<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Fungal Biol.</journal-id>
<journal-title>Frontiers in Fungal Biology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Fungal Biol.</abbrev-journal-title>
<issn pub-type="epub">2673-6128</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/ffunb.2024.1505388</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Fungal Biology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>CSE-8, a filamentous fungus-specific Shr3-like chaperone, facilitates endoplasmic reticulum exit of chitin synthase CHS-3 (class I) in <italic>Neurospora crassa</italic>
</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Gonz&#xe1;lez-T&#xe9;llez</surname>
<given-names>Samantha Ver&#xf3;nica</given-names>
</name>
<uri xlink:href="https://loop.frontiersin.org/people/2858818"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Riquelme</surname>
<given-names>Meritxell</given-names>
</name>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/306895"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
</contrib>
</contrib-group>
<aff id="aff1">
<institution>Department of Microbiology, Centro de Investigaci&#xf3;n Cient&#xed;fica y de Educaci&#xf3;n Superior de Ensenada (CICESE)</institution>, <addr-line>Ensenada</addr-line>, <country>Mexico</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Gustavo Henrique Goldman, University of S&#xe3;o Paulo, Brazil</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Georgios Tzelepis, Swedish University of Agricultural Sciences, Sweden</p>
<p>Oier Etxebeste, University of the Basque Country, Spain</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Meritxell Riquelme, <email xlink:href="mailto:riquelme@cicese.mx">riquelme@cicese.mx</email>
</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>24</day>
<month>01</month>
<year>2025</year>
</pub-date>
<pub-date pub-type="collection">
<year>2024</year>
</pub-date>
<volume>5</volume>
<elocation-id>1505388</elocation-id>
<history>
<date date-type="received">
<day>02</day>
<month>10</month>
<year>2024</year>
</date>
<date date-type="accepted">
<day>18</day>
<month>12</month>
<year>2024</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2025 Gonz&#xe1;lez-T&#xe9;llez and Riquelme</copyright-statement>
<copyright-year>2025</copyright-year>
<copyright-holder>Gonz&#xe1;lez-T&#xe9;llez and Riquelme</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>Chitin is a crucial structural polysaccharide in fungal cell walls, essential for maintaining cellular plasticity and integrity. Its synthesis is orchestrated by chitin synthases (CHS), a major family of transmembrane proteins. In <italic>Saccharomyces cerevisiae</italic>, the cargo receptor Chs7, belonging to the Shr3-like chaperone family, plays a pivotal role in the exit of Chs3 from the endoplasmic reticulum (ER) and its subsequent activity in the plasma membrane (PM). However, the auxiliary machinery responsible for CHS trafficking in filamentous fungi remains poorly understood. The <italic>Neurospora crassa</italic> genome encodes two orthologues of Chs7: chitin synthase export (CSE) proteins CSE-7 (NCU05720) and CSE-8 (NCU01814), both of which are highly conserved among filamentous fungi. In contrast, yeast forms only possess a single copy CHS export receptor. Previous research highlighted the crucial role of CSE-7 in the localization of CHS-4 at sites of cell wall synthesis, including the Spitzenk&#xf6;rper (SPK) and septa. In this study, CSE-8 was identified as an export protein for CHS-3 (class I). In the <italic>&#x394;cse-8</italic> knockout strain of <italic>N. crassa</italic>, CHS-3-GFP fluorescence was absent from the SPK or septa, indicating that CSE-8 is required for the exit of CHS-3 from the ER. Additionally, sexual development was disrupted in the <italic>&#x394;cse-8</italic> strain, with 20% of perithecia from homozygous crosses exhibiting two ostioles. A <italic>&#x394;cse-7;&#x394;cse-8</italic> double mutant strain showed reduced N-acetylglucosamine (GlcNAc) content and decreased radial growth. Furthermore, the loss of cell polarity and the changes in subcellular distribution of CSE-8-GFP and CHS-3-GFP observed in hyphae under ER stress induced by the addition of tunicamycin and dithiothreitol reinforce the hypothesis that CSE-8 functions as an ER protein. The current evidence suggests that the biogenesis of CHS exclusive to filamentous fungi may involve pathways independent of CSE-mediated receptors.</p>
</abstract>
<kwd-group>
<kwd>chitin synthases</kwd>
<kwd>endoplasmic reticulum</kwd>
<kwd>cargo receptor protein</kwd>
<kwd>Spitzenk&#xf6;rper</kwd>
<kwd>endoplasmic reticulum chaperones</kwd>
<kwd>perithecia</kwd>
</kwd-group>
<counts>
<fig-count count="9"/>
<table-count count="2"/>
<equation-count count="0"/>
<ref-count count="74"/>
<page-count count="18"/>
<word-count count="8735"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Fungal Genomics and Evolution</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>The fungal cell wall is a dynamic structure essential for maintaining cell integrity. It is primarily composed of structural polysaccharides, including chitin, glucans, and proteins. Chitin, a homopolymer of N-acetylglucosamine (GlcNAc) subunits linked by &#x3b2;-(1,4)-glycosidic bonds, forms a network of linear molecules that confer rigidity and strength to the cell wall (<xref ref-type="bibr" rid="B9">Bowman and Free, 2006</xref>; <xref ref-type="bibr" rid="B21">Gow et&#xa0;al., 2017</xref>; <xref ref-type="bibr" rid="B30">Kar et&#xa0;al., 2019</xref>). The synthesis of chitin is catalyzed by chitin synthases (CHS), which are delivered to synthesis sites via specialized microvesicles known as chitosomes (<xref ref-type="bibr" rid="B3">Bartnicki-Garcia et&#xa0;al., 1978</xref>). The CHS family is divided into seven classes based on their amino acid composition and is further categorized into three divisions according to their conserved protein domains (<xref ref-type="bibr" rid="B47">Pacheco-Arjona and Ramirez-Prado, 2014</xref>). Division 1 includes classes I, II, and III of CHSs, characterized by a hydrophobic C-terminal domain and a hydrophilic catalytic subdomain in the N-terminal region. Division 2 encompasses classes IV, V, and VII, all sharing a conserved cytochrome b5 catalytic domain. Division 3 comprises class VI CHS, distinguished by a Pfam03142 domain and a signal peptide motif (<xref ref-type="bibr" rid="B54">Riquelme and Bartnicki-Garc&#xed;a, 2008</xref>; <xref ref-type="bibr" rid="B18">Fajardo-Somera et&#xa0;al., 2015</xref>). Notably, CHS classes III, V, VI, and VII are unique to filamentous fungi.</p>
<p>In the <italic>Neurospora crassa</italic> genome, there are seven <italic>chs</italic> genes, each encoding a different class of CHS, which play distinct roles during cell development and septum biogenesis (<xref ref-type="bibr" rid="B6">Borkovich et&#xa0;al., 2004</xref>; <xref ref-type="bibr" rid="B11">Cabib, 2004</xref>; <xref ref-type="bibr" rid="B54">Riquelme and Bartnicki-Garc&#xed;a, 2008</xref>; <xref ref-type="bibr" rid="B12">Cabib and Schmidt, 2013</xref>; <xref ref-type="bibr" rid="B18">Fajardo-Somera et&#xa0;al., 2015</xref>). All <italic>N. crassa</italic> CHS are transported to the plasma membrane (PM) within chitosomes that accumulate in the core of the Spitzenk&#xf6;rper (SPK) before being secreted (<xref ref-type="bibr" rid="B1">Bartnicki-Garcia, 1987</xref>, <xref ref-type="bibr" rid="B2">2006</xref>; <xref ref-type="bibr" rid="B55">Riquelme et&#xa0;al., 2007</xref>; <xref ref-type="bibr" rid="B53">Riquelme, 2013</xref>; <xref ref-type="bibr" rid="B18">Fajardo-Somera et&#xa0;al., 2015</xref>). However, the factors regulating CHS transport and PM activity remain poorly understood, and the machinery involved in the exit of CHS from the endoplasmic reticulum (ER), where they are packaged for transport to the apical zones of the hyphae, is largely unknown. In the model yeast <italic>Saccharomyces cerevisiae</italic>, there are only three CHS classes, with Chs3 (class IV) responsible for synthesizing 90-95% of the chitin (<xref ref-type="bibr" rid="B48">Pammer et&#xa0;al., 1992</xref>; <xref ref-type="bibr" rid="B66">Sudoh et al., 1999</xref>; <xref ref-type="bibr" rid="B10">Bulik et&#xa0;al., 2003</xref>; <xref ref-type="bibr" rid="B46">Orlean, 2012</xref>). For Chs3 to exit the ER, it must be palmitoylated by Pfa4 at two catalytic sites, allowing it to associate with Chs7 (<xref ref-type="bibr" rid="B70">Trilla et&#xa0;al., 1999</xref>; <xref ref-type="bibr" rid="B36">Lam et&#xa0;al., 2006</xref>; <xref ref-type="bibr" rid="B20">Gonz&#xe1;lez Montoro et&#xa0;al., 2011</xref>; <xref ref-type="bibr" rid="B46">Orlean, 2012</xref>). A &#x394;<italic>chs7</italic> strain exhibits a chitin content defect nearly identical to &#x394;<italic>chs3</italic>, and the deletion of <italic>CHS7</italic> causes Chs3-GFP to accumulate in the ER (<xref ref-type="bibr" rid="B70">Trilla et&#xa0;al., 1999</xref>; <xref ref-type="bibr" rid="B46">Orlean, 2012</xref>). Thus, Chs7 functions as a chaperone for Chs3. Furthermore, while initially characterized as an ER-resident protein responsible for Chs3 egress to the Golgi apparatus (<xref ref-type="bibr" rid="B70">Trilla et&#xa0;al., 1999</xref>), later studies demonstrated that Chs7 does not remain in the ER after Chs3 exit. Instead, it forms a complex with Chs3 that facilitates its proper folding and activity in the PM (<xref ref-type="bibr" rid="B17">Dharwada et&#xa0;al., 2018</xref>). In <italic>Candida albicans</italic>, a <italic>CHS7</italic> deletion mutant resulted in reduced chitin levels, morphogenetic alterations, and also attenuated virulence (<xref ref-type="bibr" rid="B60">Sanz et&#xa0;al., 2005</xref>).</p>
<p>
<italic>S. cerevisiae</italic> Chs7 belongs to a small group of four ER chaperone-like transmembrane proteins known as &#x201c;Shr3-like&#x201d; proteins, which include Shr3, Pho86, Gsf2, and Chs7 (<xref ref-type="bibr" rid="B33">Kota and Ljungdahl, 2005</xref>). These proteins function as specialized chaperones that prevent the aggregation of PM proteins at the ER by ensuring proper folding (<xref ref-type="bibr" rid="B33">Kota and Ljungdahl, 2005</xref>). Unlike other chaperones, &#x201c;Shr3-like&#x201d; proteins do not interact with a broad range of cargoes and lack conserved domains common to other chaperone families. Shr3, an ER-resident protein, assists amino acid permeases (AAPs) by utilizing its hydrophilic C-terminal domain to associate with COPII coatomer subunits, facilitating AAP transport through the secretory pathway (<xref ref-type="bibr" rid="B33">Kota and Ljungdahl, 2005</xref>). Similarly, Pho86 is an ER protein responsible for packaging the phosphate transporter Pho84 into COPII vesicles for secretory transport (<xref ref-type="bibr" rid="B37">Lau et&#xa0;al., 2000</xref>; <xref ref-type="bibr" rid="B62">Shen et&#xa0;al., 2012</xref>). Mutations in Gsf2 lead to the accumulation of the hexose transporter Hxt1 at ER exit sites (<xref ref-type="bibr" rid="B63">Sherwood and Carlson, 1999</xref>).</p>
<p>The function of Chs7 orthologous proteins in filamentous fungi remained unclear until two orthologues of <italic>S. cerevisiae</italic> Chs7 were identified in <italic>N. crassa</italic>. The first orthologue, CSE-7 (<italic>Chitin Synthase Export chaperone 7</italic>), is located in the ER and tubular vacuoles, where it plays a role in the secretion and biogenesis of CHS-4, a class IV CHS ortholog of the yeast Chs3 (<xref ref-type="bibr" rid="B52">Rico-Ram&#xed;rez et&#xa0;al., 2018</xref>). The <italic>&#x394;cse-7</italic> strain of <italic>N. crassa</italic> did not display significant phenotypic alterations, consistent with the phenotype of the <italic>&#x394;chs-4</italic> strain. In contrast, the <italic>Trichoderma atroviridae &#x394;cse-7</italic> strain exhibited noticeable changes in colony morphology, characterized by stratified mycelium with abundant branching (<xref ref-type="bibr" rid="B29">Kappel et&#xa0;al., 2020</xref>). Much of what is known about CHS biogenesis and transport to the apical region and PM comes from studies in yeast (<xref ref-type="bibr" rid="B44">Munro et al., 2001</xref>; <xref ref-type="bibr" rid="B49">Preechasuth et al., 2015</xref>). Research in <italic>S. cerevisiae</italic> has identified several auxiliary proteins that function as chaperones in the vesicular trafficking of chitosomes (<xref ref-type="bibr" rid="B43">Munro, 2013</xref>; <xref ref-type="bibr" rid="B59">Sanz, 2004</xref>). This study investigated the role of the second <italic>S. cerevisiae</italic> Chs7 orthologue, CSE-8 (<italic>Chitin Synthase Export chaperone 8</italic>), in CHS trafficking. Our findings provide evidence that CSE-8 is involved in the trafficking of CHS-3 (Class I)-carrying chitosomes, with their transport to septa and SPK being disrupted in the absence of the <italic>cse-8</italic> gene.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<label>2</label>
<title>Materials and methods</title>
<sec id="s2_1">
<label>2.1</label>
<title>Molecular constructs</title>
<p>Endogenous labeling of <italic>cse-8</italic> with <italic>gfp</italic> was carried out using the Split Marker method (<xref ref-type="bibr" rid="B64">Smith et&#xa0;al., 2011</xref>). The oligonucleotides cse-8/Gly-FW and cse-8/Gly-RV (<xref ref-type="table" rid="T1"><bold>Table&#xa0;1</bold></xref>) were used to directly amplify the ORF of the <italic>cse-8</italic> gene using genomic DNA from <italic>N. crassa</italic> FGSC #988 strain as a template. Likewise, the oligonucleotides FW-lox/3&#x2019;cse-8 and RV-lox/3&#x2019;cse-8 (<xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>) were used to amplify the 3&#x2019; UTR region of the <italic>cse-8</italic> gene. The plasmid pRS416 (<xref ref-type="bibr" rid="B26">Honda and Selker, 2009</xref>), was used as a template to amplify the green fluorescent protein gene (<italic>gfp</italic>) fused to 10 glycines and the <italic>hph</italic> gene (hygromycin B conferring resistant gene) using the oligonucleotides loxP-R and 10xGly-F (<xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>). Subsequently, fusion PCRs were performed to fuse the PCR products and obtain the constructs <italic>cse-8::gfp::hph</italic> and <italic>hph::cse-8</italic>. The resulting constructs were purified after running them by gel electrophoresis (1% agarose), and conidia of <italic>N. crassa</italic> (FGSC #9718) were transformed with 500 ng of each construct by electroporation in a Biorad Gene Pulser Electroporation using 0.2 mm electroporation cuvettes (600 OHMS, 25 &#x3bc;FD, 1.5 KV).</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Primers used in this study.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="center">Name</th>
<th valign="top" align="center">Sequence</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">P1-cse8 FW</td>
<td valign="top" align="left">CCTCCATATTTACAGGACTTCTGTCG</td>
</tr>
<tr>
<td valign="top" align="left">P2-cse8 RV</td>
<td valign="top" align="left">GGCCAATCGTCTTCGGTAATGCTG</td>
</tr>
<tr>
<td valign="top" align="left">cse-8/Gly FW</td>
<td valign="top" align="left">ATGGGCTCAACACAATTTGGCAACTTTCATG</td>
</tr>
<tr>
<td valign="top" align="left">cse-8/Gly RV</td>
<td valign="top" align="left">CCTCCGCCTCCGCCTCCGCCGCCTCCGCCTGGGAACTGGTTAGGCGGAACC</td>
</tr>
<tr>
<td valign="top" align="left">lox/3'cse-8 FW</td>
<td valign="top" align="left">TGCTATACGAAGTTATGGATCCGAGCTCGAAGGGCCAGTACAGGTTGAAGTCTCG</td>
</tr>
<tr>
<td valign="top" align="left">lox/3'cse-8 RV</td>
<td valign="top" align="left">GGGCACGACAAATCGGATTTATGGG</td>
</tr>
<tr>
<td valign="top" align="left">cse-8_3'UTR</td>
<td valign="top" align="left">CGTCCGCATGTTCTTCTTCCA</td>
</tr>
<tr>
<td valign="top" align="left">chs-1_ORF</td>
<td valign="top" align="left">CGTCCGCATGTTCTTCTTCCACGT</td>
</tr>
<tr>
<td valign="top" align="left">ORF chs-3 FW</td>
<td valign="top" align="left">CCGCCTTTGGCTTCATTTCCGTCT</td>
</tr>
<tr>
<td valign="top" align="left">ORF chs-3 RV</td>
<td valign="top" align="left">CGTGTAGCTTCTCACCGGCAAAGT</td>
</tr>
<tr>
<td valign="top" align="left">FWPccg1</td>
<td valign="top" align="left">TTCGTTCAAAGCCACATCACTGGG</td>
</tr>
<tr>
<td valign="top" align="left">GFP-F/P5</td>
<td valign="top" align="left">ATGGTGAGCAAGGGCGAG</td>
</tr>
<tr>
<td valign="top" align="left">GFP-R/P6</td>
<td valign="top" align="left">CTTGTACAGCTCGTCCATGC</td>
</tr>
<tr>
<td valign="top" align="left">loxP-R</td>
<td valign="top" align="left">CGAGCTCGGATCCATAACTTCGTATA</td>
</tr>
<tr>
<td valign="top" align="left">10xGly-F</td>
<td valign="top" align="left">GGCGGAGGCGGCGGAGGCGGAGGC</td>
</tr>
<tr>
<td valign="top" align="left">hph SM-r</td>
<td valign="top" align="left">TCGCCTCGCTCCAGTCAATGACC</td>
</tr>
<tr>
<td valign="top" align="left">hph SM-f</td>
<td valign="top" align="left">AAAAAGCCTGAACTCACCGCGACG</td>
</tr>
<tr>
<td valign="top" align="left">chs-5 P1 seq F</td>
<td valign="top" align="left">CTGACAACACTGCTTCTTAAGTTC</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_2">
<label>2.2</label>
<title>Strains and culture conditions</title>
<p>All fungal or bacterial strains used or generated in this study are listed in <xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>. <italic>N. crassa</italic> strains were grown in Vogel&#x2019;s minimum medium (VMM) supplemented with 1.5% sucrose and 1% agar (<xref ref-type="bibr" rid="B71">Vogel, 1956</xref>). For phenotypic characterization, 1x10<sup>5</sup> conidia were inoculated onto VMM plates supplemented with NaCl (0.8 mM), KCl (0.8 mM), and Congo Red (100 mg/mL) to induce osmotic and cell wall stress. For optimal growth, inoculated flasks and plates were incubated at 30&#xb0;C (<xref ref-type="bibr" rid="B16">Davis, 2000</xref>). For the selection of hygromycin-resistant transformants, conidia were incubated in a recovery solution (1X Vogel&#x2019;s salts and 2% yeast extract) after electroporation. After 3 hours of incubation, transformed conidia of FGSC #9718 were inoculated onto FGS medium supplemented with hygromycin B (300 &#x3bc;g/mL). The conidia of FGSC #9717 strains were inoculated on FGS plates with or without (for negative controls) histidine (0.25 mg/mL). The FGS medium contains 2% Vogel&#x2019;s salts, 1% agar, and 10% FGS solution (0.5% fructose, 0.5% glucose, and 20% sorbose). All media components were sterilized by filtration, and the media were autoclaved at 15 lbf/in<sup>2</sup> for 15 minutes. Synthetic crossing medium (50% SCM 2X solution, 2% sucrose, and 1.5% agar) was used to obtain homokaryotic &#x394;<italic>cse-8</italic> strains expressing CHS-1-GFP, CHS-3-GFP, or CHS-5-GFP, and a double mutant strain &#x394;<italic>cse-8;</italic>&#x394;<italic>cse-7</italic>.</p>
<table-wrap id="T2" position="float">
<label>Table&#xa0;2</label>
<caption>
<p>Strains and plasmids used or generated in this study.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Strain</th>
<th valign="top" align="left">Genotype</th>
<th valign="top" align="left">Source</th>
</tr>
</thead>
<tbody>
<tr>
<th valign="top" colspan="3" align="left">
<italic>Escherichia coli</italic>
</th>
</tr>
<tr>
<td valign="top" align="left">DH5<sup>TM</sup>
</td>
<td valign="top" align="left">F<sup>-</sup> &#x3a6;80lacZ&#x394;M15 &#x394;(lacZYA-argF) U169 recA1 endA1 hsdR17(rk<sup>-</sup>,mk<sup>+</sup>) phoA supE44thi-1 gyrA96 relA1 &#x3bb;<sup>-</sup>
</td>
<td valign="top" align="left">Invitrogen &#xae;</td>
</tr>
<tr>
<th valign="top" colspan="3" align="left">
<italic>Neurospora crassa</italic>
</th>
</tr>
<tr>
<td valign="top" align="left">FGSC #4200</td>
<td valign="top" align="left">
<italic>mat A;</italic> wild type</td>
<td valign="top" align="left">FGSC</td>
</tr>
<tr>
<td valign="top" align="left">FGSC #9717</td>
<td valign="top" align="left">
<italic>his-3::&#x394;mus-51</italic>::<italic>bar<sup>+</sup>
</italic>
</td>
<td valign="top" align="left">FGSC</td>
</tr>
<tr>
<td valign="top" align="left">FGSC #9718</td>
<td valign="top" align="left">
<italic>&#x394;mus-51::bar<sup>+</sup>
</italic>
</td>
<td valign="top" align="left">FGSC</td>
</tr>
<tr>
<td valign="top" align="left">FGSC #13138</td>
<td valign="top" align="left">&#x394;<italic>cse-8; mat A; hyg<sup>r</sup>
</italic>
</td>
<td valign="top" align="left">FGSC</td>
</tr>
<tr>
<td valign="top" align="left">NSSG1</td>
<td valign="top" align="left">&#x394;<italic>cse-7;</italic> &#x394;<italic>cse-8; mat a; hyg<sup>r</sup>
</italic>
</td>
<td valign="top" align="left">This study</td>
</tr>
<tr>
<td valign="top" align="left">FGSC #13680</td>
<td valign="top" align="left">&#x394;<italic>cse-7; mat A; hyg<sup>r</sup>
</italic>
</td>
<td valign="top" align="left">FGSC</td>
</tr>
<tr>
<td valign="top" align="left">NSSG2</td>
<td valign="top" align="left">&#x394;<italic>cse-8::hph<sup>r</sup>; &#x394;cse-7::hph<sup>r</sup>
</italic>
</td>
<td valign="top" align="left">This study</td>
</tr>
<tr>
<td valign="top" align="left">SMRP207</td>
<td valign="top" align="left">
<italic>Pchs-5::chs-5::gfp</italic>; <italic>hph</italic>; <italic>mat a</italic>
</td>
<td valign="top" align="left">
<xref ref-type="bibr" rid="B18">Fajardo-Somera et al. 2015</xref>
</td>
</tr>
<tr>
<td valign="top" align="left">FGSC #13408</td>
<td valign="top" align="left">
<italic>Pchs-1::chs-1::gfp</italic>; <italic>hph</italic>; <italic>mat a</italic>
</td>
<td valign="top" align="left">
<xref ref-type="bibr" rid="B58">S&#xe1;nchez-Le&#xf3;n et al. 2011</xref>
</td>
</tr>
<tr>
<td valign="top" align="left">NSSG3</td>
<td valign="top" align="left">
<italic>Pcse-8::gfp::hph; &#x394;mus-51::bar<sup>+</sup>
</italic>
</td>
<td valign="top" align="left">This study</td>
</tr>
<tr>
<td valign="top" align="left">NSSG4</td>
<td valign="top" align="left">
<italic>Pchs-1::sgfp::hph; &#x394;cse-8, hyg<sup>r</sup> , &#x394;mus-51::bar<sup>+</sup>
</italic>
</td>
<td valign="top" align="left">This study</td>
</tr>
<tr>
<td valign="top" align="left">NSSG5</td>
<td valign="top" align="left">
<italic>Pchs-5::sgfp::hph; &#x394;cse-8, hyg<sup>r</sup> , &#x394;mus-51::bar<sup>+</sup>
</italic>
</td>
<td valign="top" align="left">This study</td>
</tr>
<tr>
<td valign="top" align="left">NMR3-1</td>
<td valign="top" align="left">
<italic>his3<sup>+</sup>::Pccg-1-chs3-sgfp</italic>
</td>
<td valign="top" align="left">
<xref ref-type="bibr" rid="B55">Riquelme et&#xa0;al. 2007</xref>
</td>
</tr>
<tr>
<td valign="top" align="left">NSSG6</td>
<td valign="top" align="left">
<italic>his3<sup>+</sup>::Pccg-1-chs3-sgfp; &#x394;cse-8</italic>
</td>
<td valign="top" align="left">This study</td>
</tr>
<tr>
<td valign="top" align="left">SMRP302</td>
<td valign="top" align="left">
<italic>his-3 <sup>+</sup>::Pccg-1::mchfp<sup>+</sup>::ypt-1; &#x394;mus51::bar<sup>+</sup>
</italic>
</td>
<td valign="top" align="left">
<xref ref-type="bibr" rid="B57">S&#xe1;nchez-Le&#xf3;n et&#xa0;al. 2014</xref>
</td>
</tr>
<tr>
<td valign="top" align="left">FGSC #10159</td>
<td valign="top" align="left">
<italic>Pccg-1::dsred-nca-1::his-3<sup>+</sup>:: &#x394;mus51::bar+</italic>
</td>
<td valign="top" align="left">
<xref ref-type="bibr" rid="B8">Bowman et&#xa0;al. 2009</xref>
</td>
</tr>
<tr>
<td valign="top" align="left">FGSC #11624</td>
<td valign="top" align="left">
<italic>Pccg-1::rfp-grp-78::his-3<sup>+</sup>:: &#x394;mus51::bar+</italic>
</td>
<td valign="top" align="left">
<xref ref-type="bibr" rid="B8">Bowman et&#xa0;al. 2009</xref>
</td>
</tr>
<tr>
<th valign="top" colspan="3" align="left">Plasmids</th>
</tr>
<tr>
<td valign="top" align="left">pRS416</td>
<td valign="top" align="left">10xGly<italic>::gfp::hph</italic>
</td>
<td valign="top" align="left">
<xref ref-type="bibr" rid="B26">Honda and Selker, 2009</xref>
</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_3">
<label>2.3</label>
<title>Confocal microscopy and image processing</title>
<p>We used an Olympus SZX12 stereoscopic microscope adapted to a C-HP4 8MP 4K, Full HD C-mount camera and equipped with an Olympus DF PLAPO 1XPF objective to image colony morphology and perithecia. An Olympus Fluoview FV1000 inverted Laser scanning confocal microscope (LSCM) was used to image GFP, dsRED, mCherry, and RFP-tagged proteins, employing 488 nm and 543 nm Lasers. FM4-64, diluted in liquid VMM to a final concentration of 5 &#xb5;M, was used to stain the NSSG3 strain to identify CSE-8 in subcellular compartments. Nuclei were stained with a stock solution of Hoechst 33258 (100 mg/mL) in distilled water, diluted to a final concentration of 26 &#xb5;g/mL in filtered PBS buffer (pH=5.2) before use. Stock solutions of 1M 1,4-dithiothreitol (DTT, Sigma-Aldrich) in water and 200 &#xb5;M tunicamycin (TM, Sigma-Aldrich) in dimethyl sulfoxide (DMSO) were prepared as ER stressors and used at final concentrations of 1.25 &#xb5;M and 4 &#xb5;g/mL in VMM, respectively. A stock solution of brefeldin A (BFA, Sigma-Aldrich) in DMSO was prepared at 20 mg/mL and diluted in MMV at a final concentration of 200 &#xb5;g/mL. This concentration was selected based on prior studies demonstrating its efficacy in disrupting CHS-4-GFP (class III) transport to the SPK in <italic>N. crassa</italic> (<xref ref-type="bibr" rid="B18">Fajardo-Somera et al., 2015</xref>). All samples were incubated at 30&#xb0;C for 15 to 20 minutes before imaging, following the inverted agar method (<xref ref-type="bibr" rid="B25">Hickey et&#xa0;al., 2004</xref>), and were observed with a PLAPLON 60X N.A. 1.42 objective. Images were acquired using FLUOVIEW FV1000 4.0.2.9 software and analyzed with Fiji Image J version 2.1.0/1.53c software. For FRAP (Fluorescence Recovery After Photobleaching) and FLIP (Fluorescence Loss in Photobleaching) analyses of the CSE-8-GFP strain, selective regions of interest (ROI) of the hyphae were selected for photobleaching and overexposed to 52% of the laser intensity for five seconds. Fluorescence intensity profiles at the SPK region during FRAP and FLIP experiments were analyzed in Fiji Image J using the image and batch tools in the Stowers plugins (<ext-link ext-link-type="uri" xlink:href="https://research.stowers.org/imagejplugins/">https://research.stowers.org/imagejplugins/</ext-link>); easyFRAP web (<ext-link ext-link-type="uri" xlink:href="https://easyfrap.vmnet.upatras.gr/">https://easyfrap.vmnet.upatras.gr/</ext-link>) was also used for the analysis of a photobleached ROI in region II. In this case, a non-photobleached ROI in a distal zone of the hypha and an ROI in the background were used as controls. Spinning disk confocal microscopy (SDCM) was performed to observe the dynamics of CSE-8-GFP and CSE-7-mCherry. A Nikon ECLIPSE Ti-E Ti-E/B inverted microscope was used with a Yokogawa CSU-X1 confocal scanner unit, an ANDOR iXon Ultra camera, and an Apo 60X /0.13-0.21 oil immersion objective. Mean shift super-resolution (MSSR, <xref ref-type="bibr" rid="B68">Torres-Garc&#xed;a et&#xa0;al., 2022</xref>) analysis was applied to improve the resolution of the LSCM and SDCM images. We used an amplification parameter (AMP) value of 3 and a 0-order analysis, while the point spread function (PSF) value was obtained using the &#x2018;ImageDecorrelationAnalysis&#x2019; plugin. Co-localization profiles were obtained with JACoP (<xref ref-type="bibr" rid="B5">Bolte and Cordeli&#xe8;res, 2006</xref>).</p>
</sec>
<sec id="s2_4">
<label>2.4</label>
<title>Analysis of N-acetylglucosamine content in mutant strains</title>
<p>To further investigate the role of CSE-8 in the CHS secretory pathway and cell wall chitin synthesis, a colorimetric assay was performed to quantify GlcNAc content in the WT, <italic>&#x394;cse-8</italic>, <italic>&#x394;cse-7</italic>, and <italic>&#x394;cse-8; &#x394;cse-7</italic> strains following the specifications previously described (<xref ref-type="bibr" rid="B42">Morgan and Elson, 1934</xref>; <xref ref-type="bibr" rid="B18">Fajardo-Somera et&#xa0;al., 2015</xref>).</p>
</sec>
<sec id="s2_5">
<label>2.5</label>
<title>Bioinformatic analysis</title>
<p>To analyze the distribution of orthologues of CSE-7 (NCU05720) and CSE-8 (NCU01814) in the fungal kingdom and other organisms, an alignment of CSE-8 and CSE-7 was performed to identify the conserved domains of both proteins. The alignment was then used as input for HMMsearch (<ext-link ext-link-type="uri" xlink:href="https://www.ebi.ac.uk/Tools/hmmer/search/phmmer">https://www.ebi.ac.uk/Tools/hmmer/search/phmmer</ext-link>) to obtain orthologous sequences to the CSE proteins. The resulting sequences were used for phylogenetic analysis, selecting amino acid sequences from representative species of each phylum. The sequences selected were aligned using MAFFT in Jalview v. 2.11.2.5. The resulting alignment was used to construct a phylogenetic tree by maximum likelihood using the Jones-Taylor-Thorton method, with a bootstrap value of 10000 and an amino acid substitution model. The phylogenetic tree obtained was edited in iTOL v6 (<xref ref-type="bibr" rid="B39">Letunic and Bork, 2024</xref>; <ext-link ext-link-type="uri" xlink:href="https://itol.embl.de/tree/1589766147326311667424835#">https://itol.embl.de/tree/1589766147326311667424835#</ext-link>). The distribution of transmembrane domains, -sheets, and -helix structures displayed were carried out based on Uniprot (<ext-link ext-link-type="uri" xlink:href="https://www.uniprot.org/">https://www.uniprot.org/</ext-link>) and AlphaFold (<ext-link ext-link-type="uri" xlink:href="https://colab.research.google.com/github/sokrypton/ColabFold/blob/main/AlphaFold2.ipynb">https://colab.research.google.com/github/sokrypton/ColabFold/blob/main/AlphaFold2.ipynb</ext-link>). Only structures predicted by AlphaFold with a pLDDT (per-residue measure of local confidence) greater than 50 were considered to outline the secondary structure of the proteins. Alpha-Fold and I-TASSER (<ext-link ext-link-type="uri" xlink:href="https://zhanggroup.org/I-TASSER/">https://zhanggroup.org/I-TASSER/</ext-link>) were utilized to predict the protein structures of CSE-8. Molecular docking analyses were performed using the HADOCK SERVER (<xref ref-type="bibr" rid="B73">Yan et&#xa0;al., 2020</xref>); <ext-link ext-link-type="uri" xlink:href="http://hdock.phys.hust.edu.cn/">http://hdock.phys.hust.edu.cn/</ext-link>) and AlphaFold 3 (<xref ref-type="bibr" rid="B28">Jumper et al., 2021</xref>; <uri xlink:href="https://alphafoldserver.com">https://alphafoldserver.com</uri>). Predicted protein structures and potential interactions between CHS and CSE proteins were analyzed and visualized in PyMOL Molecular Graphics System, Version 2.5.4, Schr&#xf6;dinger, LLC.</p>
</sec>
<sec id="s2_6">
<label>2.6</label>
<title>Statistical analysis</title>
<p>All graphs and statistical analysis presented in this article were performed using GraphPad Prism version 9.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<label>3</label>
<title>Results and discussion</title>
<sec id="s3_1">
<label>3.1</label>
<title>CSE-8, a second <italic>N. crassa</italic> orthologue of the <italic>S. cerevisiae</italic> chitin synthase 3 (class IV) cargo receptor Chs7, is widely distributed throughout the fungal kingdom</title>
<p>Unlike in yeasts, little is known about the mechanisms governing the vesicular transport of CHSs in filamentous fungi. In order to investigate potential components of the protein machinery involved in this transport, the orthologues of the yeast Chs7 were identified in <italic>N. crassa</italic>. The function of the Chs7 orthologue CSE-7 (NCU05720) in the transport of CHS-4 (Class IV) has previously been described in <italic>N. crassa</italic> hyphae (<xref ref-type="bibr" rid="B52">Rico-Ram&#xed;rez et&#xa0;al., 2018</xref>). CSE-7 acts as a cargo receptor for CHS-4, facilitating its transport from the ER to the SPK and septa. We identified a second Chs7 orthologue, NCU01814, and named it CSE-8 (for <italic>chitin synthase export chaperone 8</italic>) after confirming its role in CHS intracellular traffic.</p>
<p>CSE-8 (Q1K536) was previously annotated as a hypothetical protein and classified as a member of the pfam12271 protein family, which includes proteins with the Chs3 catalytic domain. BLASTp analysis revealed that CSE-8 shares 25.42% identity with Chs7 (J4U2B4) and 31.12% with CSE-7 (Q7SB92; <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>). Like CSE-7 (358 aa, 39.3 kDa) and Chs7 (316 aa, 34.9 kDa), CSE-8 (299 aa, 33.1 kDa) contains seven transmembrane alpha-helix regions and four cytoplasmic domains with conserved amino acid residues (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref>). Despite their structural similarities, CSE-7 is unique in having a long-disordered domain at its C-terminal region (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref>).</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Protein secondary structure and phylogenetic distribution of CSE proteins. <bold>(A)</bold> Identity percent matrix of CSE-8 (NCU01814), CSE-7 (NCU05720) and Chs7 (YHR142W). <bold>(B)</bold> Secondary protein structures of CSE-7, CSE-8, and Chs7. Regions with the highest sequence conservation are colored in red, while transmembrane domains are shown in yellow. All three proteins feature seven transmembrane domains and two &#x3b2;-sheets. Notably, CSE-7 has a large, disordered region at its C-terminus. Models for these proteins were generated using AlphaFold 3, except for CHS-3, whose model was obtained from Swiss-Prot and aligned with the AlphaFold model. These structural models were used as the basis for molecular docking analyses. <bold>(C)</bold> Phylogenetic tree of Chs7 fungal orthologues. The phylogenetic tree includes representative species from each fungal phylum, showing that CSE proteins are highly conserved across all fungi. All identified proteins belong to the pfam12271 family, with only representative species displayed. Stars point to the species that present a unique CSE protein, and triangles indicate those species with two CSE copies. Bootstrap values are indicated by blue circles on each branch, with only values of 50% or greater considered reliable. The distribution of protein domains for each species is illustrated in schematic cartoons. Proposed secondary structures are based on AlphaFold models, with only regions having a pLDDT score greater than 50 displayed. The following nomenclature is used: rectangles for -sheets, diamonds for -helices, and ellipses for transmembrane domains. Each dotted line is equivalent to 100 aminoacids.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="ffunb-05-1505388-g001.tif"/>
</fig>
<p>To assess the conservation of these proteins across the fungal kingdom, we performed an HMM search. These proteins had E-values ranging from 2.5 x 10<sup>-152</sup> to 0.77. Of the identified sequences, 927 were&#xa0;from Ascomycota, 380 from Basidiomycota, 67 from Mucormycota, 45 from Zoopagomycota, 19 from Microsporidia, 26 from Chytridiomycota, 7 from Blastocladiomycota, and 2 from Cryptomycota. Representative species from each phylum were selected to construct the phylogenetic tree, where CSE proteins grouped into two distinct clades, one corresponding to CSE-7 orthologues and the other to CSE-8 orthologues. As expected, CSE-7 clustered with Chs7 from <italic>S. cerevisiae</italic>, reflecting the&#xa0;conserved identity between these two proteins. Most of the analyzed sequences grouped within the CSE-7 clade, which is characterized by the conservation of a disordered region in the C-terminal part of the protein. Most of the phylogenetically analyzed CSE proteins share common features, including two&#xa0;conserved &#x3b2;-sheets in the N-terminal region and seven predicted transmembrane domains. Most CSE proteins have a molecular weight below 45 kDa, fitting the typical profile of chaperones, which are usually small proteins. Larger CSEs (<italic>Rozella allomycis</italic> A0A075AX29 and A0A075AVG7, <italic>Rhizoctonia solani</italic> A0A0K6FLV5, <italic>Carpinus fangiana</italic> A0A5N6KZK2), are enriched with repeated &#x3b2;-sheet and -helix structures.</p>
<p>Different species had varying numbers of non-redundant sequences containing the characteristic domains of CSE-7 and CSE-8. For example, <italic>Basidiobolus meristosporus</italic> (Zoopagomycota), <italic>Fibularhizoctonia</italic> sp. (Basidiomycota), <italic>Conidiobulus coronatus</italic> (Zoopagomycota), and <italic>Absidia rapens</italic> (Mucormycota) have 9, 3, 4, and 3 proteins from the pfam12271 family, respectively (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref>). Within the Ascomycota, filamentous species such as <italic>Aspergillus</italic> spp., <italic>Penicillium</italic> spp., <italic>Trichoderma</italic> spp., and <italic>Fusarium</italic> spp. have two genes encoding CSE proteins. Yeast-like and dimorphic species, such as <italic>S. cerevisiae</italic> and <italic>C. albicans</italic>, have only one CSE protein distributed in the CSE-7 clade. Only the single CSE of <italic>Pneumocystis murina</italic> was distributed in the CSE-8 clade. However, the dimorphic fungal pathogen <italic>Coccidioides immitis</italic> is an exception, possessing two CSE proteins. Another exception was <italic>Ustilago maydis</italic>, which retains a single copy of the CSE and has three morphological stages during its life cycle, including its yeast-like form (<xref ref-type="bibr" rid="B13">Cabrera-Ponce et&#xa0;al., 2012</xref>).</p>
<p>These results suggest that filamentous ascomycetous likely share a conserved mechanism for CHS function, with CSE-7 and CSE-8 serving as auxiliary proteins for the biogenesis of CHS vesicular carriers (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>). Interestingly, one of the sequences identified in the alignment corresponded to a CSE protein from <italic>Carpinus fangiana</italic> (Viridiplantae, Streptophyta, Betulaceae), commonly known as Fang&#x2019;s hornbeam. The homology of this sequence was confirmed by E-value (6.2 x 10<sup>-118</sup>) and bit score (405). The <italic>C. fangiana</italic> CSE protein (A0A5N6KZK2) is 709 amino acids long, contains six transmembrane regions, and is predicted to be a multipass membrane protein. Notably, this protein also preserves a homologous region with the &#x3b1;/&#x3b2; hydrolase fold superfamily (IPR029058), a diverse group of hydrolytic enzymes with different phylogenetic origins and catalytic functions. Additionally, it contains a pleckstrin homology domain, which is typically involved in protein targeting and signal transduction pathways. However, no experimental data currently exists about this unique plant CSE.</p>
</sec>
<sec id="s3_2">
<label>3.2</label>
<title>CSE-8-GFP localizes at sites of polarized growth and septa</title>
<p>To determine the subcellular localization of CSE-8 during polarized growth, the <italic>N. crassa</italic> homokaryon strain expressing CSE-8-GFP was analyzed using LSCM. The subcellular localization pattern of CSE-8-GFP was consistent with previous observations of CHS-tagged fluorescent proteins of <italic>N. crassa</italic> (<xref ref-type="bibr" rid="B55">Riquelme et&#xa0;al., 2007</xref>; <xref ref-type="bibr" rid="B58">S&#xe1;nchez-Le&#xf3;n et&#xa0;al., 2011</xref>; <xref ref-type="bibr" rid="B18">Fajardo-Somera et&#xa0;al., 2015</xref>). There was a prevalence of CSE-8-GFP fluorescence in hyphal regions I and III, more precisely in the SPK and apical regions, as well as in subapical tubular structures (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2A&#x2013;C</bold>
</xref>). FM4-64 staining was used to visualize the localization of CSE-8-GFP within the SPK region, revealing that CSE-8-GFP is concentrated at the SPK core, as shown more clearly through MSSR analysis (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2D, E</bold>
</xref>; <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Video 1</bold>
</xref>). CSE-8-GFP was also observed at septa in mature hyphae, co-localizing with FM4-64 mainly in the central region of the septum (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2F</bold>
</xref>). Additionally, CSE-8 shows partial overlap with FM4-64 in subapical regions of the hyphae, as confirmed by the co-localization plots (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2G, H</bold>
</xref>), indicating its involvement in endocytic pathways, particularly in vacuoles (<xref ref-type="bibr" rid="B19">Fischer&#x2010;Parton et&#xa0;al., 2000</xref>; <xref ref-type="bibr" rid="B24">Hickey et&#xa0;al., 2002</xref>). CSE-8-GFP&#x2019;s appearance in FM4-64-stained organelles is consistent with studies on CHS recycling through the trans-Golgi network in a clathrin-dependent manner, as seen in <italic>S. cerevisiae</italic>, <italic>C. albicans</italic>, and <italic>A. nidulans</italic> (<xref ref-type="bibr" rid="B61">Seaman, 2008</xref>; <xref ref-type="bibr" rid="B65">Starr et al., 2012</xref>; <xref ref-type="bibr" rid="B56">Sacristan et&#xa0;al., 2013</xref>; <xref ref-type="bibr" rid="B23">Hern&#xe1;ndez-Gonz&#xe1;lez et&#xa0;al., 2018</xref>; <xref ref-type="bibr" rid="B32">Knafler et&#xa0;al., 2019</xref>; <xref ref-type="bibr" rid="B27">Jin et&#xa0;al., 2021</xref>). Further research on CSE proteins will help clarify whether their recycling is tied to their association with CHS or an unrelated mechanism. These findings support a function of CSE-8 associated with CHS subcellular transport.</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Subcellular localization of CSE-8 in <italic>N. crassa</italic> hyphae. <bold>(A)</bold> Distribution of CSE-8-GFP fluorescence in a hypha in the regions I, II, and III. <bold>(B)</bold> Graph of the Fluorescence intensity (FI) values along the hyphae displayed in <bold>(A)</bold>. <bold>(C)</bold> Distribution of CSE-8-GFP (green) and FM4-64 (magenta) in subapical regions; yellow arrows and blue arrows point to CSE-8-GFP in tubular compartments and vesicular clusters, respectively. <bold>(D)</bold> The apical region&#x2019;s micrograph shows CSE-8-GFP localization at the SPK in hyphae stained with FM4-64 (channels are the same displayed in <bold>(B)</bold>. The yellow square shows the region of interest (ROI) shown in <bold>(E)</bold>. <bold>(E)</bold> Staining with FM4-64 (magenta) shows that CSE-8-GFP (green) accumulates at the SPK core using MSSR (analyzed using 1<sup>st</sup> order equation). <bold>(F)</bold> Time series of CSE-8-GFP during septum formation, with FM4-64 marking the cell division sites. Blue arrows indicate CSE-8 in the lumen of globular compartments, where the membranes are stained with FM4-64. <bold>(G)</bold> Co-localization plot of CSE-8 with FM4-64 in the subapical region shown in <bold>(B, H)</bold> Co-localization plot of merged channels for the apical zone of the hyphae shown in <bold>(D)</bold> Note that the PC and plot confirms that CSE-8-GFP does not colocalize with the SPK&#x2019;s outer layer stained with FM4-64. PC, Pearson&#x2019;s coefficient; AU, Arbitrary units; scale bars = 10 &#x3bc;m, except for (E)= 2 &#x3bc;m.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="ffunb-05-1505388-g002.tif"/>
</fig>
</sec>
<sec id="s3_3">
<label>3.3</label>
<title>CSE-8 localizes to the endoplasmic reticulum</title>
<p>We aimed to determine whether CSE-8 localizes to the ER, as its orthologue in <italic>S. cerevisiae</italic> (Chs7) has been identified as an ER chaperone, and the <italic>N. crassa</italic> CSE-7 was identified in the nuclear periphery (<xref ref-type="bibr" rid="B70">Trilla et&#xa0;al., 1999</xref>; <xref ref-type="bibr" rid="B17">Dharwada et&#xa0;al., 2018</xref>; <xref ref-type="bibr" rid="B52">Rico-Ram&#xed;rez et&#xa0;al., 2018</xref>). We used RFP-BiP and dsRED-NCA-1 as markers of the rough ER and nuclear envelope, respectively. NCA-1, a homolog of the SERCA-type Ca<sup>2+</sup>-ATPase found in animal cells, primarily localizes to the nuclear envelope in <italic>N. crassa</italic> (<xref ref-type="bibr" rid="B7">Bowman et&#xa0;al., 2011</xref>). On the other hand, BiP, an HSP70 family protein, functions as an ER chaperone involved in post-transcriptional regulation, protein folding, and the recognition of misfolded proteins destined for the unfolded protein response (UPR) pathway under ER stress (<xref ref-type="bibr" rid="B22">Hendershot et&#xa0;al., 1995</xref>). For this work, we renamed the <italic>N. crassa</italic> GRP-78 protein as BiP (<xref ref-type="bibr" rid="B41">Monnerjahn et&#xa0;al., 2001</xref>; <xref ref-type="bibr" rid="B7">Bowman et&#xa0;al., 2011</xref>) based on its orthology to the mammalian and plant binding immunoglobulin protein and the yeast Kar2. The co-localization of CSE-8-GFP with dsRED-NCA-1 or RFP-BiP in heterokaryon strains was observed in region III of the hyphae (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3A, B</bold>
</xref>). Co-localization analysis confirmed the presence of CSE-8 at ER membranes and, to a lower degree, around the nuclei (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3C</bold>
</xref>). Pearson&#x2019;s coefficients showed a stronger correlation between BiP and CSE-8 than between NCA-1 and CSE-8 (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3C</bold>
</xref>), further suggesting that CSE-8 is an ER protein potentially involved in the biogenesis of CHS-carrying microvesicles from the ER, as previously reported for CSE-7 and Chs7.</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>CSE-8-GFP and ER markers in heterokaryon strains of <italic>N. crassa</italic>. <bold>(A)</bold> Subapical region (20 &#x3bc;m from the tip) of a hypha co-expressing CSE-8-GFP and the ER lumen chaperone protein RFP-BiP. <bold>(B)</bold> Subapical region (30 &#x3bc;m from the tip) of a hypha co-expressing CSE-8-GFP and NCA-1-RFP, an ER SERCA-type Ca<sup>2+</sup> ATPase. <bold>(C)</bold> Co-localization plots of the merged channels. The Pearsons&#x2019; coefficients indicate stronger co-localization between RFP-BiP and CSE-8-GFP than NCA-1-RFP and CSE-8-GFP. Scale bars = 10 &#x3bc;m.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="ffunb-05-1505388-g003.tif"/>
</fig>
</sec>
<sec id="s3_4">
<label>3.4</label>
<title>Apical CSE-8 arises from subapical regions of the hyphae</title>
<p>FRAP and FLIP experiments were carried out to elucidate the biogenesis of CSE-8 in <italic>N. crassa</italic> hyphae (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref>). We first assessed whether photobleaching the apex (within the first 5.63 &#xb1; 2.18 &#x3bc;m from the tip) affected the fluorescence of CSE-8-GFP at the SPK, where it accumulates, presumably co-transporting CHS. After photobleaching the SPK region, CSE-8-GFP fluorescence at the SPK recovered about 6.06 &#xb1; 0.34 s after photobleaching (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4A</bold>
</xref>). Since CSE-8-GFP displayed high fluorescence intensity at distal regions of the hypha (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2A, B</bold>
</xref>), we also photobleached a distal ROI (67.33 &#xb1; 6.38 &#x3bc;m from the tip) and measured fluorescence intensity at the SPK (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4B</bold>
</xref>). Fluorescence loss after photobleaching in the subapical region was observed, including a notable decrease in CSE-8-GFP fluorescence at the SPK. The half-time fluorescence recovery value at the SPK was greater for FLIP when applying the photobleaching at an ROI in region III of the hyphae (t<sub>1/2</sub> = 38.95 s), than for FRAP applied directly at the SPK (t<sub>1/2</sub> = 11.36 s) (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4C, D</bold>
</xref>). To support our observations, the photobleaching was also applied to region II of the hyphae (10.99 &#xb1; 0.78 &#x3bc;m from the apex), which is characterized by a high abundance of nuclei (<xref ref-type="fig" rid="f4"><bold>Figure 4E</bold></xref>). FRAP analysis displayed a t<sub>1/2</sub> value of 52.64 s for the photobleached ROI (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4F</bold>
</xref>). Fluorescence at the SPK did not completely disappear following photobleaching at region II, suggesting that most CSE-8-GFP vesicles originate from more distal regions (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4G</bold>
</xref>), rich in rough ER (<xref ref-type="bibr" rid="B40">Mart&#xed;nez-Andrade et&#xa0;al., 2024</xref>). Additionally, a significant portion of the fluorescence may derive from the network of endomembranous cisternae (NEC), where CSE-7 has been previously localized (<xref ref-type="bibr" rid="B52">Rico-Ram&#xed;rez et&#xa0;al., 2018</xref>). These findings suggest that CHS synthesis occurs in the subapical regions and that efficient transport to the apex is essential for polarized growth.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss in Photobleaching (FLIP) of CSE-8-GFP. <bold>(A)</bold> FRAP at the SPK region. The photobleached area is indicated by a cyan circle, with the blue arrow in the third panel marking the re-establishment of CSE-8-GFP fluorescence at the SPK. <bold>(B)</bold> Time-lapse of subapical FRAP of CSE-8-GFP. The cyan box highlights the photobleached region, and the blue arrow indicates the fluorescence loss at the SPK after photobleaching. Fluorescence intensity at the SPK (FLIP) following photobleaching at apical <bold>(C)</bold> and subapical regions <bold>(D)</bold>. The measured area in <bold>(A)</bold> corresponds to 5.83 px<sup>2</sup> in the SPK region, while the measured area in <bold>(B)</bold> covers 22.8 px<sup>2</sup>. <bold>(E)</bold> Time series of the photobleached region II during FRAP experiments. <bold>(F)</bold> Fluorescence intensity profiles of the photobleached region II indicated in the cyan box (measured area of 12.44 px<sup>2</sup>). <bold>(G)</bold> Fluorescence intensity profiles in the SPK (FLIP) during FRAP are shown in Figure E (measured area of 4.32 px<sup>2</sup>). The bars in the plots indicate the standard error of the mean calculated for each time point (n = 4). In both graphs, the fluorescence intensity at the SPK in non-photobleached hyphae corresponds to the pink line (control). The 50% fluorescence recovery time (t<sub>1/2</sub>) is shown on each graph. Notably, fluorescence is more affected throughout the experiment when photobleaching occurs in the subapical region than in the SPK. Yellow and cyan arrows indicate CSE-8-GFP at the SPK. For FLIP experiments shown in B, all selected ROIs for bleaching were positioned 60 &#xb1; 5 &#x3bc;m from the tip. AU: arbitrary units; scale bars = 10 &#x3bc;m.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="ffunb-05-1505388-g004.tif"/>
</fig>
</sec>
<sec id="s3_5">
<label>3.5</label>
<title>CSE-8 and CSE-7 travel in different vesicles in <italic>N. crassa</italic> hyphae</title>
<p>CSE-8 exhibits a subcellular distribution similar to the one previously reported for CSE-7 by <xref ref-type="bibr" rid="B52">Rico-Ram&#xed;rez et&#xa0;al. (2018)</xref>. To compare the dynamics of these two proteins, a heterokaryon strain co-expressing CSE-8-GFP and CSE-7-mCherry was analyzed using SDCM. We used SDCM rather than LSCM in order to observe the dynamics of the two proteins in near real-time and to avoid possible spurious co-localization due to scanning time. When the two fluorescence channels were superimposed, overlapping spots of CSE-8 and CSE-7 were observed at subapical regions of the hyphae (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5A</bold>
</xref>; <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Video 2</bold>
</xref>), around non-fluorescent round organelles. The MSSR plugin in Fiji (<xref ref-type="bibr" rid="B68">Torres-Garc&#xed;a et&#xa0;al., 2022</xref>) was used to enhance the resolution of the confocal images, confirming a partial co-localization between CSE-8 and CSE-7 (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5C, D</bold>
</xref>). In addition, microscopy revealed that some GFP and mCherry vesicle clusters moved independently in both retrograde and anterograde directions (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5B</bold>
</xref>). In the kymographs corresponding to the subapical region of the hyphae, it can be seen in more detail that both CSE-8-GFP and CSE-7-mCherry have independent trajectories mainly in the anterograde direction, although retrograde displacements are also observed (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5E</bold>
</xref>). These results reveal that CSE-8 and CSE-7, are transported in different vesicle sub-populations. To determine whether the organelles observed near CSE-7 and CSE-8 were nuclei (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5B</bold>
</xref>), the nucleic acid dye Hoechst 22358 was used (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5F</bold>
</xref>). MSSR revealed clusters of GFP and clusters of mCherry around the nuclei, with some clusters partially overlapping (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5G</bold>
</xref>). Remarkably, non-fluorescent organelles surrounded by CSE-7-mCherry and CSE-8-GFP are still observed in the hypha, suggesting that there could be compartments, other than nuclei, related to both proteins.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Spinning disk confocal microscopy revealed the movement of CSE-7-mCherry and CSE-8-GFP in different vesicles. <bold>(A)</bold> Subapical hyphal region (20 &#x3bc;m from the tip) of an <italic>N. crassa</italic> heterokaryon strain co-expressing CSE-7-mCherry and CSE-8-GFP. White points indicate areas of overlap between the two channels. <bold>(B)</bold> Tracking of anterograde and retrograde movement of CSE-7-mCherry and CSE-8-GFP clusters in the subapical region of the hyphae. Color lines show the trajectories of particular vesicle clusters. Green and red trajectories indicate anterograde movements. Blue and cyan indicate retrograde trajectories followed by anterograde movements. Points at the end of the lines indicate the final position of the clusters for each frame. <bold>(C)</bold> The selected ROI with CSE-8-GFP and CSE-7-mCherry around unidentified organelles shows partial overlapping signals for both CSE proteins. The ROI was analyzed using the zero-order equation of the MSSR algorithm (analyzed using zero-order equation). <bold>(D)</bold> Co-localization analysis of the merged image shown in <bold>(C)</bold>. <bold>(E)</bold> Kymographs of CSE-7-mCherry and CSE-8-GFP; scale bars correspond to 10 &#x3bc;m (x axis) and 10 s (y axis). <bold>(F)</bold> LSCM imaging of the heterokaryon strain shown in panels A and B with stained nuclei (cyan). Yellow arrows point to overlap of the CSE-8-GFP and CSE-7-mCherry signals around the nuclei. <bold>(G)</bold> ROI selected in the merge channel of panel F, analyzed using the MSSR plugin in Fiji; a third-order equation was selected for analysis. Scale bars: <bold>(A, B, D&#x2013;F)</bold> = 10 &#x3bc;m, <bold>(C&#x2013;G)</bold> = 2 &#x3bc;m.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="ffunb-05-1505388-g005.tif"/>
</fig>
</sec>
<sec id="s3_6">
<label>3.6</label>
<title>Lack of CSE-8 prevents CHS-3-GFP from reaching the SPK and septa</title>
<p>Genetic crosses were performed between a strain expressing CHS-3-GFP (NSSG6) (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6A</bold>
</xref>) and a <italic>&#x394;cse-8</italic> knockout strain to investigate potential interactions between CSE-8 and CHS in <italic>N. crassa</italic>. Homokaryotic strains recovered from the resulting ascospores were analyzed by LSCM to confirm the presence of fluorescence, followed by validation through PCR using primers flanking the CHS-3-GFP and <italic>cse-8</italic> gene constructs (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;1</bold>
</xref>). In homokaryotic <italic>&#x394;cse-8</italic> strains expressing CHS-3-GFP, fluorescence appeared in subapical clusters, with an absence of signal at the SPK and septa (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6B, C</bold>
</xref>). A previous study including FRAP analysis of CHS-3-GFP and CHS-6-GFP revealed that photobleaching near the hyphal tip caused only transient disruption in CHS localization at the SPK (<xref ref-type="bibr" rid="B55">Riquelme et al., 2007</xref>). Furthermore, the localization of CSE-8-GFP within the lumen of globular vacuoles is consistent with earlier findings for CHS-3-GFP (<xref ref-type="bibr" rid="B55">Riquelme et&#xa0;al., 2007</xref>). These results support the hypothesis of intracellular transport of CSE-8 in association with CHS-3. Additionally, <italic>&#x394;cse-7</italic> and <italic>&#x394;cse-8</italic> strains expressing CHS-1-GFP or CHS-5-GFP were obtained (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;2</bold>
</xref>). Since no disruption in CHS transport to polarized growth sites was observed for CHS-1 (class III) or CHS-5 (class V), which are unique to filamentous fungi, it is suggested that these CHS may employ alternative transport routes, bypassing ER-to-Golgi COPII vesicles, as proposed in previous studies (<xref ref-type="bibr" rid="B55">Riquelme et&#xa0;al., 2007</xref>; <xref ref-type="bibr" rid="B58">S&#xe1;nchez-Le&#xf3;n et&#xa0;al., 2011</xref>; <xref ref-type="bibr" rid="B52">Rico-Ram&#xed;rez et&#xa0;al., 2018</xref>). Thus, while CSE proteins may still function as chaperones assisting with CHS folding at the ER, they do not appear to be essential for CHS transport to apical regions in filamentous fungi, suggesting the evolution of alternative transport mechanisms.</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Lack of <italic>cse-8</italic> prevents CHS-3-GFP from reaching sites of cell wall biosynthesis. <bold>(A)</bold> Laser scanning confocal microscopy of the <italic>N. crassa</italic> strain with exogenous labeling of CHS-3-GFP shows CHS-3-GFP clearly visible in the SPK and in FM4-64-stained septa. <bold>(B)</bold> In the <italic>&#x394;cse-8</italic> strain expressing CHS-3-GFP, hyphal staining with FM4-64 reveals the absence of CHS-3 in the SPK core at 99 seconds, where the outer layer is still visible via FM4-64 staining. <bold>(C)</bold> Time series showing disrupted CHS-3-GFP transport in the <italic>&#x394;cse-8</italic> strain, using FM4-64 as a marker for SPK and septum formation. The time-lapse of septum formation in the <italic>&#x394;cse-8</italic> knockout strain expressing CHS-3-GFP shows that the fluorescence of FM4-64 in the forming septum does not overlap with the surrounding CHS-3-GFP vesicle clusters. Scale bars = 10 &#x3bc;m.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="ffunb-05-1505388-g006.tif"/>
</fig>
<p>To explore the possible interaction mechanism between CHS-3 and CSE-8, AlphaFold 3 and the HDOCK server were used to predict potential interaction sites. The model with the lowest average distance values between the atoms was selected and compared to the docking results obtained from AlphaFold 3, which yielded a pTM score of 0.68. A CHS-3 dimer obtained from SwissProt was used for the interaction models with CSE-8 to better predict their real interaction (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;3A</bold>
</xref>). This model of the <italic>N. crassa</italic> CHS-3 dimer is supported by crystallographic data on CHS structures from <italic>S. cerevisiae</italic> and <italic>C. albicans</italic> (<xref ref-type="bibr" rid="B15">Chen et&#xa0;al., 2022</xref>; <xref ref-type="bibr" rid="B51">Ren et&#xa0;al., 2022</xref>; <xref ref-type="bibr" rid="B14">Chen et al., 2023</xref>) and is consistent with the structure of Chs1 (class I) from the oomycete <italic>Phytophthora sojae</italic> and Chs2 (class I) from <italic>Candida albicans</italic> (<xref ref-type="bibr" rid="B15">Chen et&#xa0;al., 2022</xref>; <xref ref-type="bibr" rid="B51">Ren et&#xa0;al., 2022</xref>). In order to obtain more accurate results, the models displayed in <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;4</bold>
</xref> were used as controls.</p>
<p>According to the interaction model, the 5th, 6th, and 7th transmembrane domains of CSE-8 interact with transmembrane regions 1, 2, 6, and 7 of one CHS-3 unit (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figures&#xa0;3B, C</bold>
</xref>). The most stable <italic>in silico</italic> interaction was predicted between the beta-sheet LPLC domain of CSE-8 and the charged amino acids glutamate, aspartate, and arginine located at the C-terminal end of CHS-3 (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figures&#xa0;3C, D</bold>
</xref>). Additionally, potential interactions between a pair of hydrophobic amino acids in the second unit of the CHS-3 dimer were suggested (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;3D</bold>
</xref>). This interaction model aligns with experimental results on the Shr3 chaperone, whose transmembrane domains protect charged amino acids on the N-terminal end of the amino acid permease Gap1 (<xref ref-type="bibr" rid="B34">Kota et&#xa0;al., 2007</xref>). Interestingly, the <italic>in silico</italic> interaction between the &#x3b2;-folded structures of CSE-8 and the transmembrane domains of CHS-3 mirrors behaviors observed in other chaperones. These proteins use their &#x3b2;-sheet structures to facilitate protein folding, prevent accumulation, and contribute to protein oligomerization (<xref ref-type="bibr" rid="B67">Sun and MacRae, 2005</xref>; <xref ref-type="bibr" rid="B31">Karamanos et&#xa0;al., 2020</xref>).</p>
</sec>
<sec id="s3_7">
<label>3.7</label>
<title>CSE-8 and CHS-3 transport under ER stress conditions</title>
<p>To further investigate the role of CSE-8 in CHS-3 transport, we examined their subcellular transport under conditions of ER stress induced by DTT and TM (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7</bold>
</xref>). The minimum inhibitory concentrations for observing the effects of these stressors on protein transport were determined to be 1.25 mM for DTT and 4.25 &#x3bc;m/mL for TM. As a positive control for ER stress, the <italic>N. crassa</italic> heterokaryon strain expressing CSE-8-GFP and RFP-BiP was grown (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figures&#xa0;5A, B</bold>
</xref>). TM produced a similar effect to DTT on RFP-BiP distribution (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figures&#xa0;5E, F</bold>
</xref>). In subapical regions near the tip, globular clusters of both proteins were observed, indicating that CSE-8-GFP is retained in the ER under stress conditions (<xref ref-type="fig" rid="f7">
<bold>Figures&#xa0;7A, B</bold>
</xref>). RFP-BiP, an established ER stress reporter, accumulated in subapical globular bodies in hyphae treated with DTT or TM, consistent with Kar2-sfGFP localization in stressed yeast cells (<xref ref-type="bibr" rid="B35">Lajoie et&#xa0;al., 2012</xref>). DTT also produced similar effects in hyphae expressing CSE-7-GFP or CHS-4-GFP, supporting the notion that CSE proteins play a comparable role in vesicular trafficking from the ER (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;6</bold>
</xref>). Likewise, CHS-3-GFP accumulated in subapical regions under DTT or TM stress, with complete SPK disruption observed at the hyphal tip. CHS-3-GFP appeared as an apical vesicle crescent and in smaller clusters than those presented by CSE-8-GFP (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7B</bold>
</xref>).</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>ER stress induced by DTT and TM stressors affects the growth and cell polarity of <italic>N. crassa</italic>. <bold>(A)</bold> Micrographs of the CSE-8-GFP tagged strain exposed to ER stress treatments with DTT (1.25 mM) and TM (4.25 &#x3bc;g/mL). Yellow arrows point to CSE-8-GFP in subapical tubular endomembranes before ER stress treatments, while blue arrows point to the accumulation of CSE-8-GFP in larger globular bodies after treatments. <bold>(B)</bold> Micrographs of the strain expressing CHS-3-GFP before and after ER stress treatment. Blue arrows indicate the accumulation of CHS-3-GFP along the hyphae. <bold>(C)</bold> DIC micrographs of hyphae treated with DTT and TM showing the presence of septa near apical regions and hyperbranched hyphae. <bold>(D, E)</bold> Quantification of branches and septa within the first 100 &#x3bc;m of principal hyphae treated with DTT and TM (n=15 for each treatment); NT, non-treated hypha). Due to the absence of septa in the first 100 &#x3bc;m from the tip in hyphae of the WT strain, no values are shown in graph E for NT hyphae. (****) indicate significant differences for quantified hyphal branching with and without treatment (p-value of 0.0001). PC, Pearson&#x2019;s coefficient; scale bars = <bold>(A, B)</bold> 5 &#x3bc;m; <bold>(C)</bold> = 10 &#x3bc;m.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="ffunb-05-1505388-g007.tif"/>
</fig>
<p>Despite DTT exposure, CSE-8-GFP and CHS-3-GFP still reached the hyphal tip, forming a disorganized structure like an apical crescent at the apex. FM4-64 staining revealed complete disruption of the SPK, including its outer layer, which surrounds the core visualized by CSE-8-GFP in non-treated cells (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figures&#xa0;5C, D</bold>
</xref>). TM did not severely disrupt the SPK, likely due to its primary effect on the folding of glycosylated proteins. It is noteworthy that, under ER stress, CSE-8-GFP predominantly appeared in globular structures resembling globular vacuoles along the hyphae. These globular vacuoles were more pronounced in the CSE-8-GFP strain than in the CHS-3-GFP strain. In contrast, CHS-3-GFP was observed in smaller clusters near the tip. These findings suggest two key conclusions: first, CSE-8&#x2019;s presence in the NEC could indicate its localization within the ER of this network. Second, the significant accumulation of CSE-8-GFP in globular vacuoles along the hyphae may result from the activation of the unfolded protein response degradation or other autophagic pathways. Further studies are required to determine the exact pathways CSE-8 and CHS-3 follow under stress ER conditions. However, these experiments confirm that CSE-8 is an ER protein based on its subcellular distribution in response to stress.</p>
<p>Severe loss of polarity, hyperbranching, and excessive septa formation in DTT- and TM-treated hyphae underscore the importance of ER integrity for polarized growth (<xref ref-type="fig" rid="f7">
<bold>Figures&#xa0;7C, E</bold>
</xref>). CSE-8 and CHS-3 transport appear essential for maintaining this growth, likely activated in response to ER stress to sustain essential cellular processes like chitin synthesis. The constant supply of <italic>S. cerevisiae CHS7</italic> under ER stress was identified among genes up-regulated under UPR cell conditions induced by TM and DTT (<xref ref-type="bibr" rid="B69">Travers et&#xa0;al., 2000</xref>; <xref ref-type="bibr" rid="B72">Weichet et al., 2020</xref>). In the same study, genes corresponding to exomer subunits Chs5 and Chs6 were also up-regulated in response to ER stress. These findings suggest a possible activation of <italic>cse</italic> genes and other selected genes in response to ER stress to support key developmental processes, including chitin synthesis. Further studies on the response of <italic>cse-8</italic> and <italic>cse-7</italic> genes under ER stress conditions may help explain the role of CSE proteins in CHS-3 and CHS-4 transport from the ER.</p>
</sec>
<sec id="s3_8">
<label>3.8</label>
<title>CSE-8 RE sorting occurs into COPII vesicles</title>
<p>The next step in elucidating the vesicular trafficking pathway of CHS-3, using CSE-8 as a chaperone, was to investigate whether CHS-3 could exit the ER and enter COPII vesicles. Brefeldin A (BFA) inhibits COPII vesicle formation and, consequently, the ER-to-Golgi vesicular transport pathway, leading to the disruption of Golgi cisternae and accumulation of coatomer subunits in ER transition membranes, forming BFA bodies (<xref ref-type="bibr" rid="B45">Orci et&#xa0;al., 1993</xref>).</p>
<p>A strain expressing the YPT-1-RFP construct was used as a control and grown in VMM medium poisoned with BFA to ensure Golgi disruption. In this strain, YPT-1-RFP localized to the SPK and accumulated in globular bodies within the subapical region (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8</bold>
</xref>), a hallmark of Golgi membrane disruption. Similarly, CSE-8 accumulated in BFA-induced bodies along the hypha, with prominent accumulations into BFA bodies in the 1<sup>st</sup> and 2<sup>nd</sup> regions (<xref ref-type="fig" rid="f8">
<bold>Figures&#xa0;8A, C, D</bold>
</xref>). CHS-3-GFP clusters were also observed near the tip (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8B</bold>
</xref>). BFA treatment led to an increase in fluorescence intensity across all regions, confirming the disruption of CSE-8-GFP, YPT-1-RFP, and CHS-3-GFP transport (<xref ref-type="fig" rid="f8">
<bold>Figures&#xa0;8E-G</bold>
</xref>). These results indicate that CSE-8 is transported to the Golgi in COPII vesicles, following the canonical transport route to the hyphal tip. This is consistent with previous observations for Chs3, where the cargo receptor Erv14 is required for its exit from the ER in COPII vesicles (<xref ref-type="bibr" rid="B56">Sacristan et&#xa0;al., 2013</xref>).</p>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>Brefeldin A disrupts the subcellular transport of CSE-8-GFP and CHS-3-GFP to the SPK. <bold>(A)</bold> Hypha co-expressing YPT-1-RFP and CSE-8-GFP without treatment (left) and exposed to BFA at 200 &#x3bc;g/mL (right). In the BFA-treated hyphae, CSE-8-GFP fails to reach the SPK and accumulates at the beginning of region II in putative BFA bodies labeled with YPT-1-RFP. Blue arrows indicate the accumulation of CSE-8-GFP in BFA bodies marked by YPT-1-RFP, while tallow arrows point the accumulation by itself. <bold>(B)</bold> Disruption of subcellular transport of CHS-3-GFP in hyphae treated with BFA. Blue arrows point the accumulation of CHS-3-GFP in regions near the tip. <bold>(C, D)</bold> Plots of the co-localization analysis shown in <bold>A</bold> (<bold>C (-)</bold> BFA; <bold>D</bold> (+) BFA). Pearsons&#x2019; coefficient is greater in BFA-treated samples, indicating that a subpopulation of CSE-8-GFP accumulates with YPT-1-RFP in putative BFA-bodies. <bold>(E&#x2013;G)</bold> Fluorescence intensity plots for the first 60 &#x3bc;m of hyphae shown in <bold>(A, B)</bold>. Scale bars = 10 &#x3bc;m.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="ffunb-05-1505388-g008.tif"/>
</fig>
</sec>
<sec id="s3_9">
<label>3.9</label>
<title>The phenotypes of the <italic>&#x394;cse-8</italic> and <italic>&#x394;cse-7 &#x394;cse-8</italic> strains confirm their role in chitin synthesis</title>
<p>To investigate the function of CSE proteins, we characterized corresponding mutants to identify any distinct phenotypic differences. No significant differences in colonial growth were observed in the <italic>&#x394;cse-8</italic> and <italic>&#x394;cse-7</italic> single mutants (<xref ref-type="fig" rid="f9">
<bold>Figures&#xa0;9A, B</bold>
</xref>). However, the <italic>&#x394;cse-8; &#x394;cse-7</italic> double mutant exhibited a slower growth rate than the single mutants and the WT strain (<xref ref-type="fig" rid="f9">
<bold>Figures&#xa0;9A, B</bold>
</xref>). Growth of the <italic>&#x394;cse-8</italic> and <italic>&#x394;cse-7</italic> mutants was significantly impaired under osmotic stress conditions induced by high concentrations of NaCl and KCl (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9B</bold>
</xref>). Furthermore, both the double mutant and <italic>&#x394;cse-7</italic> were more sensitive to Congo red (CR)-induced stress than the WT. CR is a molecule known for its antifungal activity, as it can inhibit chitin synthesis and form complexes with chitin and glucans present in the cell wall (<xref ref-type="bibr" rid="B4">Bartnicki-Garcia et&#xa0;al., 1994</xref>; <xref ref-type="bibr" rid="B50">Ram and Klis, 2006</xref>). Taken together, these results indicate that the absence of <italic>cse-7</italic> and <italic>cse-8</italic> renders <italic>N. crassa</italic> hyphae more sensitive to osmotic stress-induced changes in turgor pressure, as well as to antifungal agents targeting cell wall and chitin synthesis, directly linking both genes to the mechanisms of chitin synthesis in cell wall. The average number of branches at a selected distance from the tip of the main hyphae was lower in the mutants tested (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9C</bold>
</xref>). However, statistical analyses did not reveal any significant difference in this morphological characteristic. Levels of the chitin monomer GlcNAc were consistent across all three mutants, each showing approximately 50% less GlcNAc than the WT strain (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9D</bold>
</xref>). Notably, knockout mutants <italic>&#x394;chs-5</italic>, <italic>&#x394;chs-6</italic>, <italic>&#x394;chs-7</italic>, and RIP mutant <italic>chs-1</italic> &#x2014; mutants in <italic>chs</italic> specific to filamentous fungi &#x2014; display a severely affected radial growth phenotype (<xref ref-type="bibr" rid="B74">Yarden and Yanofsky, 1991</xref>; <xref ref-type="bibr" rid="B18">Fajardo-Somera et&#xa0;al., 2015</xref>). These findings suggest that, at least in <italic>N. crassa</italic>, CSE proteins are unlikely to be directly involved in the transport of CHSs unique to filamentous fungi. However, the possibility that CSE interacts with these specific CHS cannot be entirely excluded, as the significant reduction in GlcNAc levels observed in <italic>&#x394;chs-1</italic>, <italic>&#x394;chs-6</italic>, and <italic>&#x394;chs-7</italic> knockout strains (<xref ref-type="bibr" rid="B18">Fajardo-Somera et&#xa0;al., 2015</xref>) is similar to the results seen here for the single and double knockout mutants for CSE proteins. Further experiments are needed to investigate the potential relationship between CSE and other CHSs.</p>
<fig id="f9" position="float">
<label>Figure&#xa0;9</label>
<caption>
<p>Phenotypic characterization of <italic>N. crassa &#x394;cse-7</italic>, <italic>&#x394;cse-8</italic>, and <italic>&#x394;cse-8; &#x394;cse-7</italic> strains. <bold>(A)</bold> Colony growth and hyphal morphology of the three strains compared to the WT strain (Scale bar = 250 &#x3bc;m). <bold>(B)</bold> Quantification of radial growth (n = 30) of all the strains exposed to osmotic (NaCl 0.8 mM; KCl 0.8 mM) and cell wall (Congo Red 100 mg/mL) stress conditions. <bold>(C, D)</bold> Graphs showing differences in branching (n = 10) and N-acetylglucosamine content (n = 4) of the analyzed strains. Asterisks indicate significant differences between strains, with p-values of 0.001 (**), 0.005 (***) and 0.0001 (****). <bold>(E)</bold> Perithecia from homozygous <italic>&#x394;cse-8</italic> crosses after 15 days (top) and 30 days (bottom) of growth in SCM. Blue arrows denote perithecia, displaying the &#x201c;shaka&#x201d; phenotype (two ostioles). Perithecia with unique ostiole is shown in the bottom square. <bold>(F)</bold> Quantification of &#x201c;shaka&#x201d; perithecia produced <italic>&#x394;cse-8</italic> sexual crosses (n= 100). <italic>&#x394;cse-8</italic> x CHS-1 corresponds to perithecia obtained by crossing between <italic>&#x394;cse-8</italic> knockout and FGSC #13408 strains (Scale bars= 200 &#x3bc;m).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="ffunb-05-1505388-g009.tif"/>
</fig>
<p>The absence of <italic>cse-8</italic> also appeared to affect sexual reproduction in <italic>N. crassa</italic>, resulting in perithecia with two beaks (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9E</bold>
</xref>). We termed this phenotype &#x201c;<italic>shaka</italic>&#x201d; due to its resemblance to the hand gesture used by surfers in Hawaii. Around 20% of the perithecia produced in homozygous and heterozygous sexual crosses exhibited the shaka phenotype (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9F</bold>
</xref>), although this did not affect the production of viable ascospores. Despite there being no previous research on this shaka phenotype, <italic>chs-3</italic> is essential for the production of mature perithecia (<xref ref-type="bibr" rid="B18">Fajardo-Somera et&#xa0;al., 2015</xref>), suggesting that the absence of <italic>cse-8</italic> could affect sexual development in <italic>N. crassa</italic>. The developmental timing of mature perithecia does not differ from that of WT fruiting bodies (<xref ref-type="bibr" rid="B38">Lehr et&#xa0;al., 2014</xref>). Although <italic>cse-8</italic> expression varies during perithecium development (<xref ref-type="bibr" rid="B38">Lehr et&#xa0;al., 2014</xref>), it does not appear to be essential, as functional beaks and viable ascospores are still formed in <italic>&#x394;cse-8</italic> mutants. Therefore, <italic>cse-8</italic> provides an interesting model for studying ostiole biogenesis in ascomycete fungi.</p>
</sec>
</sec>
<sec id="s4" sec-type="conclusions">
<label>4</label>
<title>Conclusions</title>
<p>Our findings demonstrate that CSE proteins play a role in cell wall development and chitin synthesis in <italic>N. crassa</italic>. Also, we could confirm the conserved function of CSE-8 in the ER, and its role in the <italic>de novo</italic> synthesis, and in the transport of CHS-3 to the SPK. This research highlights the need of further investigation to elucidate the transport mechanisms of other CHS, particularly those exclusive to filamentous fungi (CHS classes 3, 5, 6, and 7). The current evidence suggests that the biogenesis of the CHS exclusive to filamentous fungi may involve pathways independent of CSE-mediated receptors.</p>
</sec>
</body>
<back>
<sec id="s5" sec-type="data-availability">
<title>Data availability statement</title>
<p>The original contributions presented in the study are included in the article/<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Material</bold>
</xref>. Further inquiries can be directed to the corresponding author.</p>
</sec>
<sec id="s6" sec-type="author-contributions">
<title>Author contributions</title>
<p>SG-T: Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Writing &#x2013; original draft, Writing &#x2013; review &amp; editing. MR: Conceptualization, Formal analysis, Funding acquisition, Project administration, Supervision, Writing &#x2013; review &amp; editing, Methodology.</p>
</sec>
<sec id="s7" sec-type="funding-information">
<title>Funding</title>
<p>The author(s) declare financial support was received for the research, authorship, and/or publication of this article. We would like to express our gratitude to the Consejo Nacional de Humanidades, Ciencia y Tecnolog&#xed;a (CONAHCYT), Mexico, for financial support provided through grant CF 2019/2041 and FONCICYT/17/2018 277869 to the MR lab. We also acknowledge the grant awarded to SVG-T for the doctoral fellowship.</p>
</sec>
<ack>
<title>Acknowledgments</title>
<p>Thanks to the Laboratorio Nacional de Microscop&#xed;a Avanzada (LNMA-CICESE) for their technical support. We are grateful to AG Mart&#xed;nez-Rangel for his valuable suggestions in the molecular docking analysis, JM Mart&#xed;nez-Andrade for assistance with the DTT experiments, and E Sep&#xfa;lveda for supplying DTT for the ER stress experiments.</p>
</ack>
<sec id="s8" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s9" sec-type="ai-statement">
<title>Generative AI statement</title>
<p>The author(s) declare that Generative AI was used in the creation of this manuscript. Chat GPT was used to edit some sentences.</p>
</sec>
<sec id="s10" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s11" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/ffunb.2024.1505388/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/ffunb.2024.1505388/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="DataSheet1.docx" id="SM1" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document"/>
<supplementary-material xlink:href="Image1.tif" id="SF1" mimetype="image/tiff"/>
<supplementary-material xlink:href="Image2.tif" id="SF2" mimetype="image/tiff"/>
<supplementary-material xlink:href="Image3.tiff" id="SF3" mimetype="image/tiff"/>
<supplementary-material xlink:href="Image4.tiff" id="SF4" mimetype="image/tiff"/>
<supplementary-material xlink:href="Image5.tif" id="SF5" mimetype="image/tiff"/>
<supplementary-material xlink:href="Image6.tif" id="SF6" mimetype="image/tiff"/>
<supplementary-material xlink:href="Video1.mov" id="SM2" mimetype="video/quicktime"/>
<supplementary-material xlink:href="Video2.mov" id="SM3" mimetype="video/quicktime"/>
</sec>
<fn-group>
<title>Abbreviations</title>
<fn fn-type="abbr" id="abbrev1">
<p>CHS, chitin synthases; CSE, chitin synthase export protein; ER, endoplasmic reticulum; GFP, green fluorescent protein; PM, plasma membrane; SPK, Spitzenk&#xf6;rper; LSCM, Laser scanning confocal microscopy; SDCM, spinning disc confocal microscopy; MSSR, mean shift super-resolution; GlcNAc, N-acetylglucosamine; NEC, network of endomembrane cisternae; FRAP, fluorescence recovery after photobleaching; FLIP, fluorescence loss in photobleaching.</p>
</fn>
</fn-group>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bartnicki-Garcia</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>1987</year>). <article-title>Chitosomes and chitin biogenesis</article-title>. <source>Food Hydrocolloids</source> <volume>1</volume>, <fpage>353</fpage>&#x2013;<lpage>358</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S0268-005X(87)80025-5</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bartnicki-Garcia</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Chitosomes: past, present and future</article-title>. <source>FEMS Yeast Res.</source> <volume>6</volume>, <fpage>957</fpage>&#x2013;<lpage>965</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1567-1364.2006.00158.x</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bartnicki-Garcia</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Bracker</surname> <given-names>C. E.</given-names>
</name>
<name>
<surname>Reyes</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Ruiz-Herrera</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>1978</year>). <article-title>Isolation of chitosomes from taxonomically diverse fungi and synthesis of chitin microfibrils <italic>in vitro</italic>
</article-title>. <source>Exp. Mycology</source> <volume>2</volume>, <fpage>173</fpage>&#x2013;<lpage>192</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S0147-5975(78)80031-0</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bartnicki-Garcia</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Persson</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Chanzy</surname> <given-names>H.</given-names>
</name>
</person-group> (<year>1994</year>). <article-title>An electron microscope and electron diffraction study of the effect of calcofluor and congo red on the biosynthesis of chitin <italic>in vitro</italic>
</article-title>. <source>Arch. Biochem. Biophysics</source> <volume>310</volume>, <fpage>6</fpage>&#x2013;<lpage>15</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1006/abbi.1994.1133</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bolte</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Cordeli&#xe8;res</surname> <given-names>F. P.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>A guided tour into subcellular colocalization analysis in light microscopy</article-title>. <source>J. Microscopy</source> <volume>224</volume>, <fpage>213</fpage>&#x2013;<lpage>232</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1365-2818.2006.01706.x</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Borkovich</surname> <given-names>K. A.</given-names>
</name>
<name>
<surname>Alex</surname> <given-names>L. A.</given-names>
</name>
<name>
<surname>Yarden</surname> <given-names>O.</given-names>
</name>
<name>
<surname>Freitag</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Turner</surname> <given-names>G. E.</given-names>
</name>
<name>
<surname>Read</surname> <given-names>N. D.</given-names>
</name>
<etal/>
</person-group>. (<year>2004</year>). <article-title>Lessons from the genome sequence of <italic>neurospora crassa</italic> : tracing the path from genomic blueprint to multicellular organism</article-title>. <source>Microbiol. Mol. Biol. Rev.</source> <volume>68</volume>, <fpage>1</fpage>&#x2013;<lpage>108</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/MMBR.68.1.1-108.2004</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bowman</surname> <given-names>B. J.</given-names>
</name>
<name>
<surname>Abreu</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Margolles-Clark</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Draskovic</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Bowman</surname> <given-names>E. J.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Role of four calcium transport proteins, encoded by <italic>nca-1</italic> , <italic>nca-2</italic> , <italic>nca-3</italic> , and <italic>cax</italic> , in maintaining intracellular calcium levels in <italic>neurospora crassa</italic>
</article-title>. <source>Eukaryotic Cell</source> <volume>10</volume>, <fpage>654</fpage>&#x2013;<lpage>661</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/EC.00239-10</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bowman</surname> <given-names>B. J.</given-names>
</name>
<name>
<surname>Draskovic</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Freitag</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Bowman</surname> <given-names>E. J.</given-names>
</name>
</person-group> (<year>2009</year>). <article-title>Structure and distribution of organelles and cellular location of calcium transporters in <italic>Neurospora crassa</italic>
</article-title>. <source>Eukaryotic Cell</source> <volume>8</volume>, <fpage>1845</fpage>&#x2013;<lpage>1855</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/EC.00174-09</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bowman</surname> <given-names>S. M.</given-names>
</name>
<name>
<surname>Free</surname> <given-names>S. J.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>The structure and synthesis of the fungal cell wall</article-title>. <source>BioEssays</source> <volume>28</volume>, <fpage>799</fpage>&#x2013;<lpage>808</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/bies.20441</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bulik</surname> <given-names>D. A.</given-names>
</name>
<name>
<surname>Olczak</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Lucero</surname> <given-names>H. A.</given-names>
</name>
<name>
<surname>Osmond</surname> <given-names>B. C.</given-names>
</name>
<name>
<surname>Robbins</surname> <given-names>P. W.</given-names>
</name>
<name>
<surname>Specht</surname> <given-names>C. A.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Chitin synthesis in <italic>saccharomyces cerevisiae</italic> in response to supplementation of growth medium with glucosamine and cell wall stress</article-title>. <source>Eukaryotic Cell</source> <volume>2</volume>, <fpage>886</fpage>&#x2013;<lpage>900</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/EC.2.5.886-900.2003</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cabib</surname> <given-names>E.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>The septation apparatus, a chitin-requiring machine in budding yeast</article-title>. <source>Arch. Biochem. Biophysics</source> <volume>426</volume>, <fpage>201</fpage>&#x2013;<lpage>207</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.abb.2004.02.030</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cabib</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Schmidt</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Chitin synthase III activity, but not the chitin ring, is required for remedial septa formation in budding yeast</article-title>. <source>FEMS Microbiol. Lett.</source> <volume>224</volume>, <fpage>299</fpage>&#x2013;<lpage>305</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S0378-1097(03)00477-4</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cabrera-Ponce</surname> <given-names>J. L.</given-names>
</name>
<name>
<surname>Le&#xf3;n-Ram&#xed;rez</surname> <given-names>C. G.</given-names>
</name>
<name>
<surname>Verver-Vargas</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Palma-Tirado</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Ruiz-Herrera</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Metamorphosis of the basidiomycota ustilago maydis: transformation of yeast-like cells into basidiocarps</article-title>. <source>Fungal Genet. Biol.</source> <volume>49</volume>, <fpage>765</fpage>&#x2013;<lpage>715</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.fgb.2012.07.005</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>D.-D.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Z.-B.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>L.-X.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Yun</surname> <given-names>C.-H.</given-names>
</name>
<name>
<surname>Bai</surname> <given-names>L.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Structure, catalysis, chitin transport, and selective inhibition of chitin synthase</article-title>. <source>Nat. Commun.</source> <volume>14</volume>, <fpage>4776</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41467-023-40479-4</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Cao</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>L.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>Structural basis for directional chitin biosynthesis</article-title>. <source>Nature</source> <volume>610</volume>, <fpage>402</fpage>&#x2013;<lpage>408</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41586-022-05244-5</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Davis</surname> <given-names>R. H.</given-names>
</name>
</person-group> (<year>2000</year>). <source>Neurospora: contributions of a model organism</source>. <publisher-loc>Oxford New York</publisher-loc>: <publisher-name>Oxford University Press</publisher-name>.</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dharwada</surname> <given-names>S. T.</given-names>
</name>
<name>
<surname>Dalton</surname> <given-names>L. E.</given-names>
</name>
<name>
<surname>Bean</surname> <given-names>B. D. M.</given-names>
</name>
<name>
<surname>Padmanabhan</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Choi</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Schluter</surname> <given-names>C.</given-names>
</name>
<etal/>
</person-group>. (<year>2018</year>). <article-title>The chaperone chs7 forms a stable complex with chs3 and promotes its activity at the cell surface</article-title>. <source>Traffic</source> <volume>19</volume>, <fpage>285</fpage>&#x2013;<lpage>295</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/tra.12553</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fajardo-Somera</surname> <given-names>R. A.</given-names>
</name>
<name>
<surname>J&#xf6;hnk</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Bayram</surname> <given-names>&#xd6;</given-names>
</name>
<name>
<surname>Valerius</surname> <given-names>O.</given-names>
</name>
<name>
<surname>Braus</surname> <given-names>G. H.</given-names>
</name>
<name>
<surname>Riquelme</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Dissecting the function of the different chitin synthases in vegetative growth and sexual development in <italic>neurospora crassa</italic>
</article-title>. <source>Fungal Genet. Biol.</source> <volume>75</volume>, <fpage>30</fpage>&#x2013;<lpage>45</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.fgb.2015.01.002</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fischer-Parton</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Parton</surname> <given-names>R. M.</given-names>
</name>
<name>
<surname>Hickey</surname> <given-names>P. C.</given-names>
</name>
<name>
<surname>Dijksterhuis</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Atkinson</surname> <given-names>H. A.</given-names>
</name>
<name>
<surname>Read</surname> <given-names>N. D.</given-names>
</name>
</person-group> (<year>2000</year>). <article-title>Confocal microscopy of FM4-64 as a tool for analysing endocytosis and vesicle trafficking in living fungal hyphae</article-title>. <source>J. Microscopy</source> <volume>198</volume>, <fpage>246</fpage>&#x2013;<lpage>595</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1046/j.1365-2818.2000.00708.x</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gonz&#xe1;lez Montoro</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Chumpen Ramirez</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Quiroga</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Valdez Taubas</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Specificity of transmembrane protein palmitoylation in yeast</article-title>. <source>PloS One</source> <volume>6</volume>, <fpage>e16969</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pone.0016969</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gow</surname> <given-names>N. A. R.</given-names>
</name>
<name>
<surname>Latge</surname> <given-names>J.-P.</given-names>
</name>
<name>
<surname>Munro</surname> <given-names>C. A.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>The fungal cell wall: structure, biosynthesis, and function. Edited by joseph heitman</article-title>. <source>Microbiol. Spectr.</source> <volume>5</volume>, <fpage>5.3.01</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/microbiolspec.FUNK-0035-2016</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hendershot</surname> <given-names>L. M.</given-names>
</name>
<name>
<surname>Wei</surname> <given-names>J. Y.</given-names>
</name>
<name>
<surname>Gaut</surname> <given-names>J. R.</given-names>
</name>
<name>
<surname>Lawson</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Freiden</surname> <given-names>P. J.</given-names>
</name>
<name>
<surname>Murti</surname> <given-names>K. G.</given-names>
</name>
</person-group> (<year>1995</year>). <article-title>
<italic>In vivo</italic> expression of mammalian biP ATPase mutants causes disruption of the endoplasmic reticulum</article-title>. <source>Mol. Biol. Cell</source> <volume>6</volume>, <fpage>283</fpage>&#x2013;<lpage>296</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1091/mbc.6.3.283</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hern&#xe1;ndez-Gonz&#xe1;lez</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Bravo-Plaza</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Pinar</surname> <given-names>M.</given-names>
</name>
<name>
<surname>De Los R&#xed;os</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Arst</surname> <given-names>H. N.</given-names>
</name>
<name>
<surname>Pe&#xf1;alva</surname> <given-names>M. A.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Endocytic recycling via the TGN underlies the polarized hyphal mode of life</article-title>. <source>PloS Genet.</source> <volume>14</volume>, <fpage>e1007291</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pgen.1007291</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hickey</surname> <given-names>P. C.</given-names>
</name>
<name>
<surname>Jacobson</surname> <given-names>D. J.</given-names>
</name>
<name>
<surname>Read</surname> <given-names>N. D.</given-names>
</name>
<name>
<surname>Glass</surname> <given-names>N. L.</given-names>
</name>
</person-group> (<year>2002</year>). <article-title>Live-cell imaging of vegetative hyphal fusion in <italic>neurospora crassa</italic>
</article-title>. <source>Fungal Genet. Biol.</source> <volume>37</volume>, <fpage>109</fpage>&#x2013;<lpage>119</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S1087-1845(02)00035-X</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hickey</surname> <given-names>P. C.</given-names>
</name>
<name>
<surname>Swift</surname> <given-names>S. R.</given-names>
</name>
<name>
<surname>Roca</surname> <given-names>M. G.</given-names>
</name>
<name>
<surname>Read</surname> <given-names>N. D.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>Live-cell imaging of filamentous fungi using vital fluorescent dyes and confocal microscopy. In</article-title>. <source>Methods Microbiol.</source> <volume>34</volume>, <fpage>63</fpage>&#x2013;<lpage>87</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S0580-9517(04)34003-1</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Honda</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Selker</surname> <given-names>E. U.</given-names>
</name>
</person-group> (<year>2009</year>). <article-title>Tools for fungal proteomics: multifunctional neurospora vectors for gene replacement, protein expression and protein purification</article-title>. <source>Genetics</source> <volume>182</volume>, <fpage>11</fpage>&#x2013;<lpage>235</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1534/genetics.108.098707</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jin</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Iwama</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Takagi</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Horiuchi</surname> <given-names>H.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>AP-2 complex contributes to hyphal-tip-localization of a chitin synthase in the filamentous fungus aspergillus nidulans</article-title>. <source>Fungal Biol.</source> <volume>125</volume>, <fpage>806</fpage>&#x2013;<lpage>145</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.funbio.2021.05.009</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jumper</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Evans</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Pritzel</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Green</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Figurnov</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Ronneberger</surname> <given-names>O.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>Highly accurate protein structure prediction with alphaFold</article-title>. <source>Nature</source> <volume>596</volume>, <fpage>583</fpage>&#x2013;<lpage>589</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41586-021-03819-2</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kappel</surname> <given-names>L.</given-names>
</name>
<name>
<surname>M&#xfc;nsterk&#xf6;tter</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Sipos</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Escobar Rodriguez</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Gruber</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Chitin and chitosan remodeling defines vegetative development and <italic>trichoderma</italic> biocontrol. Edited by alex andrianopoulos</article-title>. <source>PloS Pathog.</source> <volume>16</volume>, <fpage>e1008320</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.ppat.1008320</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kar</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Patel</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Ao</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Free</surname> <given-names>S. J.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Neurospora crassa family GH72 glucanosyltransferases function to crosslink cell wall glycoprotein N-linked galactomannan to cell wall lichenin</article-title>. <source>Fungal Genet. Biol.</source> <volume>123</volume>, <fpage>60</fpage>&#x2013;<lpage>69</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.fgb.2018.11.007</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Karamanos</surname> <given-names>T. K.</given-names>
</name>
<name>
<surname>Tugarinov</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Clore</surname> <given-names>G.M.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>An S/T motif controls reversible oligomerization of the hsp40 chaperone DNAJB6b through subtle reorganization of a &#x3b2; Sheet backbone</article-title>. <source>Proc. Natl. Acad. Sci.</source> <volume>117</volume>, <fpage>30441</fpage>&#x2013;<lpage>30505</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1073/pnas.2020306117</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Knafler</surname> <given-names>H. C.</given-names>
</name>
<name>
<surname>Smaczynska-de Rooij</surname> <given-names>I. I.</given-names>
</name>
<name>
<surname>Walker</surname> <given-names>L. A.</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>K. K.</given-names>
</name>
<name>
<surname>Gow</surname> <given-names>N. A. R.</given-names>
</name>
<name>
<surname>Ayscough</surname> <given-names>K. R.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>AP-2-dependent endocytic recycling of the chitin synthase chs3 regulates polarized growth in <italic>candida albicans</italic>
</article-title>. <source>mBio</source> <volume>10</volume>, <fpage>e02421</fpage>&#x2013;<lpage>e02418</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/mBio.02421-18</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kota</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Ljungdahl</surname> <given-names>P. O.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>Specialized membrane-localized chaperones prevent aggregation of polytopic proteins in the ER</article-title>. <source>J. Cell Biol.</source> <volume>168</volume>, <fpage>79</fpage>&#x2013;<lpage>88</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1083/jcb.200408106</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kota</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Gilstring</surname> <given-names>C. F.</given-names>
</name>
<name>
<surname>Ljungdahl</surname> <given-names>P. O.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Membrane chaperone Shr3 assists in folding amino acid permeases preventing precocious ERAD</article-title>. <source>The Journal of Cell Biology</source> <volume>176</volume>, <fpage>617</fpage>&#x2013;<lpage>628</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1083/jcb.200612100</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lajoie</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Moir</surname> <given-names>R. D.</given-names>
</name>
<name>
<surname>Willis</surname> <given-names>I. M.</given-names>
</name>
<name>
<surname>Snapp</surname> <given-names>E. L.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Kar2p availability defines distinct forms of endoplasmic reticulum stress in living cells</article-title>. <source>Mol. Biol. Cell</source> <volume>23</volume>, <fpage>955</fpage>&#x2013;<lpage>964</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1091/mbc.e11-12-0995</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lam</surname> <given-names>K. K. Y.</given-names>
</name>
<name>
<surname>Davey</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Roth</surname> <given-names>A. F.</given-names>
</name>
<name>
<surname>Davis</surname> <given-names>N. G.</given-names>
</name>
<name>
<surname>Conibear</surname> <given-names>E.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Palmitoylation by the DHHC protein pfa4 regulates the ER exit of chs3</article-title>. <source>J. Cell Biol.</source> <volume>174</volume>, <fpage>19</fpage>&#x2013;<lpage>25</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1083/jcb.200602049</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lau</surname> <given-names>W.-T. W.</given-names>
</name>
<name>
<surname>Howson</surname> <given-names>R. W.</given-names>
</name>
<name>
<surname>Malkus</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Schekman</surname> <given-names>R.</given-names>
</name>
<name>
<surname>O&#x2019;Shea</surname> <given-names>E. K.</given-names>
</name>
</person-group> (<year>2000</year>). <article-title>Pho86p, an endoplasmic reticulum (ER) resident protein in <italic>saccharomyces cerevisiae</italic> , is required for ER exit of the high-affinity phosphate transporter pho84p</article-title>. <source>Proc. Natl. Acad. Sci.</source> <volume>97</volume>, <fpage>1107</fpage>&#x2013;<lpage>1112</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1073/pnas.97.3.1107</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lehr</surname> <given-names>N. A.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Hewitt</surname> <given-names>D. A.</given-names>
</name>
<name>
<surname>L&#xf3;pez-Gir&#xe1;ldez</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Trail</surname> <given-names>F.</given-names>
</name>
<etal/>
</person-group>. (<year>2014</year>). <article-title>Gene expression differences among three <italic>neurospora</italic> species reveal genes required for sexual reproduction in <italic>neurospora crassa</italic>
</article-title>. <source>PloS One</source> <volume>9</volume>, <fpage>e110398</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pone.0110398</pub-id>
</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Letunic</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Bork</surname> <given-names>P.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Interactive tree of life (iTOL) V6: recent updates to the phylogenetic tree display and annotation tool</article-title>. <source>Nucleic Acids Res.</source> <volume>52</volume>(<issue>W1</issue>):<page-range>W78&#x2013;W82</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/gkae268</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mart&#xed;nez-Andrade</surname> <given-names>J. M.</given-names>
</name>
<name>
<surname>Roberson</surname> <given-names>R. W.</given-names>
</name>
<name>
<surname>Riquelme</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>A bird&#x2019;s-eye view of the endoplasmic reticulum in filamentous fungi</article-title>. <source>Microbiol. Mol. Biol. Rev.</source> <volume>88</volume>, <fpage>e00027</fpage>&#x2013;<lpage>e00023</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/mmbr.00027-23</pub-id>
</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Monnerjahn</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Techel</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Meyer</surname> <given-names>U.</given-names>
</name>
<name>
<surname>Rensing</surname> <given-names>L.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>The grp78 promoter of neurospora crassa: constitutive, stress and differentiation-dependent protein-binding patterns</article-title>. <source>Curr. Genet.</source> <volume>39</volume>, <fpage>319</fpage>&#x2013;<lpage>326</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s002940100202</pub-id>
</citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Morgan</surname> <given-names>W. T. J.</given-names>
</name>
<name>
<surname>Elson</surname> <given-names>L. A.</given-names>
</name>
</person-group> (<year>1934</year>). <article-title>A colorimetric method for the determination of N-acetylglucosamine and N-acetylchrondrosamine</article-title>. <source>Biochem. J.</source> <volume>28</volume>, <fpage>988</fpage>&#x2013;<lpage>955</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1042/bj0280988</pub-id>
</citation>
</ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Munro</surname> <given-names>C. A.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Chitin and glucan, the yin and yang of the fungal cell wall, implications for antifungal drug discovery and therapy. In</article-title>. <source>Adv. Appl. Microbiol.</source> <volume>83</volume>, <fpage>145</fpage>&#x2013;<lpage>172</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/B978-0-12-407678-5.00004-0</pub-id>
</citation>
</ref>
<ref id="B44">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Munro</surname> <given-names>C. A.</given-names>
</name>
<name>
<surname>Winter</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Buchan</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Henry</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Becker</surname> <given-names>J. M.</given-names>
</name>
<name>
<surname>Brown</surname> <given-names>A. J. P.</given-names>
</name>
<etal/>
</person-group>. (<year>2001</year>). <article-title>Chs1 of <italic>candida albicans</italic> is an essential chitin synthase required for synthesis of the septum and for cell integrity</article-title>. <source>Mol. Microbiol.</source> <volume>39</volume>, <fpage>1414</fpage>&#x2013;<lpage>1426</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1046/j.1365-2958.2001.02347.x</pub-id>
</citation>
</ref>
<ref id="B45">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Orci</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Perrelet</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Ravazzola</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Wieland</surname> <given-names>F. T.</given-names>
</name>
<name>
<surname>Schekman</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Rothman</surname> <given-names>J. E.</given-names>
</name>
</person-group> (<year>1993</year>). <article-title>BFA bodies: A subcompartment of the endoplasmic reticulum</article-title>. <source>Proc. Natl. Acad. Sci. United States America</source> <volume>90</volume>, <fpage>11089</fpage>&#x2013;<lpage>11093</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1073/pnas.90.23.11089</pub-id>
</citation>
</ref>
<ref id="B46">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Orlean</surname> <given-names>P.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Architecture and biosynthesis of the <italic>saccharomyces cerevisiae</italic> cell wall</article-title>. <source>Genetics</source> <volume>192</volume>, <fpage>775</fpage>&#x2013;<lpage>818</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1534/genetics.112.144485</pub-id>
</citation>
</ref>
<ref id="B47">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pacheco-Arjona</surname> <given-names>J. R.</given-names>
</name>
<name>
<surname>Ramirez-Prado</surname> <given-names>J. H.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Large-scale phylogenetic classification of fungal chitin synthases and identification of a putative cell-wall metabolism gene cluster in <italic>aspergillus</italic> genomes</article-title>. <source>PloS One</source> <volume>9</volume>, <fpage>e104920</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pone.0104920</pub-id>
</citation>
</ref>
<ref id="B48">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pammer</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Briza</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Ellinger</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Schuster</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Stucka</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Feldmann</surname> <given-names>H.</given-names>
</name>
<etal/>
</person-group>. (<year>1992</year>). <article-title>
<italic>DIT101 (CSD2, CAL1)</italic> , a cell cycle-regulated yeast gene required for synthesis of chitin in cell walls and chitosan in spore walls</article-title>. <source>Yeast</source> <volume>8</volume>, <fpage>1089</fpage>&#x2013;<lpage>1099</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/yea.320081211</pub-id>
</citation>
</ref>
<ref id="B49">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Preechasuth</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Anderson</surname> <given-names>J. C.</given-names>
</name>
<name>
<surname>Peck</surname> <given-names>S. C.</given-names>
</name>
<name>
<surname>Brown</surname> <given-names>A. J. P.</given-names>
</name>
<name>
<surname>Gow</surname> <given-names>N. A. R.</given-names>
</name>
<name>
<surname>Lenardon</surname> <given-names>M. D.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Cell wall protection by the <italic>candida albicans</italic> class I chitin synthases</article-title>. <source>Fungal Genet. Biol.</source> <volume>82</volume>, <fpage>264</fpage>&#x2013;<lpage>276</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.fgb.2015.08.001</pub-id>
</citation>
</ref>
<ref id="B50">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ram</surname> <given-names>A. F.J.</given-names>
</name>
<name>
<surname>Klis</surname> <given-names>F. M.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Identification of fungal cell wall mutants using susceptibility assays based on calcofluor white and congo red</article-title>. <source>Nat. Protoc.</source> <volume>1</volume>, <fpage>2253</fpage>&#x2013;<lpage>2565</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nprot.2006.397</pub-id>
</citation>
</ref>
<ref id="B51">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ren</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Chhetri</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Guan</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Suo</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Yokoyama</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>S.-Y.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Structural basis for inhibition and regulation of a chitin synthase from candida albicans</article-title>. <source>Nat. Struct. Mol. Biol.</source> <volume>29</volume>, <fpage>653</fpage>&#x2013;<lpage>645</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41594-022-00791-x</pub-id>
</citation>
</ref>
<ref id="B52">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rico-Ram&#xed;rez</surname> <given-names>A. M.</given-names>
</name>
<name>
<surname>Roberson</surname> <given-names>R. W.</given-names>
</name>
<name>
<surname>Riquelme</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Imaging the secretory compartments involved in the intracellular traffic of CHS-4, a class IV chitin synthase</article-title>. <source>Neurospora Crassa. Fungal Genet. Biol.</source> <volume>117</volume>, <fpage>30</fpage>&#x2013;<lpage>42</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.fgb.2018.03.006</pub-id>
</citation>
</ref>
<ref id="B53">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Riquelme</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Tip growth in filamentous fungi: A road trip to the apex</article-title>. <source>Annu. Rev. Microbiol.</source> <volume>67</volume>, <fpage>587</fpage>&#x2013;<lpage>609</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1146/annurev-micro-092412-155652</pub-id>
</citation>
</ref>
<ref id="B54">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Riquelme</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Bartnicki-Garc&#xed;a</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Advances in understanding hyphal morphogenesis: ontogeny, phylogeny and cellular localization of chitin synthases</article-title>. <source>Fungal Biol. Rev.</source> <volume>22</volume>, <fpage>56</fpage>&#x2013;<lpage>70</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.fbr.2008.05.003</pub-id>
</citation>
</ref>
<ref id="B55">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Riquelme</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Bartnicki-Garc&#xed;a</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Gonz&#xe1;lez-Prieto</surname> <given-names>J. M.</given-names>
</name>
<name>
<surname>S&#xe1;nchez-Le&#xf3;n</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Verd&#xed;n-Ramos</surname> <given-names>J. A.</given-names>
</name>
<name>
<surname>Beltr&#xe1;n-Aguilar</surname> <given-names>A.</given-names>
</name>
<etal/>
</person-group>. (<year>2007</year>). <article-title>Spitzenk&#xf6;rper localization and intracellular traffic of green fluorescent protein-labeled CHS-3 and CHS-6 chitin synthases in living hyphae of <italic>neurospora crassa</italic>
</article-title>. <source>Eukaryotic Cell</source> <volume>6</volume>, <fpage>1853</fpage>&#x2013;<lpage>1864</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/EC.00088-07</pub-id>
</citation>
</ref>
<ref id="B56">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sacristan</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Manzano-Lopez</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Reyes</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Spang</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Mu&#xf1;iz</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Roncero</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Oligomerization of the chitin synthase chs 3 is monitored at the G olgi and affects its endocytic recycling</article-title>. <source>Mol. Microbiol.</source> <volume>90</volume>, <fpage>252</fpage>&#x2013;<lpage>266</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/mmi.12360</pub-id>
</citation>
</ref>
<ref id="B57">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>S&#xe1;nchez&#x2010;Le&#xf3;n</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Bowman</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Seidel</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Fischer</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Novick</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Riquelme</surname> <given-names>M</given-names>
</name>
</person-group>. (<year>2014</year>). <article-title>The Rab GTPase YPT-1 associates with Golgi cisternae and Spitzenk&#xf6;rper microvesicles in <italic>Neurospora crassa</italic>
</article-title>. <source>Mol. Microbiol.</source> <volume>95</volume>, <fpage>472</fpage>&#x2013;<lpage>490</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/mmi.12878</pub-id>
</citation>
</ref>
<ref id="B58">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>S&#xe1;nchez-Le&#xf3;n</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Verd&#xed;n</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Freitag</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Roberson</surname> <given-names>R. W.</given-names>
</name>
<name>
<surname>Bartnicki-Garcia</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Riquelme</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Traffic of chitin synthase 1 (CHS-1) to the spitzenk&#xf6;rper and developing septa in hyphae of <italic>neurospora crassa</italic>: actin dependence and evidence of distinct microvesicle populations</article-title>. <source>Eukaryotic Cell</source> <volume>10</volume>, <fpage>683</fpage>&#x2013;<lpage>695</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/EC.00280-10</pub-id>
</citation>
</ref>
<ref id="B59">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sanz</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>
<italic>Saccharomyces cerevisiae</italic> bni4p directs the formation of the chitin ring and also participates in the correct assembly of the septum structure</article-title>. <source>Microbiology</source> <volume>150</volume>, <fpage>3229</fpage>&#x2013;<lpage>3241</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1099/mic.0.27352-0</pub-id>
</citation>
</ref>
<ref id="B60">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sanz</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Carrano</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Jim&#xe9;nez</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Candiani</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Trilla</surname> <given-names>J. A.</given-names>
</name>
<name>
<surname>Dur&#xe1;n</surname> <given-names>A.</given-names>
</name>
<etal/>
</person-group>. (<year>2005</year>). <article-title>
<italic>Candida albicans</italic> strains deficient in CHS7, a key regulator of chitin synthase III, exhibit morphogenetic alterations and attenuated virulence</article-title>. <source>Microbiology</source> <volume>151</volume>, <fpage>2623</fpage>&#x2013;<lpage>2636</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1099/mic.0.28093-0</pub-id>
</citation>
</ref>
<ref id="B61">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Seaman</surname> <given-names>M. N. J.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Membrane traffic in the secretory pathway: endosome protein sorting: motifs and machinery</article-title>. <source>Cell. Mol. Life Sci.</source> <volume>65</volume>, <fpage>2842</fpage>&#x2013;<lpage>2858</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00018-008-8354-1</pub-id>
</citation>
</ref>
<ref id="B62">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shen</surname> <given-names>M. W. Y.</given-names>
</name>
<name>
<surname>Shah</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Da Silva</surname> <given-names>N.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Enhanced arsenate uptake in <italic>saccharomyces cerevisiae</italic> overexpressing the pho84 phosphate transporter</article-title>. <source>Biotechnol. Prog.</source> <volume>28</volume>, <fpage>654</fpage>&#x2013;<lpage>661</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/btpr.1531</pub-id>
</citation>
</ref>
<ref id="B63">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sherwood</surname> <given-names>P. W.</given-names>
</name>
<name>
<surname>Carlson</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>1999</year>). <article-title>Efficient export of the glucose transporter hxt1p from the endoplasmic reticulum requires gsf2p</article-title>. <source>Proc. Natl. Acad. Sci.</source> <volume>96</volume>, <fpage>7415</fpage>&#x2013;<lpage>7420</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1073/pnas.96.13.7415</pub-id>
</citation>
</ref>
<ref id="B64">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Smith</surname> <given-names>K. M.</given-names>
</name>
<name>
<surname>Phatale</surname> <given-names>P. A.</given-names>
</name>
<name>
<surname>Sullivan</surname> <given-names>C. M.</given-names>
</name>
<name>
<surname>Pomraning</surname> <given-names>K. R.</given-names>
</name>
<name>
<surname>Freitag</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Heterochromatin is required for normal distribution of <italic>neurospora crassa</italic> cenH3</article-title>. <source>Mol. Cell. Biol.</source> <volume>31</volume>, <fpage>2528</fpage>&#x2013;<lpage>2542</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/MCB.01285-10</pub-id>
</citation>
</ref>
<ref id="B65">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Starr</surname> <given-names>T. L.</given-names>
</name>
<name>
<surname>Pagant</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>C. W.</given-names>
</name>
<name>
<surname>Schekman</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Sorting signals that mediate traffic of chitin synthase III between the TGN/endosomes and to the plasma membrane in yeast</article-title>. <source>PloS One</source> <volume>7</volume>, <fpage>e46386</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pone.0046386</pub-id>
</citation>
</ref>
<ref id="B66">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sudoh</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Tatsuno</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Ono</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Ohta</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Chibana</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Yamada-Okabe</surname> <given-names>H.</given-names>
</name>
<etal/>
</person-group>. (<year>1999</year>). <article-title>The <italic>candida albicans</italic> CHS4 gene complements a <italic>saccharomyces cerevisiae</italic> skt5/chs4 mutation and is involved in chitin biosynthesis</article-title>. <source>Microbiology</source> <volume>145</volume>, <fpage>1613</fpage>&#x2013;<lpage>1622</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1099/13500872-145-7-1613</pub-id>
</citation>
</ref>
<ref id="B67">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sun</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>MacRae</surname> <given-names>T. H.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>Small heat shock proteins: molecular structure and chaperone function</article-title>. <source>Cell. Mol. Life Sci.</source> <volume>62</volume>, <fpage>2460</fpage>&#x2013;<lpage>2476</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00018-005-5190-4</pub-id>
</citation>
</ref>
<ref id="B68">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Torres-Garc&#xed;a</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Pinto-C&#xe1;mara</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Linares</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Mart&#xed;nez</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Abonza</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Brito-Alarc&#xf3;n</surname> <given-names>E.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>Extending resolution within a single imaging frame</article-title>. <source>Nat. Commun.</source> <volume>13</volume>, <fpage>7452</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41467-022-34693-9</pub-id>
</citation>
</ref>
<ref id="B69">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Travers</surname> <given-names>K. J.</given-names>
</name>
<name>
<surname>Patil</surname> <given-names>C. K.</given-names>
</name>
<name>
<surname>Wodicka</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Lockhart</surname> <given-names>D. J.</given-names>
</name>
<name>
<surname>Weissman</surname> <given-names>J. S.</given-names>
</name>
<name>
<surname>Walter</surname> <given-names>P.</given-names>
</name>
</person-group> (<year>2000</year>). <article-title>Functional and genomic analyses reveal an essential coordination between the unfolded protein response and ER-associated degradation</article-title>. <source>Cell</source> <volume>101</volume>, <fpage>249</fpage>&#x2013;<lpage>258</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S0092-8674(00)80835-1</pub-id>
</citation>
</ref>
<ref id="B70">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Trilla</surname> <given-names>J. A.</given-names>
</name>
<name>
<surname>Dur&#xe1;n</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Roncero</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>1999</year>). <article-title>Chs7p, a new protein involved in the control of protein export from the endoplasmic reticulum that is specifically engaged in the regulation of chitin synthesis in <italic>saccharomyces cerevisiae</italic>
</article-title>. <source>J. Cell Biol.</source> <volume>145</volume>, <fpage>1153</fpage>&#x2013;<lpage>1163</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1083/jcb.145.6.1153</pub-id>
</citation>
</ref>
<ref id="B71">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vogel</surname> <given-names>H. J.</given-names>
</name>
</person-group> (<year>1956</year>). <article-title>A convenient growth medium for neurospora (Medium N)</article-title>. <source>Microbial Genet. Bull.</source> <volume>13</volume>, <fpage>42</fpage>&#x2013;<lpage>43</lpage>.</citation>
</ref>
<ref id="B72">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Weichert</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Guirao-Abad</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Aimanianda</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Krishnan</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Grisham</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Snyder</surname> <given-names>P.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>Functional coupling between the unfolded protein response and endoplasmic reticulum/golgi ca<sup>2+</sup>-ATPases promotes stress tolerance, cell wall biosynthesis, and virulence of <italic>aspergillus fumigatus.</italic> Edited by J. Andrew alspaugh</article-title>. <source>mBio</source> <volume>11</volume>, <fpage>e01060</fpage>&#x2013;<lpage>e01020</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/mBio.01060-20</pub-id>
</citation>
</ref>
<ref id="B73">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yan</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Tao</surname> <given-names>H.</given-names>
</name>
<name>
<surname>He</surname> <given-names>Ji</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>S.-Y.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>The HDOCK server for integrated protein&#x2013;Protein docking</article-title>. <source>Nat. Protoc.</source> <volume>15</volume>, <fpage>1829</fpage>&#x2013;<lpage>1525</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41596-020-0312-x</pub-id>
</citation>
</ref>
<ref id="B74">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yarden</surname> <given-names>O.</given-names>
</name>
<name>
<surname>Yanofsky</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>1991</year>). <article-title>Chitin synthase 1 plays a major role in cell wall biogenesis</article-title>. <source>Neurospora Crassa. Genes Dev.</source> <volume>5</volume>, <fpage>2420</fpage>&#x2013;<lpage>2430</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1101/gad.5.12b.2420</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>