma</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Clepper</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Woodward</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2009</year>). <article-title>Mitochondrial gene replacement in primate offspring and embryonic stem cells</article-title>. <source>Nature</source> <volume>461</volume> (<issue>7262</issue>), <fpage>367</fpage>&#x2013;<lpage>372</lpage>. <pub-id pub-id-type="doi">10.1038/nature08368</pub-id>
</citation>
</ref>
<ref id="B72">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tamura</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Nei</surname>
<given-names>M.</given-names>
</name>
</person-group> (<year>1993</year>). <article-title>Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees</article-title>. <source>Mol. Biol. Evol.</source> <volume>10</volume>, <fpage>512</fpage>&#x2013;<lpage>526</lpage>. <pub-id pub-id-type="doi">10.1093/oxfordjournals.molbev.a040023</pub-id>
</citation>
</ref>
<ref id="B73">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Taylor</surname>
<given-names>R. W.</given-names>
</name>
<name>
<surname>Turnbull</surname>
<given-names>D. M.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>Mitochondrial DNA mutations in human disease</article-title>. <source>Nat. Rev. Genet.</source> <volume>6</volume> (<issue>5</issue>), <fpage>389</fpage>&#x2013;<lpage>402</lpage>. <pub-id pub-id-type="doi">10.1038/nrg1606</pub-id>
</citation>
</ref>
<ref id="B74">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Thompson</surname>
<given-names>J. D.</given-names>
</name>
<name>
<surname>Gibson</surname>
<given-names>T. J.</given-names>
</name>
<name>
<surname>Plewniak</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Jeanmougin</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Higgins</surname>
<given-names>D. G.</given-names>
</name>
</person-group> (<year>1997</year>). <article-title>The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools</article-title>. <source>Nucleic Acids Res</source> <volume>25</volume> (<issue>24</issue>), <fpage>4876</fpage>&#x2013;<lpage>4882</lpage>. <pub-id pub-id-type="doi">10.1093/nar/25.24.4876</pub-id>
</citation>
</ref>
<ref id="B75">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tixier-Boichard</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Bed&#x2019;hom</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Rognon</surname>
<given-names>X.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Chicken domestication: from archeology to genomics</article-title>. <source>C. R. Biol.</source> <volume>334</volume>, <fpage>197</fpage>&#x2013;<lpage>204</lpage>. <pub-id pub-id-type="doi">10.1016/j.crvi.2010.12.012</pub-id>
</citation>
</ref>
<ref id="B76">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tonsing</surname>
<given-names>M. V.</given-names>
</name>
<name>
<surname>Sailo</surname>
<given-names>C. V.</given-names>
</name>
<name>
<surname>Chhakchhuak</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Chhakchhuak</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Pandit</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Kumar</surname>
<given-names>D.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Analysis of variants in mitochondrial genome and their putative pathogenicity in Tuberculosis patients from Mizoram, North east India</article-title>. <source>Mitochondrion</source> <volume>54</volume>, <fpage>21</fpage>&#x2013;<lpage>25</lpage>. <pub-id pub-id-type="doi">10.1016/j.mito.2020.06.012</pub-id>
</citation>
</ref>
<ref id="B77">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tuppen</surname>
<given-names>H. A.</given-names>
</name>
<name>
<surname>Blakely</surname>
<given-names>E. L.</given-names>
</name>
<name>
<surname>Turnbull</surname>
<given-names>D. M.</given-names>
</name>
<name>
<surname>Taylor</surname>
<given-names>R. W.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Mitochondrial DNA mutations and human disease</article-title>. <source>BBA-Bioenergetics</source> <volume>1797</volume> (<issue>2</issue>), <fpage>113</fpage>&#x2013;<lpage>128</lpage>. <pub-id pub-id-type="doi">10.1016/j.bbabio.2009.09.005</pub-id>
</citation>
</ref>
<ref id="B78">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ulfah</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Kawahara-Miki</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Farajalllah</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Muladno</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Dorshorst</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Martin</surname>
<given-names>A.</given-names>
</name>
<etal/>
</person-group> (<year>2016</year>). <article-title>Genetic features of red and green jungle fowls and relationship with Indonesian native chickens Sumatera and Kedu Hitam</article-title>. <source>BMC Genomics</source> <volume>17</volume>, <fpage>320</fpage>&#x2013;<lpage>325</lpage>. <pub-id pub-id-type="doi">10.1186/s12864-016-2652-z</pub-id>
</citation>
</ref>
<ref id="B79">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wani</surname>
<given-names>C. E.</given-names>
</name>
<name>
<surname>Yousif</surname>
<given-names>I. A.</given-names>
</name>
<name>
<surname>Ibrahim</surname>
<given-names>M. E.</given-names>
</name>
<name>
<surname>Musa</surname>
<given-names>H. H.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Molecular characterization of Sudanese and Southern Sudanese chicken breeds using mtDNA D-Loop</article-title>. <source>Genet. Res. Int.</source> <volume>2014</volume>, <fpage>928420</fpage>. <pub-id pub-id-type="doi">10.1155/2014/928420</pub-id>
</citation>
</ref>
<ref id="B80">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>West</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>B-X.</given-names>
</name>
</person-group> (<year>1988</year>). <article-title>Did chicken go north? New evidence for domestication</article-title>. <source>J. Archaeol. Sci.</source> <volume>15</volume>, <fpage>515</fpage>&#x2013;<lpage>533</lpage>. <pub-id pub-id-type="doi">10.1016/0305-4403(88)90080-5</pub-id>
</citation>
</ref>
<ref id="B81">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wright</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>1951</year>). <article-title>The genetical structure of populations</article-title>. <source>Ann. Eugenics</source> <volume>15</volume> (<issue>1</issue>), <fpage>323</fpage>&#x2013;<lpage>354</lpage>. <pub-id pub-id-type="doi">10.1111/j.1469-1809.1949.tb02451.x</pub-id>
</citation>
</ref>
<ref id="B82">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xiang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Cai</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Y.</given-names>
</name>
<etal/>
</person-group> (<year>2014</year>). <article-title>Early Holocene chicken domestication in northern China</article-title>. <source>Proc. Natl. Acad. Sci. U. S. A.</source> <volume>111</volume>, <fpage>17564</fpage>&#x2013;<lpage>17569</lpage>. <pub-id pub-id-type="doi">10.1073/pnas.1411882111</pub-id>
</citation>
</ref>
<ref id="B83">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xu</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Luosang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Hua</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Ciren</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>W.</given-names>
</name>
<etal/>
</person-group> (<year>2007</year>). <article-title>High altitude adaptation and phylogenetic analysis of Tibetan horse based on the mitochondrial genome</article-title>. <source>J. Genet. Genom.</source> <volume>34</volume> (<issue>8</issue>), <fpage>720</fpage>&#x2013;<lpage>729</lpage>. <pub-id pub-id-type="doi">10.1016/S1673-8527(07)60081-2</pub-id>
</citation>
</ref>
<ref id="B84">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yacoub</surname>
<given-names>H. A.</given-names>
</name>
<name>
<surname>Fathi</surname>
<given-names>M. M.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Phylogenetic analysis using d-loop marker of mtDNA of Saudi native chicken strains</article-title>. <source>Mitochondrial DNA</source> <volume>24</volume> (<issue>5</issue>), <fpage>538</fpage>&#x2013;<lpage>551</lpage>. <pub-id pub-id-type="doi">10.3109/19401736.2013.770494</pub-id>
</citation>
</ref>
<ref id="B85">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Huo</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Ji</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>Y.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>The spatio-temporal features of chicken mitochondrial ND2 gene heteroplasmy and the effects of nutrition factors on this gene</article-title>. <source>Sci. Rep.</source> <volume>10</volume> (<issue>1</issue>), <fpage>2972</fpage>&#x2013;<lpage>9</lpage>. <pub-id pub-id-type="doi">10.1038/s41598-020-59703-y</pub-id>
</citation>
</ref>
<ref id="B86">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yu</surname>
<given-names>Q. F.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>L. L.</given-names>
</name>
<name>
<surname>Fu</surname>
<given-names>C. X.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>S. P.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>J. H.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>The complete mitochondrial genome of the Huang Lang chicken</article-title>. <source>Mitochondrial DNA Part A</source> <volume>27</volume> (<issue>1</issue>), <fpage>216</fpage>&#x2013;<lpage>217</lpage>. <pub-id pub-id-type="doi">10.3109/19401736.2014.880895</pub-id>
</citation>
</ref>
<ref id="B87">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Zeuner</surname>
<given-names>F. E.</given-names>
</name>
</person-group> (<year>1963</year>). <source>A History of Domesticated Animals</source>. <publisher-loc>London</publisher-loc>: <publisher-name>Hutchinson and Co. (Publishers) Ltd</publisher-name>.</citation>
</ref>
<ref id="B88">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhao</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Gaur</surname>
<given-names>U.</given-names>
</name>
<name>
<surname>Gu</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>D.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>High-altitude adaptation of Tibetan chicken from MT-COI and ATP-6 perspective</article-title>. <source>Mitochondrial DNA Part A</source> <volume>27</volume> (<issue>5</issue>), <fpage>3280</fpage>&#x2013;<lpage>3288</lpage>. <pub-id pub-id-type="doi">10.3109/19401736.2015.1015006</pub-id>
</citation>
</ref>
<ref id="B89">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhou</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Shen</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Irwin</surname>
<given-names>D. M.</given-names>
</name>
<name>
<surname>Shen</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Y.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Mitogenomic analyses propose positive selection in mitochondrial genes for high-altitude adaptation in galliform birds</article-title>. <source>Mitochondrion</source> <volume>18</volume>, <fpage>70</fpage>&#x2013;<lpage>75</lpage>. <pub-id pub-id-type="doi">10.1016/j.mito.2014.07.012</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>