The non-consanguineous couple first visited the Institute of Reproduction and Genetics, Chongqing Health Center for Women and Children (Chongqing, China), three times due to abnormal pregnancies and to consult for PGT. Pedigree data were obtained from the couple and their parents. Clinical assessments, including ultrasonic examination and assisted reproductive technology (ART), were performed in the related clinical departments. This study was approved by the Ethics Committee of the Chongqing Health Center for Women and Children. Informed consent was obtained from the couple.

The exomes were captured using the Agilent SureSelect Human All Exon V6 Kit (Agilent Technologies Inc., CA, United States) and sequenced on an Illumina NovaSeq 6000 platform (Illumina Inc., CA, United States). The clean reads derived from targeted sequencing were filtered and aligned to the human reference genome (GRCh37/hg19) using the Burrows–Wheeler Aligner (BWA) (Li and Durbin, 2009). Single-nucleotide variants (SNVs) and InDels were called using Genome Analysis Toolkit (GATK), annotated with Ensembl Variant Effect Predictor (McLaren et al., 2016), and filtered using multiple databases, including NCBI dbSNP, HapMap, 1,000 human genome dataset, and gnomAD. Finally, all the variants were annotated according to the guidelines of the American College of Medical Genetics and Genomics (ACMG) (Richards et al., 2015), and the variants from known causative genes of MKS were analyzed. The Human Gene Mutation Database (HGMD) and VarSome were used to screen the mutations reported previously. The variants were validated by Sanger sequencing.

Sanger sequencing was used to validate MKS1 mutations in the aborted fetuses (II:1 and II:3) and the couple (I:1 and I:2) (Figure 1A) The following primers were used: MKS1-exon4-forward: 5′-TTC​TTG​GTT​CCC​CTG​CCA​TTC-3′, MKS1-exon4-reverse: 5′-CTC​ACC​ACC​TGT​AGA​CTG​TGC-3’; MKS1-intron15-forward: 5′-CTG​TGT​CAT​TGC​TGG​GGA​GTC-3′, MKS1-intron15-reverse: 5′-CCA​GCC​ACA​TGG​TTA​CGG-3′. The products were purified on 2% agarose gels, sequenced with ABI 3500 (Thermo Fisher, MA, United States), and analyzed using Chromas 2.6.5 (Technelysium Pvt. Ltd., United States).

The amino acid sequence and name of mutant MKS1 proteins were analyzed using Name Checker (https://mutalyzer.nl/name-checker). The MKS1 amino acid sequences from different species were compared using the ClustalW software and analyzed using ESPript 3.0 (https://espript.ibcp.fr/ESPript). Wild-type and mutant MKS1 proteins were modeled using Illustrator for Biological Sequences (IBS, http://ibs.biocuckoo.org/online.php).

The mutations at the 3′-terminus of intron 15 were found in the gnomAD database (http://gnomad-sg.org/). The effect of these mutations was analyzed with varSEAK (https://varseak.bio/) and SpliceAI (https://spliceailookup.broadinstitute.org/). Total RNA was extracted from blood samples using the QIAamp RNA blood mini kit (Qiagen, Germany), according to the manufacturer’s instructions. PrimeScript Reverse-Transcription Polymerase Chain Reaction (RT-PCR) kit (Takara, Japan) was used for RT-PCR. The forward primer (5′-GGC​TGA​GCT​GAG​GAG​GTT​TT-3′) used for cDNA amplification was located at exon 15, while the reverse primer (5′-CTT​CCA​GAC​GGT​CCA​ACA​CA-3′) was located at exon 17. Then, the products were purified on 2% agarose gels and analyzed on ABI 3500.

The primers used for real-time fluorescence quantitative PCR (qPCR) were as follows: forward 5′-CTC​CGA​GTC​CAC​CTG​CAA​AGA​ATC-3′ and reverse 5′-CTC​CTC​CTC​TTC​GTC​TTC​CTC​TGG-3′ for MKS1 exons 2 and 3; forward 5′-GGA​TCC​TTC​AAG​GGG​GAA​CG-3′ and reverse 5′-CAT​GAA​GGC​CCT​GGA​CTG​CT-3′ for MKS1 exon 16; forward 5′-ATG​CAG​AAT​CCA​CGC​CAG​TAC​AAG-3′ and reverse 5′-TCA​GTC​GCT​CCA​GGT​CTT​CAC​G-3′ for RPS18 as the control. The expression of MKS1 was evaluated using EvaGreen SuperMix (Bio-Rad, United States) on a CFX96 apparatus (Bio-Rad, United States) and analyzed using the 2^−ΔΔCt method by normalizing to that of RPS18.

The full-length coding sequence (CDS) of MKS1 (NM_017777.4) was amplified by RT-PCR from wild-type, c.350C>A heterozygous, and c.1408-14A>G heterozygous subjects and subcloned into the pcDNA3.1-Myc B vectors (Invitrogen, USA). B9D2 was inserted into the pCMV-HA plasmid. All plasmid sequences were validated by Sanger sequencing.

HEK293T cells were provided by Stem Cell Bank, Chinese Academy of Sciences (Shanghai, China), and grown at 37°C in the presence of 5% CO₂ in DMEM (HyClone, United States) supplemented with 10% fetal bovine serum (HyClone, United States). 293T cells were seeded in six-well plates (Corning, United States), and 2.5 µg wild-type or mutant MKS1 vector was transfected using Lipofectamine 3000 reagent (Thermo Fisher, United States). The cells were lysed with cell lysis buffer for western blot and immunoprecipitation (IP) (Beyotime, China) after transfection for different times (12, 24, 36, and 48 h), and 20 μg protein was analyzed by western blot. The anti-Myc antibody (AM926, 1:1,000) was purchased from Beyotime. Actin antibody (Beyotime, AA128, 1:1,000) served as an internal control.

For co-IP, MKS1 (1.5 µg) and B9D2 (1.0 µg) expression vectors were co-transfected into HEK293T cells. After 36 h post-transfection, HEK293T cells were rinsed with ice-cold phosphate-buffered saline (PBS) and lysed with IP lysis buffer (Beyotime, China) supplemented with a protease inhibitor cocktail. After 20 min, cell lysates were cleared by centrifugation at 14,000 × g, 4°C for 5 min. The supernatant was used for the co-IP assay by shaking with BeyoMag™ anti-Myc magnetic beads (Beyotime, China) at 4°C for 4–6 h. After three washes, protein-Myc bead complex was eluted with IP buffer containing 150 μg/ml 3× Myc peptides (Beyotime, China) for 2 h. Then, the elution products were subjected to western blotting. The following antibodies (1:1,000, Beyotime, China) were used: anti-Myc, anti-HA, and goat anti-mouse HRP.

The COS was conducted using a gonadotropin-releasing hormone (GnRH) antagonist protocol based on the ovarian reserve of the I:2 subject. It was initiated on day 2 of the cycle with a dose of 250 IU recombinant follicle-stimulating hormone (rFSH, Puregon, Organon, Netherlands). GnRH antagonist (0.25 mg; Cetrotide, Merck Serono, Switzerland) was given on cycle day 8. Human chorionic gonadotropin (hCG, Merck Serono, Switzerland) was administered as a trigger on cycle day 10, and transvaginal oocyte retrieval was performed after 36 h. Consequently, 13 oocytes were obtained, and five blastocysts were biopsied after intracytoplasmic sperm injection (ICSI).

Whole-genome amplification of each embryo biopsy sample was performed using the MALBAC WGA kit (Yikon Genomics, China), following the manufacturer’s instructions. A total of 60 single-nucleotide polymorphism (SNP) markers linked to the mutation alleles were selected for linkage analysis. The mutation site and SNPs were amplified using specific primer pairs; the amplification products were pooled with the MALBAC WGA products and sequenced. The chromosomal copy number and the mutation site and SNPs were analyzed, as published previously (Huang et al., 2015).

As shown by the family genetic map (Figure 1A), the non-consanguineous couple (I:1 and I:2) suffered from abnormal pregnancy three times, while the family presented no related medical history. Ultrasonographic images showed that the three aborted fetuses (II:1, II:2, and II:3) had clinical features of MKS such as occipital encephalocele, cerebellar vermis agenesis, and postaxial polydactyly (Figure 1B; Supplementary Table S1). Renal/hepatic involvement was not observed by ultrasonography in these fetuses. WES of the proband II:3 identified two novel MKS1 (NM_017777.4) variants, c.350C>A and c.1408-14A>G (Figure 1C). Moreover, analysis of MKS1 with Sanger sequencing in I:1, I:2, II:1, and II:3 showed that these two compound heterozygous mutations were inherited from their parents (Figure 1C).

The maternally inherited variant, c.350C>A, is a novel nonsense mutation causing the premature stop of MKS1 translation at the conserved Ser117, thereby encoding the mutant MKS1 p.S117*, while the paternally inherited variant, c.1408-14A>G, is located at intron 15 (Figure 1D). MKS1 c.350C>A is not recorded in the human disease-related databases (gnomAD, ClinVar, and HGMD), and the truncated MKS1 protein would be a loss of function without the C-terminal B9-C2 domain. MKS1 c.1408-14A>G is known as rs1194131222 with a rare frequency (0.000007228) in the gnomAD database, and no clinical case has yet been reported. Thus, according to the ACMG guidelines, the MKS1 c.350C>A mutation is classified as “pathogenic” (PVS1: very strong pathogenicity, PS4: strong pathogenicity, PM2: moderate pathogenicity, and PP1: supporting pathogenicity), and the MKS1 c.1408-14A>G mutation is classified as “uncertain significance” (PM3+PP1+PP4).

As previously reported, MKS1 c.1408-34_1408-6del29bp [AGAAACCTGAGGCTGTCCCAATGGCATGC], the Finnish major mutation, affected the MKS1 mRNA splicing with the skip of exon 16 and induced frameshift of the MKS1 protein, resulting in MKS in a homozygous pattern (Kyttälä et al., 2006; Auber et al., 2007). Aberrant splicing was reported as a crucial mutational mechanism in MKS1-induced Meckel–Gruber syndrome (Frank et al., 2007). To date, 22 variants have been identified at the 3′-terminus of intron 15, while two variants (c.1408-1G>A and c.1408-34_1408-6del29bp) were predicted to induce the skip of exon 16, as assessed by varSEAK and SpliceAI (Figure 2A; Supplementary Table S2). The analysis showed an uncertain significance of c.1408-14A>G on MKS1 mRNA splicing.

To further investigate the effect of c.1408-14A>G, RT-PCR was conducted with primers specific to exons 15 and 17. The results showed that there was one band >200 bp in I:2, and there were two bands in I:1 (one >200 bp and one <200 bp) (Figure 2B). Sanger sequencing of the two bands demonstrated a direct connection between exons 15 and 17 in the shorter one with the skip of exon 16 (Figure 2C), implying that the effect of c.1408-14A>G was like c.1408-34_1408-6del29bp on MKS1 mRNA splicing. Using the in silico prediction software Name-Checker, the mutant CDS was predicted to encode the MKS1 p.E471Lfs*92 protein (Supplementary data S1). BLAST and alignment with MKS1 proteins across evolution manifested the partial dysfunction of the highly conserved B9-C2 domain (313–493 aa) in MKS1 p.E471Lfs*92 (Figure 2D). Herein, we updated the clinical significance of MKS1 c.1408-14A>G as “pathogenic.”

Previous studies have shown that the nonsense codons in all internal exons could trigger a nonsense-mediated mRNA decay (NMD) process (Nagy and Maquat, 1998). The c.350C>A variant resulted in a premature stop codon in exon 4, which probably triggered the degradation of mutant MKS1 mRNA through the NMD pathway, while the c.1408-14A>G variant induced the skip of exon 16 and generated a new stop codon in the 3′-untranslated region (3′-UTR) (Figure 3A). The results of qPCR with specific primers for exons 2–3 and 16 respectively showed that the expression level of MKS1 gene in an I:2 heterozygous subject was equivalent to the control individual (Figure 3B), implying the absence of NMD process for the c.350C>A variant. Moreover, the MKS1 level detected for exon 16 was downregulated in the c.1408-14A>G heterozygous individual (I:1), confirming the skip of exon 16 during the MKS1 mRNA splicing process.

The C-terminal B9-C2 domain (313–493 aa) of MKS1 protein is conserved across evolution and essential for the predominant interaction between MKS1, B9D1, and B9D2, which is essential for cilial function (Dowdle et al., 2011; Romani et al., 2014; Okazaki et al., 2020). The truncated protein MKS1 p.S117* produced by the c.350C>A variant was predicted to lose its function completely, while the elongated protein MKS1 p.E471Lfs*92 maintained partial B9-C2 domain (313–470 aa) with the frameshift of the C-terminus (471–561 aa). We transfected 293T cells with Myc-tagged wild-type or mutant MKS1 expression plasmids to investigate the effect of these two variants on the B9 domain function. qPCR with specific primers for exons 2–3 confirmed the transcription of wild-type and mutant MKS1 in the transfected 293T cells (Figure 3C). However, immunoblots with anti-Myc antibody demonstrated the expression of the wild-type and the frameshifted MKS1 proteins, while the MKS1 p.S117* was undetectable (Figure 3D). Co-IP assays with B9D2 protein showed that the wild-type MKS1 but not the MKS1 p.E471Lfs*92 interacted with B9D2, implying the dysfunction of the B9-C2 domain of MKS1 p.E471Lfs*92 (Figure 3E). Thus, c.350C>A and c.1408-14A>G variants disrupted the function of MKS1 and were pathogenic for fetal development.

To avoid the occurrence of abnormal pregnancy, the non-consanguineous couple (I:1 and I:2) chose the in vitro assisted reproductive technology combined with PGT-M for the MKS1 variants. Clinically, the I:2 individual was consecutively treated with an antagonist for ovulation induction, and 11 mature oocytes at the metaphase II (MII) stage were retrieved through the laparoscopic ovarian puncture method (Figure 4A). After intracytoplasmic sperm injection (ICSI), seven zygotes developed into transferable embryos, and five blastocysts were biopsied for amplification with multiple annealing and looping-based cycles (Figure 4B).

The linkage analysis with SNP array for haplotype showed that two embryos were normal, and the other three were affected (Figure 4C). Finally, one healthy embryo was transferred, and luteal phase supports were administered routinely. Serum β-hCG levels were measured at 14 days after frozen embryo transplantation (FET). The presence of a gestational sac and fetal heartbeat detected by ultrasound at 5 weeks after FET was evidence of clinical pregnancy. Sanger sequencing was performed on the amniotic fluid sample collected by amniocentesis at 18 weeks of gestation; no MKS1 mutation was found.