<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xml:lang="EN" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. For. Glob. Change</journal-id>
<journal-title>Frontiers in Forests and Global Change</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. For. Glob. Change</abbrev-journal-title>
<issn pub-type="epub">2624-893X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/ffgc.2022.1068135</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Forests and Global Change</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Benchmarking a fast and simple on-site detection assay for the oak wilt pathogen <italic>Bretziella fagacearum</italic></article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name><surname>Bourgault</surname> <given-names>&#x00C9;milie</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="author-notes" rid="fn002"><sup>&#x2020;</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/2092385/overview"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Gauthier</surname> <given-names>Marie-Krystel</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="author-notes" rid="fn002"><sup>&#x2020;</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/2082539/overview"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Potvin</surname> <given-names>Am&#x00E9;lie</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
</contrib>
<contrib contrib-type="author">
<name><surname>Stewart</surname> <given-names>Don</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
</contrib>
<contrib contrib-type="author">
<name><surname>Chahal</surname> <given-names>Karandeep</given-names></name>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/1722624/overview"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Sakalidis</surname> <given-names>Monique L.</given-names></name>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<xref ref-type="aff" rid="aff3"><sup>3</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/687309/overview"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name><surname>Tanguay</surname> <given-names>Philippe</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="corresp" rid="c001"><sup>&#x002A;</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/684242/overview"/>
</contrib>
</contrib-group>
<aff id="aff1"><sup>1</sup><institution>Natural Resources Canada, Canadian Forest Service, Laurentian Forestry Centre</institution>, <addr-line>Qu&#x00E9;bec, QC</addr-line>, <country>Canada</country></aff>
<aff id="aff2"><sup>2</sup><institution>Department of Plant, Soil and Microbial Sciences, Michigan State University</institution>, <addr-line>East Lansing, MI</addr-line>, <country>United States</country></aff>
<aff id="aff3"><sup>3</sup><institution>Department of Forestry, Michigan State University</institution>, <addr-line>East Lansing, MI</addr-line>, <country>United States</country></aff>
<author-notes>
<fn fn-type="edited-by"><p>Edited by: Benoit Mar&#x00E7;ais, INRA Centre Nancy-Lorraine, France</p></fn>
<fn fn-type="edited-by"><p>Reviewed by: Jaime Aguayo, Agence Nationale de S&#x00E9;curit&#x00E9; Sanitaire de l&#x2019;Alimentation, de l&#x2019;Environnement et du Travail (ANSES), France; Luisa Ghelardini, University of Florence, Italy</p></fn>
<corresp id="c001">&#x002A;Correspondence: Philippe Tanguay, <email>Philippe.Tanguay@nrcan-rncan.gc.ca</email></corresp>
<fn fn-type="equal" id="fn002"><p><sup>&#x2020;</sup>These authors have contributed equally to this work and share first authorship</p></fn>
<fn fn-type="other" id="fn004"><p>This article was submitted to Pests, Pathogens and Invasions, a section of the journal Frontiers in Forests and Global Change</p></fn>
</author-notes>
<pub-date pub-type="epub">
<day>15</day>
<month>12</month>
<year>2022</year>
</pub-date>
<pub-date pub-type="collection">
<year>2022</year>
</pub-date>
<volume>5</volume>
<elocation-id>1068135</elocation-id>
<history>
<date date-type="received">
<day>12</day>
<month>10</month>
<year>2022</year>
</date>
<date date-type="accepted">
<day>30</day>
<month>11</month>
<year>2022</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#x00A9; 2022 Bourgault, Gauthier, Potvin, Stewart, Chahal, Sakalidis and Tanguay.</copyright-statement>
<copyright-year>2022</copyright-year>
<copyright-holder>Bourgault, Gauthier, Potvin, Stewart, Chahal, Sakalidis and Tanguay</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/"><p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p></license>
</permissions>
<abstract>
<p>Oak wilt is a vascular disease of oak trees caused by the fungus <italic>Bretziella fagacearum</italic>. Once infected, trees may die in a few weeks. Although the disease is currently only found in the United States, it has been reported within just a few hundred meters of the Canada&#x2013;USA border. To limit the establishment and spread of oak wilt in Canada, the development of an on-site, quick and reliable method to detect <italic>B. fagacearum</italic> is critical. In this study, we developed and validated a new qPCR TaqMan<sup>&#x00AE;</sup> assay that can detect <italic>B. fagacearum</italic> in a laboratory setting with great specificity and sensitivity. Using this test as a reference, we also developed and validated a new DETECTR assay that can detect <italic>B. fagacearum</italic> under 1 h from a variety of environmental samples, such as mycelium mats and insect vectors, using minimal laboratory equipment. While there are still some limitations to the sensitivity of this assay, we believe that its ease of use, flexibility and accuracy will provide an essential tool in efforts to reduce the spread of oak wilt.</p>
</abstract>
<kwd-group>
<kwd>DETECTR</kwd>
<kwd>molecular detection</kwd>
<kwd>oak wilt</kwd>
<kwd><italic>Bretziella fagacearum</italic></kwd>
<kwd>TaqMan<sup>&#x00AE;</sup> assay</kwd>
</kwd-group>
<contract-sponsor id="cn001">Natural Resources Canada<named-content content-type="fundref-id">10.13039/501100000159</named-content></contract-sponsor>
<counts>
<fig-count count="3"/>
<table-count count="2"/>
<equation-count count="0"/>
<ref-count count="58"/>
<page-count count="12"/>
<word-count count="8846"/>
</counts>
</article-meta>
</front>
<body>
<sec id="S1" sec-type="intro">
<title>1 Introduction</title>
<p>Oak wilt is a vascular disease of oak trees (<italic>Quercus</italic> spp.) caused by the fungus <italic>Bretziella fagacearum</italic>, previously known as <italic>Ceratocystis fagacearum</italic> (<xref ref-type="bibr" rid="B4">Beer et al., 2017</xref>). First described in the 1940&#x2019;s (<xref ref-type="bibr" rid="B27">Henry, 1944</xref>; <xref ref-type="bibr" rid="B7">Bretz, 1953</xref>), disease symptoms appear after the pathogen enters the sapwood and disrupts the xylem vessels, therefore preventing water and nutrient transport (<xref ref-type="bibr" rid="B23">French and Stienstra, 1980</xref>). The affected trees eventually die, sometimes within just a few months of infection. For instance, red oaks (section <italic>Lobatae</italic>) are highly susceptible to the disease and can die in a matter of weeks, forever altering urban landscapes, plantations, and natural ecosystems (<xref ref-type="bibr" rid="B24">Gibbs and French, 1980</xref>).</p>
<p>Dispersion of <italic>B. fagacearum</italic> to healthy trees happens by underground or aboveground transmission. Underground transmission involves the movement of <italic>B. fagacearum</italic> through naturally occurring root grafts and accounts for short distance spread and the creation of expanding oak wilt pockets. The connected xylem vessels of the root grafts allow the fungus to travel from an infected tree to adjacent healthy oaks. Aboveground transmission occurs mainly through spores dissemination <italic>via</italic> insect vectors, mostly by Nitidulidae species (sap beetles) such as <italic>Colopterus truncatus</italic> and <italic>Carpophilus sayi</italic> (<xref ref-type="bibr" rid="B12">Cease and Juzwik, 2001</xref>). Sap beetles are attracted to fragrant sporulating fungal mats formed on bark cracks on the trunk of oak wilt killed trees or by mat bearing firewood (<xref ref-type="bibr" rid="B29">Juzwik et al., 2008</xref>). They can later transmit spores to wounded healthy trees, up to 600 meters away within a single year (<xref ref-type="bibr" rid="B50">Shelstad et al., 1991</xref>).</p>
<p>Currently, oak wilt disease is only found in Texas, midwestern and eastern states in the United States (<xref ref-type="bibr" rid="B52">USDA-Forest Service Northern Research Station, and Forest Health Protection, 2019</xref>), where it was potentially introduced many years ago (<xref ref-type="bibr" rid="B29">Juzwik et al., 2008</xref>). However, there has been a continuous northward spread of the disease, with an increasing number of infected counties being reported at the Canada&#x2013;USA border (<xref ref-type="bibr" rid="B28">Jensen-Tracy et al., 2009</xref>).</p>
<p>Of the 200 oak species existing in the world, only 10 can be found in Canada, mainly located in Ontario and Eastern Canada (<xref ref-type="bibr" rid="B32">Lacoursi&#x00E8;re, 2015</xref>). They include species from red oaks, white oaks (section <italic>Quercus</italic>) and chestnut oaks (section <italic>Quercus</italic>), all of whom are susceptible to <italic>B. fagacearum</italic> infections to various levels (<xref ref-type="bibr" rid="B24">Gibbs and French, 1980</xref>; <xref ref-type="bibr" rid="B40">OWTAC, 2019</xref>).</p>
<p>As climate change progresses, insect vectors could possibly carry the fungus across the border and eventually spread to all of Eastern Canada, an area now climatically suitable for <italic>B. fagacearum</italic> and numerous potential vectors. In fact, the climate in southern Ontario has already been found appropriate for <italic>B. fagacearum</italic>, <italic>C. truncatus</italic>, and <italic>C. sayi</italic> (<xref ref-type="bibr" rid="B43">Pedlar et al., 2020</xref>). Additionally, despite the regulatory measures already in place, oak wilt could enter Canada through the transportation of contaminated logs (<xref ref-type="bibr" rid="B13">CFIA, 2020</xref>). The spread of oak wilt to Canada may lead to large-scale mortality of urban trees, the devastation of natural ecosystems and could cripple the oak log industry, with estimated economic losses of CDN&#x0024; 400 million (<xref ref-type="bibr" rid="B43">Pedlar et al., 2020</xref>).</p>
<p>Since it is not possible to cure infected trees, management of oak wilt is focused on preventing additional spread and involves the establishment of root graft barriers and trench inserts, removal of potential spore-producing trees, preventive fungicide injections, a ban on firewood transportation between different areas and restricted oak tree wounding activities to certain periods of the year (<xref ref-type="bibr" rid="B39">O&#x2019;Brien et al., 2000</xref>; <xref ref-type="bibr" rid="B53">Wilson, 2001</xref>; <xref ref-type="bibr" rid="B31">Koch et al., 2010</xref>). The European Union is also tightening its restrictions when trading oak logs with bark from the USA (<xref ref-type="bibr" rid="B20">EFSA et al., 2020</xref>). For these efforts to be successful, rapid confirmation of infection is critical.</p>
<p>Diseased trees can tentatively be identified due to wilted leaves and defoliation. Unfortunately, those early symptoms are common among other abiotic and biotic issues, such as oak leaf blister and drought (<xref ref-type="bibr" rid="B38">Natural Resources Canada [NRCAN], 2015</xref>; <xref ref-type="bibr" rid="B37">Moore et al., 2022</xref>). Therefore, lab-based identification of <italic>B. fagacearum</italic> from symptomatic plant samples is required to confirm oak wilt. The need for a lab confirmation results in delays to the implementation of mitigating measures and increased associated costs. <italic>B. fagacearum</italic> may be present in logs or firewood from oak wilt killed trees, and may also persist in the root system of cut down diseased trees for several years and go unnoticed (<xref ref-type="bibr" rid="B29">Juzwik et al., 2008</xref>). The need to develop an on-site, quick and reliable method to detect <italic>B. fagacearum</italic> is now becoming more and more pressing in order to limit the establishment and spread of oak wilt.</p>
<p>Quantitative real-time PCR (qPCR) has become the gold standard in pathogen detection in many fields, including invasive alien tree pathogens, facilitating the detection of infinitesimal amounts of target DNA within a large quantity of environmental material (<xref ref-type="bibr" rid="B26">Heid et al., 1996</xref>). However, while qPCR is highly specific and sensitive, it is time-consuming, costly and requires specialized equipment, i.e., real-time PCR machine and technical expertise. Efforts have been made to miniaturize this piece of equipment, and various companies have commercialized portable real-time PCR instruments like the Franklin&#x2122; by Biomeme (Biomeme, Philadelphia, PA, USA), facilitating point-of-care detection. In a recent study, the Franklin&#x2122; machine, was shown to reliably detect forest pests and pathogens such as <italic>Sphaerulina musiva</italic>, <italic>Phytophthora ramorum</italic>, <italic>Lymantria dispar</italic>, and <italic>Cronartium</italic> sp. in the field (<xref ref-type="bibr" rid="B11">Capron et al., 2020</xref>). Other studies have also demonstrated on-site molecular detection using a variety of portable machines and sample types (<xref ref-type="bibr" rid="B9">Brown et al., 2020</xref>; <xref ref-type="bibr" rid="B58">Zowawi et al., 2021</xref>). These portable machines are robust, allow multiplexing and can also use previously developed lab-validated assays (<xref ref-type="bibr" rid="B11">Capron et al., 2020</xref>). However, with a price around US &#x0024;10 0000, the cost of the portable real-time PCR machine can hamper its deployment.</p>
<p>In recent years, a novel technique called recombinase polymerase amplification (RPA) was developed, which can exponentially amplify a DNA target with a sensitivity, specificity, and a reliability comparable to that of a standard PCR (<xref ref-type="bibr" rid="B44">Piepenburg et al., 2006</xref>). The RPA reaction exploits the activity of recombinase proteins that bind to oligonucleotide primers and scan the double stranded DNA for complementary sequence. The recombinase then inserts the primers <italic>via</italic> strand exchange, and a single-strand DNA binding protein binds to the displaced strand to stabilize the loop. A polymerase can then initiate polymerization from the primers if the target sequence is present. Companies like TwistDx have packaged RPA reactions in very convenient lyophilized tubes, making the technology even more accessible (TwistDx, Cambridge, UK). RPA is fast and works at a constant low temperature, two features making this technology highly desirable for outdoor deployment since the use of a simple thermal block can now be considered. RPA has been used for the rapid detection of viruses (<xref ref-type="bibr" rid="B21">Euler et al., 2012a</xref>; <xref ref-type="bibr" rid="B6">Boyle et al., 2013</xref>; <xref ref-type="bibr" rid="B55">Yang et al., 2017</xref>), bacteria (<xref ref-type="bibr" rid="B22">Euler et al., 2012b</xref>; <xref ref-type="bibr" rid="B1">Ahmed et al., 2014</xref>) and fungi (<xref ref-type="bibr" rid="B2">Ahmed et al., 2015</xref>; <xref ref-type="bibr" rid="B30">Karakkat et al., 2018</xref>).</p>
<p>It has recently been shown that RPA can be combined with CRISPR/Cas technologies leading to different detection methods. DNA endonuclease-targeted CRISPR trans reporter (DETECTR) is one of these new detection methods. DETECTR uses RPA enzymes combined with Cas12a enzyme from the clustered regularly interspaced short palindromic repeats (CRISPR) platform (<xref ref-type="bibr" rid="B16">Chen et al., 2018</xref>). This innovative detection tool exploits the collateral <italic>trans-</italic>cleavage activity of an activated Cas12a, which will, upon recognition of a dsDNA target sequence, cleave ssDNA non-specifically at multiple random sites. By adding a modified ssDNA reporter in the reaction, a positive signal, i.e., the presence of the original target DNA sequence, can be detected by various methods, such as lateral flow assays or fluorometry (<xref ref-type="bibr" rid="B16">Chen et al., 2018</xref>). DETECTR assays have already been used in the detection and/or diagnosis of various pathogens and cancer (<xref ref-type="bibr" rid="B3">Arora et al., 2020</xref>; <xref ref-type="bibr" rid="B57">Zhang et al., 2020</xref>), most notably for the betacoronavirus severe acute respiratory syndrome (SARS)-CoV-2 (<xref ref-type="bibr" rid="B8">Broughton et al., 2020</xref>; <xref ref-type="bibr" rid="B19">Ding et al., 2020</xref>; <xref ref-type="bibr" rid="B34">Lucia et al., 2020</xref>). Similar assays have also been recently tested, to a lesser extent, on bacterial and viral plant diseases (<xref ref-type="bibr" rid="B35">Luo et al., 2021</xref>; <xref ref-type="bibr" rid="B51">Singh et al., 2022</xref>).</p>
<p>This study therefore aimed at developing and validating a DETECTR assay targeting the internal transcribed spacer (ITS) gene of <italic>B. fagacearum.</italic> The specificity and sensitivity of this detection test were evaluated and compared to a newly designed qPCR TaqMan<sup>&#x00AE;</sup> assay for a variety of environmental sample types, namely mycelial mats and insect samples. A panel of participants was also used to optimize the DETECTR assay for on-site deployment. We hope that future implementation of this detection test with phytosanitary inspectors and other end users will effectively limit the spread of oak wilt in Canada and the USA.</p>
</sec>
<sec id="S2" sec-type="materials|methods">
<title>2 Materials and methods</title>
<sec id="S2.SS1">
<title>2.1 Isolates, DNA extraction and sample preparation</title>
<p>DNA from <italic>B. fagacearum</italic> and closely related species was obtained from a previously published study (<xref ref-type="bibr" rid="B33">Lamarche et al., 2015</xref>) and is listed in <xref ref-type="supplementary-material" rid="TS1">Supplementary Table 1</xref>. To confirm the species identity of all samples, the ITS gene, recognized as the universal DNA barcode for fungi (<xref ref-type="bibr" rid="B48">Schoch et al., 2012</xref>), was amplified and sequenced. A genus-specific SYBR Green-based qPCR assay (<xref ref-type="table" rid="T1">Table 1</xref>) was designed in a conserved region of the ITS gene to perform an absolute quantification (<xref ref-type="bibr" rid="B47">Rutledge, 2011</xref>) of all the strains and to standardize their concentration when necessary.</p>
<table-wrap position="float" id="T1">
<label>TABLE 1</label>
<caption><p>Primers and probe used for genus-specific qPCR SYBRGreen, species-specific qPCR TaqMan<sup>&#x00AE;</sup>, and DETECTR assays.</p></caption>
<table cellspacing="5" cellpadding="5" frame="hsides" rules="groups">
<thead>
<tr>
<td valign="top" align="left">Name</td>
<td valign="top" align="center">Target gene</td>
<td valign="top" align="center">Amplicon length (bp)</td>
<td valign="top" align="left">Sequence (5&#x2032; &#x2192; 3&#x2032;)</td>
<td valign="top" align="center">References</td>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left" colspan="5"><bold><italic>Ceratocystis sensu lato</italic></bold></td>
</tr>
<tr>
<td valign="top" align="left" colspan="5"><bold>qPCR SYBR green assay</bold></td>
</tr>
<tr>
<td valign="top" align="left">Cerat ITS gen F277&#x2013;301</td>
<td valign="top" align="center">ITS</td>
<td valign="top" align="center">120</td>
<td valign="top" align="left">GCGAAATGCGATAMGTAATGTGAATTG</td>
<td valign="top" align="center">This study</td>
</tr>
<tr>
<td valign="top" align="left">Cerat Gen ITS R377&#x2013;397</td>
<td valign="top" align="center">ITS</td>
<td/>
<td valign="top" align="left">CTTGAGTGGTGAAATGACGCT</td>
<td valign="top" align="center">This study</td>
</tr>
<tr>
<td valign="top" align="left" colspan="5"><bold><italic>B. fagacearum-</italic>specific</bold></td>
</tr>
<tr>
<td valign="top" align="left" colspan="5"><bold>qPCR TaqMan<sup>&#x00AE;</sup> assay</bold></td>
</tr>
<tr>
<td valign="top" align="left">Cfag ITS F 75&#x2013;97</td>
<td valign="top" align="center">ITS</td>
<td valign="top" align="center">168</td>
<td valign="top" align="left">TAAAACCATTTGTGAACATACCA</td>
<td valign="top" align="center">This study</td>
</tr>
<tr>
<td valign="top" align="left">Cfag ITS R2 215&#x2013;43</td>
<td valign="top" align="center">ITS</td>
<td/>
<td valign="top" align="left">TGAAAGTTTTAACTATTTTGTTAAATGCA</td>
<td valign="top" align="center">This study</td>
</tr>
<tr>
<td valign="top" align="left">Cfag ITS T RC 126&#x2013;50</td>
<td valign="top" align="center">ITS</td>
<td/>
<td valign="top" align="left">6FAM-AACATCCCCTGAAGAAAGAAGTCC-ZEN</td>
<td valign="top" align="center">This study</td>
</tr>
<tr>
<td valign="top" align="left" colspan="5"><bold>RPA reaction</bold></td>
</tr>
<tr>
<td valign="top" align="left">Cfag ITS RPA-F1</td>
<td valign="top" align="center">ITS</td>
<td valign="top" align="center">170</td>
<td valign="top" align="left">AACTCTTTAAAACCATTTGTGAACATACCA</td>
<td valign="top" align="center">This study</td>
</tr>
<tr>
<td valign="top" align="left">Cfag ITS R2 215&#x2013;43</td>
<td valign="top" align="center">ITS</td>
<td/>
<td valign="top" align="left">TGAAAGTTTTAACTATTTTGTTAAATGCA</td>
<td valign="top" align="center">This study</td>
</tr>
<tr>
<td valign="top" align="left" colspan="5"><bold>DETECTR assay</bold></td>
</tr>
<tr>
<td valign="top" align="left">Cfag ITS crRNA&#x2013;2</td>
<td valign="top" align="center">ITS</td>
<td valign="top" align="center">&#x2014;</td>
<td valign="top" align="left">TGCCAGTAGTATTTACAAACTCTT<xref ref-type="table-fn" rid="t1fna"><sup>a</sup></xref></td>
<td valign="top" align="center">This study</td>
</tr>
<tr>
<td valign="top" align="left">FQ-reporter</td>
<td valign="top" align="center">&#x2014;</td>
<td valign="top" align="center">&#x2014;</td>
<td valign="top" align="left">/56-FAM/ttatt/3IABkFQ/</td>
<td valign="top" align="center"><xref ref-type="bibr" rid="B57">Zhang et al., 2020</xref></td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="t1fna"><p><sup>a</sup>Targeting sequence of crRNA.</p></fn>
</table-wrap-foot>
</table-wrap>
<p>Fresh cultures of <italic>B. fagacearum</italic> were also isolated from wood tissue of various infected <italic>Quercus</italic> spp. in the Lower Peninsula of Michigan in 2020. Isolates were grown on acidified potato dextrose agar (PDA; Difco&#x2122;, Sparks, MD, USA) for 2 weeks at room temperature, and hyphal-tip purified. One mL of Lactic acid, 85% (JT Baker, Phillipsburg, NJ, USA) was added into 1L of PDA. Mycelium was then harvested, frozen in liquid nitrogen, and ground with a mortar and pestle. Subsequent DNA extraction followed the protocol described before (<xref ref-type="bibr" rid="B41">Parada-Rojas and Quesada-Ocampo, 2018</xref>). All samples were quantified using the SYBR Green assay and are listed in <xref ref-type="supplementary-material" rid="TS1">Supplementary Table 1</xref>.</p>
</sec>
<sec id="S2.SS2">
<title>2.2 Novel target-specific TaqMan<sup>&#x00AE;</sup>-based real-time PCR assay design</title>
<p>To benchmark the DETECTR assay, we first developed a TaqMan<sup>&#x00AE;</sup>-based real-time PCR assay. A total of 37 published ITS sequences for <italic>B. fagacearum</italic> and closely related species were aligned (<xref ref-type="supplementary-material" rid="TS2">Supplementary File 2</xref>). A set of primers and a probe were then designed in regions showing <italic>B. fagacearum</italic>-specific nucleotide polymorphisms. All primers were designed using previously described criteria and amplifications were conducted under the conditions described in <xref ref-type="bibr" rid="B33">Lamarche et al. (2015</xref>; <xref ref-type="table" rid="T1">Table 1</xref>). Positive (using <italic>B. fagacearum</italic> DNA from pure culture isolate C520, <xref ref-type="supplementary-material" rid="TS1">Supplementary Table 1</xref>) and negative (no DNA template) controls were included in all qPCR runs.</p>
</sec>
<sec id="S2.SS3">
<title>2.3 Novel target-specific DETECTR assay design</title>
<p>The DETECTR assay was performed using RPA to amplify fungal DNA with the TwistAmp Basic Kit (TwistDx, Cambridge, UK), and LbaCas12a (New England Biolabs, MA, USA) for the DETECTR part of the assay. RPA primers (Integrated DNA Technologies Inc., Coralville, IA, USA) were adapted from the TaqMan<sup>&#x00AE;</sup> qPCR assay following the TwistAmp Basic kit manual and are listed in <xref ref-type="table" rid="T1">Table 1</xref>. Amplification was achieved with a few modifications to the manufacturer&#x2019;s instructions. Briefly, each reaction was prepared using 29.5 &#x03BC;L of TwistAmp Rehydration buffer, 2.75 &#x03BC;L of forward and reverse primers (10 &#x03BC;M) and 10.8 &#x03BC;L of nuclease-free water. The mix was used to resuspend the reaction pellets provided with the TwistAmp Basic kit. Then, 1 &#x03BC;L of DNA template and 3.2 &#x03BC;L of 280 mM magnesium acetate were added in a final volume of 50 &#x03BC;L. Tubes were quickly vortexed and incubated at 37&#x00B0;C for 20 min, followed by inactivation at 65&#x00B0;C for 10 min.</p>
<p>The LbaCas12a (Cas12a from <italic>Lachnospiraceae bacterium ND2006</italic>) <italic>trans-</italic>cleavage assay was performed similarly to those previously described (<xref ref-type="bibr" rid="B16">Chen et al., 2018</xref>; <xref ref-type="bibr" rid="B57">Zhang et al., 2020</xref>). Cas12a targeting sequence was selected according to the presence of PAM for Lba Cas12a (TTTV) (<xref ref-type="bibr" rid="B56">Zetsche et al., 2015</xref>). Guide RNA and ssDNA FQ-reporter are listed in <xref ref-type="table" rid="T1">Table 1</xref> and were designed following recommendations from NEB (New England Biolabs, MA, USA) as well as previous studies (<xref ref-type="bibr" rid="B56">Zetsche et al., 2015</xref>; <xref ref-type="bibr" rid="B57">Zhang et al., 2020</xref>). Both were ordered from Integrated DNA Technology (IDT Inc., Coralville, IA, USA). To detect the DNA target <italic>via</italic> fluorescence, Cas12a digestion reactions were prepared using 1X NEBuffer 2.1, 50 nM of LbaCas12a, 50 nM guide RNA and 250 nM FQ-reporter in a final volume of 60 &#x03BC;L. The mix was pre-incubated at room temperature for 10 min. Then, 6 &#x03BC;L of unpurified RPA product was added to the reaction and transferred to a 96-well black optical-bottom plate (Thermo Fisher Scientific, MA, USA). Fluorescence was measured at 37&#x00B0;C every 5 min for 1 h (excitation: 485 nm, emission: 535 nm) using the Fluoroskan Ascent plate reader (Labsystems).</p>
</sec>
<sec id="S2.SS4">
<title>2.4 Validating the specificity and sensitivity of the qPCR TaqMan<sup>&#x00AE;</sup> assay</title>
<p>To validate the specificity of the newly designed qPCR TaqMan<sup>&#x00AE;</sup> for <italic>B. fagacearum</italic>, we ran the assay in triplicates on 31 <italic>B. fagacearum</italic> strains from pure cultures as well as a panel of closely related species (section &#x201C;DNA from pure cultures,&#x201D; <xref ref-type="supplementary-material" rid="TS1">Supplementary Table 1</xref>). Closely related species&#x2019; DNA samples were standardized to approximately 5,000 ITS copies with the SYBR Green assay. Since high DNA concentrations are known to sometimes inhibit amplification, we wanted to ensure that, if samples were not detected, it would be due to the specificity of the assay, and not because of potential inhibition.</p>
<p>In order to evaluate the sensitivity of the qPCR TaqMan<sup>&#x00AE;</sup> assay, we built standard curves using serial dilutions of <italic>B. fagacearum</italic> ITS synthetic DNA target sequence, and calculated the limit of detection (LOD), which is the smallest amount of target DNA that can be detected 95% of the time with the assay (<xref ref-type="bibr" rid="B10">Bustin et al., 2009</xref>). Briefly, 10-fold serial dilutions of <italic>B. fagacearum</italic> ITS copies were made from a gBlocks&#x2122; gene fragment (IDT Inc., Coralville, IA, USA) comprising a segment of the <italic>B. fagacearum</italic> ITS sequence, encompassing the two TaqMan<sup>&#x00AE;</sup> assay primers (<xref ref-type="table" rid="T1">Table 1</xref>) (ref GenBank: KC305152.1). The ITS concentration of each dilution was calculated using the TaqMan<sup>&#x00AE;</sup> primers and SYBR Green reagents. The qPCR TaqMan<sup>&#x00AE;</sup> assay was then run in triplicates for each dilution and a standard curve was obtained by plotting the Ct values against the log value of the number of ITS copies. The LOD was determined by running 20 replicates of the smallest dilution of the standard curve giving 3 positive results.</p>
</sec>
<sec id="S2.SS5">
<title>2.5 Efficiency of two DNA extractions methods using the qPCR TaqMan<sup>&#x00AE;</sup> assay</title>
<p>To assess the efficiency of two DNA extraction methods, standard curves were also built using DNA extracted with 2 protocols from serial dilutions of <italic>B. fagacearum</italic> conidia. A conidial suspension was prepared by growing isolate MIFCC41 on acidified PDA for 2 weeks at room temperature (<xref ref-type="bibr" rid="B15">Chahal et al., 2019</xref>). Conidia were harvested by flooding pure cultures with 70% ethanol, followed by two filtrations using a double layer of Miracloth (Miracloth, EMD Millipore, Billerica, MA, USA). The concentration of conidia in the suspension was determined using a hemocytometer (6.18 &#x00D7; 10<sup>7</sup> conidia per mL). Conidia were plated onto acidified PDA to confirm their non-viability, sedimented by centrifugation, and then sent to the Tanguay Lab at the Laurentian Forestry Centre, Canada. Conidia were then resuspended in 1 mL of sterile distilled water, disaggregated by repeatedly pushing them through a 24-gauge needle, and counted with a hemocytometer. Concentration was adjusted to 10<italic><sup>E</sup></italic>6 conidia per mL, and the stock solution was diluted following a series of 10-fold dilutions in water, down to 1000 conidia per mL. Aliquots of 10 &#x03BC;L from each concentration were dried using a SpeedVac, and then extracted using two different methods. First, to speed-up and facilitate the on-site detection process, samples were immersed in 100 &#x03BC;L of the QuickExtract&#x2122; Plant DNA Extraction Solution (Lucigen, WI, USA) and were immediately heated to 65&#x00B0;C for 6 min, followed by 98&#x00B0;C for 2 min. Extracted samples were stored at &#x2212;20&#x00B0;C until use. As a comparison, we also extracted DNA from the conidia dilutions using the QIAamp DNA micro kit (Qiagen, Valencia, CA, USA) according to the manufacturer&#x2019;s recommendations. The qPCR TaqMan<sup>&#x00AE;</sup> assay was run in triplicates with both sets of conidia dilutions and standard curves were obtained by plotting the Ct values against the log value of the number of conidia.</p>
</sec>
<sec id="S2.SS6">
<title>2.6 Performance of the DETECTR and TaqMan<sup>&#x00AE;</sup> qPCR assays on environmental samples</title>
<p>We ran the DETECTR along with the qPCR TaqMan<sup>&#x00AE;</sup> (in triplicates) on the same samples to see if the source of the material would impact the performance of the assay. The list of all environmental samples, and their origins, used to validate both of our new assays, is shown in <xref ref-type="supplementary-material" rid="TS1">Supplementary Table 1</xref>. DNA from <italic>B. fagacearum</italic> mycelial mat samples, which ranged from development stages 0 to 5 (<xref ref-type="bibr" rid="B14">Chahal et al., 2021</xref>) was extracted with 200 &#x03BC;L of QuickExtract&#x2122; Plant DNA Extraction Solution (Lucigen, Wisconsin, USA). DNA samples from various insect vectors carrying <italic>B. fagacearum</italic> spores (<italic>Carpophilus sayi</italic>, <italic>Epuraea corticina</italic>, <italic>Glischrochilus sanguinolentus</italic>) were obtained from <xref ref-type="bibr" rid="B33">Lamarche et al. (2015)</xref>. DNA from other insect samples not carrying <italic>B. fagacearum</italic> spores was also included to ensure the specificity of both tests (<xref ref-type="bibr" rid="B5">Bergeron et al., 2019</xref>).</p>
</sec>
<sec id="S2.SS7">
<title>2.7 Adapting DETECTR protocol for on-site deployment</title>
<p>In order to facilitate the on-site deployment of this DETECTR assay, a few modifications were made to simplify its use outside of laboratory settings (<xref ref-type="fig" rid="F1">Figure 1</xref>). Most notably, each step of the protocol was carried out in a microtube of a specific color, incubation times were reduced to the minimum and reactions were lyophilized when possible. The DNA extraction step using Lucigen buffer was the same as described above, except that only 100 &#x03BC;L of buffer was prealiquoted in red microtubes. The RPA reaction components (TwistAmp Rehydration buffer, forward and reverse primers, MgOAc and ddH<sub>2</sub>O) were aliquoted in green microtubes with the addition of 5% trehalose. Cas12a digestion reactions were assembled in blue microtubes with a few modifications: reactions were prepared in a final volume of 50 &#x03BC;l, FQ-reporter concentration was increased to 500 nM and 5% of trehalose was added. The RPA and Cas12a reactions were lyophilized overnight at &#x2212;50&#x00B0;C in a FreeZone 2.5 Liter freeze-dryer (Labconco, Kansas City, MO, USA) and stored at &#x2212;20&#x00B0;C until use.</p>
<fig id="F1" position="float">
<label>FIGURE 1</label>
<caption><p>Summary of the new and simplified on-site DETECTR assay. Amplification of target DNA by RPA, and detection by <italic>trans-</italic>cleavage release of fluorescence from the ssDNA FQ-reporter following CRISPR/CAS12a recognition of the target DNA. Each step is carried out in a specific colored microtube. All liquid handling is done <italic>via</italic> a simple transfer pipette. Reagents are either stable at room temperature or have been previously lyophilized to facilitate the deployment of the test. The equipment needed to perform the test is minimal and easy to carry into the field. A complete description of the protocol is available in <xref ref-type="supplementary-material" rid="DS1">Supplementary File 3</xref>.</p></caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="ffgc-05-1068135-g001.tif"/>
</fig>
<p>Just before use, each of the RPA and Cas12a lyophilized reactions tubes were rehydrated with water (approx. 48 &#x03BC;L, or 3 drops) using a 1.5 mL extended fine tip transfer pipette (Samco&#x2122; Fine Tip Transfer Pipettes, 231PK, Thermo Fisher Scientific, MA, USA). A small piece of mycelium mat was inserted in red microtubes containing the QuickExtract&#x2122; buffer, and samples were then incubated at 65&#x00B0;C for 6 min, followed by 98&#x00B0;C for 2 min in a portable mini16 Thermal cycler (miniPCR Bio, Cambridge, MA, USA). Using the same transfer pipette, the extracted DNA was diluted about 10-fold when transferred to the green microtubes. The entire content of the green microtubes was then used to rehydrate the RPA reaction pellets provided with the TwistAmp Basic Kit (TwistDx, Cambridge, UK). Samples were incubated at 37&#x00B0;C for 10 min without further inactivation. Part of the RPA reactions (approx. 8 &#x03BC;L) was then transferred to the blue microtubes. Samples were incubated at 37&#x00B0;C for 20 min, and fluorescence was visualized with the P51&#x2122; Molecular Fluorescence Viewer (miniPCR Bio, Cambridge, MA, USA). Each sample&#x2019;s fluorescence was compared to that of the negative control, which was run along the assay. The complete protocol for the on-site DETECTR assay is illustrated in <xref ref-type="fig" rid="F1">Figure 1</xref> and listed in (<xref ref-type="supplementary-material" rid="DS1">Supplementary File 3</xref>).</p>
</sec>
<sec id="S2.SS8">
<title>2.8 Human trial to validate the simplified DETECTR assay</title>
<p>To evaluate the level of difficulty in implementing the DETECTR on-site assay with non-laboratory end users, we organized a trial consisting of 22 volunteers with various backgrounds (from non-scientific to basic/advanced laboratory skills). Each participant was given a detailed version of the on-site protocol to read beforehand (<xref ref-type="supplementary-material" rid="DS1">Supplementary File 3</xref>), from DNA extraction to fluorescence read-out. A demonstration as well as clarifications were offered on the day of the trial. A total of 3 randomized samples (positive fungal mats or negative fungi) as well as a negative (no template) DNA control were given to each volunteer. Participants were told to use the on-site DETECTR assay to detect the presence of <italic>B. fagacearum</italic> in their samples. Various parameters were investigated, including time to completion and accuracy of results. Suggested improvements and recommendations from participants were also considered when designing the final written version of the simplified on-site protocol (<xref ref-type="supplementary-material" rid="DS1">Supplementary File 3</xref>).</p>
</sec>
<sec id="S2.SS9">
<title>2.9 Statistical analysis</title>
<p>Analysis was conducted using R (<xref ref-type="bibr" rid="B45">R Core Team, 2014</xref>), RStudio (<xref ref-type="bibr" rid="B46">R Studio Team, 2018</xref>). The standard curves, that represent the relationships between the outcome (Ct values) and the predictors (either ITS copies or the number of extracted conidia) were evaluated by simple regression using the <italic>lm</italic> function in the R statistical package.</p>
<p>Performance of the DETECTR assay was compared to the qPCR reference by constructing confusion matrices for each type of samples. The python package <italic>pycm</italic> (<xref ref-type="bibr" rid="B25">Haghighi et al., 2018</xref>) was used to generate the tables and calculate the accuracy. The statistical comparison was performed using the <italic>mcnemar</italic> function of the <italic>statsmodels</italic> package (<xref ref-type="bibr" rid="B49">Seabold and Perktold, 2010</xref>) with default parameters.</p>
</sec>
</sec>
<sec id="S3" sec-type="results">
<title>3 Results</title>
<sec id="S3.SS1">
<title>3.1 Design and validation of a new <italic>B. fagacearum</italic> gold standard qPCR TaqMan<sup>&#x00AE;</sup> assay</title>
<p>We first designed a new qPCR TaqMan<sup>&#x00AE;</sup> assay that could specifically detect <italic>B. fagacearum</italic> but also act as a reference for our new molecular DETECTR assay. Using closely related species listed in <xref ref-type="supplementary-material" rid="TS1">Supplementary Table 1</xref> (see section &#x201C;DNA from pure cultures&#x201D;), our data shows amplification only for <italic>B. fagacearum</italic> DNA. There was no amplification of any sister species isolates, making this new qPCR TaqMan<sup>&#x00AE;</sup> assay 100% specific in discriminating <italic>B. fagacearum</italic> among the other closely related species selected here. Of note, some very highly concentrated DNA samples from pure cultures had to be diluted first to be detectable, most probably due to the presence of inhibitors or a DNA concentration too high. Nonetheless, amplification results were proportional to the amount of DNA present in the samples.</p>
<p>We then assessed the sensitivity of the qPCR TaqMan<sup>&#x00AE;</sup> assay and calculated its LOD. First, we ran the assay in triplicates on serial dilutions of the gBlocks&#x2122; ITS gene fragments. The standard curve obtained by plotting the Ct values against the log value of the number of ITS copies shows a square correction coefficient (<italic>R</italic><sup>2</sup>) of 0.98 and a LOD of 2 ITS copies (<xref ref-type="fig" rid="F2">Figure 2A</xref>). The LOD was determined by re-running 20 times the last dilution that gave 3 positive detection results, giving a positive detection 18/20 runs. In all cases, Ct values were proportional to the amount of template DNA used for the qPCR reactions.</p>
<fig id="F2" position="float">
<label>FIGURE 2</label>
<caption><p>Sensitivity of the new qPCR TaqMan<sup>&#x00AE;</sup> detection test against <italic>B. fagacearum</italic> and comparison of DNA extraction methods. Ct values obtained from running the qPCR TaqMan<sup>&#x00AE;</sup> assay are plotted against the log value of the number of ITS copies (gBlocks&#x2122; gene fragment) and conidia. Equations and coefficients <italic>R</italic><sup>2</sup> are displayed on the graphs. <bold>(A)</bold> LOD of the newly designed qPCR TaqMan<sup>&#x00AE;</sup> assay on ITS copies (gBlocks&#x2122; gene fragment) is 2 ITS copies. <bold>(B)</bold> Comparison of the new qPCR TaqMan<sup>&#x00AE;</sup> detection test (black) and the old qPCR TaqMan<sup>&#x00AE;</sup> designed in the TEF region (gray) to detect <italic>B. fagacearum</italic> DNA extracted from various amount of conidia using the Lucigen (circle points) and QIAamp (triangle points) procedures.</p></caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="ffgc-05-1068135-g002.tif"/>
</fig>
</sec>
<sec id="S3.SS2">
<title>3.2 Comparison of DNA extraction methods using the qPCR TaqMan<sup>&#x00AE;</sup> assay and a previously designed assay</title>
<p>The assay was also run on two series of dilutions of conidia DNA extracted with the QIAamp and Lucigen DNA extraction kits. <xref ref-type="fig" rid="F2">Figure 2B</xref> shows the standard curves obtained, with <italic>R</italic><sup>2</sup> ranging from 0.93 to 0.95. The difference between the two DNA extraction methods is clearly showed by a 3.4 Ct shift upward with the Lucigen method, making it about 10 times less sensitive than the QIAamp method, but easier to deploy.</p>
<p>In parallel, another goal when designing the <italic>B. fagacearum</italic> ITS qPCR TaqMan<sup>&#x00AE;</sup> assay was to replace the previous qPCR detection assay that our laboratory had developed and published in 2015 (<xref ref-type="bibr" rid="B33">Lamarche et al., 2015</xref>), which, while being specific, lacked in sensitivity. The previous detection assay targeted the transcription elongation factor 1-a (TEF) gene instead of the ITS region. <xref ref-type="fig" rid="F2">Figure 2B</xref> shows a comparison between the two detection assays using the two DNA extraction methods above mentioned. As seen clearly on the graph, results confirm that our new <italic>B. fagacearum</italic> qPCR assay allowed us to gain a downshift of 6.6 Ct (with the QIAamp extraction), which corresponds to a 97-fold increase in sensitivity when run on conidia dilutions. This result was expected since TEF is a single copy gene, while the ITS is multi-copy. The increase in sensitivity suggests that the <italic>B. fagacearum</italic> genome possesses about 100 copies of the nuclear ribosomal DNA.</p>
</sec>
<sec id="S3.SS3">
<title>3.3 Design and validation of a new molecular DETECTR assay</title>
<p>The specificity of the DETECTR assay was evaluated with the same sister species isolates used with the qPCR TaqMan<sup>&#x00AE;</sup> assay (see &#x201C;DNA from pure cultures,&#x201D; <xref ref-type="supplementary-material" rid="TS1">Supplementary Table 1</xref>). This new molecular test is not meant to be quantitative and therefore only determines if a sample is &#x201C;positive&#x201D; or &#x201C;negative.&#x201D; As for our qPCR TaqMan<sup>&#x00AE;</sup> assay, the DETECTR test only gave a positive result for <italic>B. fagacearum</italic>, whereas every other closely related species came up negative following a fluorescence reading on a plate reader. The new DETECTR test is therefore 100% specific for <italic>B. fagacearum</italic> according to the panel of species tested.</p>
<p>To estimate the sensitivity of this non-quantitative test, we ran it on various <italic>B. fagacearum</italic> sample types that could be naturally found in the environment, for instance, fungal mats and insect vectors known to carry spores of the pathogen (see samples in <xref ref-type="supplementary-material" rid="TS1">Supplementary Table 1</xref>). We also investigated the conidia dilution set extracted with the Qiagen method, as well as DNA samples from pure cultures (<xref ref-type="supplementary-material" rid="TS1">Supplementary Table 1</xref>). <xref ref-type="fig" rid="F3">Figure 3</xref> represents a scatter plot graph comparing the sensitivities of the qPCR TaqMan<sup>&#x00AE;</sup> and DETECTR assays for all sample types combined. Results show that the DETECTR assay does not span the same detection range as that of the reference qPCR TaqMan<sup>&#x00AE;</sup> assay. As described by <xref ref-type="bibr" rid="B10">Bustin et al. (2009)</xref>, sensitivity refers to the minimum number of copies in a sample that can be measured accurately with an assay, and it is typically expressed as the LOD. While we didn&#x2019;t run the DETECTR assay on predefined amounts of copies as we did with the qPCR TaqMan<sup>&#x00AE;</sup> assay to determine the LOD, plotting all the data from this study as shown in <xref ref-type="fig" rid="F3">Figure 3</xref> suggests that the DETECTR test is roughly a 1000 times less sensitive than the qPCR TaqMan<sup>&#x00AE;</sup> assay. As described above, LOD is only dependant on the target copy number, which we were able to obtain for all types of samples. Sample type and DNA preparation will, however, impact the amount of target copies being present in a sample.</p>
<fig id="F3" position="float">
<label>FIGURE 3</label>
<caption><p>Comparison of the qPCR TaqMan<sup>&#x00AE;</sup> and DETECTR assays sensitivity when detecting various sample types. The scatter plot depicted here suggests that the lower detection limit of the DETECTR test is much higher than that of the qPCR TaqMan<sup>&#x00AE;</sup>.</p></caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="ffgc-05-1068135-g003.tif"/>
</fig>
<p>In order to further validate and compare our new DETECTR assay to the qPCR reference, we looked into their respective detection results of these samples. <xref ref-type="supplementary-material" rid="TS1">Supplementary Table 1</xref> shows results obtained with both tests for the same sample, and <xref ref-type="table" rid="T2">Table 2</xref> summarizes the outcome of the comparison using a confusion matrix. Results were exactly the same for both assays when investigating DNA from pure cultures and DNA from insect vectors, with positive and negative results matching perfectly, giving an accuracy of 1 in both circumstances. In a confusion table, the accuracy represents the number of all correct predictions divided by the total number of the dataset. Therefore, the best possible case is an accuracy of 1 and indeed shows here that DETECTR results for pure DNA cultures and insects thoroughly match the qPCR &#x201C;reference&#x201D; results. However, while the qPCR TaqMan<sup>&#x00AE;</sup> assay detected a positive signal for every mycelial mat tested, the DETECTR assay missed 5 of the late-stage samples, therefore giving 5 false-negative results. This slightly lowered the accuracy of the test to 0.84375, but with a negligible difference (McNemar&#x2019;s exact test, <italic>P</italic> = 0.0625). Those mats were also late-stage mats (stages 4A and 5), with the expectation that extracted DNA amount and quality would be lower than fresh mats. SYBR Green quantification of those samples indeed confirmed that very few ITS copies were present. Hence, the DETECTR test can still be considered as a reliable assay when applied to young and fresh mycelial mats.</p>
<table-wrap position="float" id="T2">
<label>TABLE 2</label>
<caption><p>Confusion matrix showing the comparison of both detection tests on various sample types.</p></caption>
<table cellspacing="5" cellpadding="5" frame="hsides" rules="groups">
<thead>
<tr>
<td valign="top" align="left">Sample type</td>
<td valign="top" align="center">Number of samples</td>
<td valign="top" align="center" colspan="4">Confusion matrix<hr/></td>
<td valign="top" align="center">Accuracy</td>
<td valign="top" align="center">McNemar&#x2019;s test <italic>P</italic>-Value</td>
</tr>
<tr>
<td/>
<td valign="top" align="center"/><td/>
<td valign="top" align="center"/><td valign="top" align="center" colspan="2">Reference qPCR<hr/></td>
<td/>
<td valign="top" align="center"/></tr>
<tr>
<td/>
<td valign="top" align="center"/><td/>
<td valign="top" align="center"/><td valign="top" align="center">0</td>
<td valign="top" align="center">1</td>
<td/>
<td valign="top" align="center"/></tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">DNA from pure cultures</td>
<td valign="top" align="center">62</td>
<td valign="top" align="center">Predicted DETECTR</td>
<td valign="top" align="center">0</td>
<td valign="top" align="center">30</td>
<td valign="top" align="center">0</td>
<td valign="top" align="center">1</td>
<td valign="top" align="center">1</td>
</tr>
<tr>
<td/>
<td valign="top" align="center"/><td/>
<td valign="top" align="center">1</td>
<td valign="top" align="center">0</td>
<td valign="top" align="center">32</td>
<td/>
<td valign="top" align="center"/></tr>
<tr>
<td valign="top" align="left">DNA from insect vectors</td>
<td valign="top" align="center">40</td>
<td valign="top" align="center">Predicted DETECTR</td>
<td valign="top" align="center">0</td>
<td valign="top" align="center">23</td>
<td valign="top" align="center">0</td>
<td valign="top" align="center">1</td>
<td valign="top" align="center">1</td>
</tr>
<tr>
<td/>
<td valign="top" align="center"/><td/>
<td valign="top" align="center">1</td>
<td valign="top" align="center">0</td>
<td valign="top" align="center">17</td>
<td/>
<td valign="top" align="center"/></tr>
<tr>
<td valign="top" align="left">Mycelial mat</td>
<td valign="top" align="center">32</td>
<td valign="top" align="center">Predicted DETECTR</td>
<td valign="top" align="center">0</td>
<td valign="top" align="center">0</td>
<td valign="top" align="center">5</td>
<td valign="top" align="center">&#x2004;&#x2004;0.84375</td>
<td valign="top" align="center">0.0625</td>
</tr>
<tr>
<td/>
<td valign="top" align="center"/><td/>
<td valign="top" align="center">1</td>
<td valign="top" align="center">0</td>
<td valign="top" align="center">27</td>
<td/>
<td valign="top" align="center"/></tr>
<tr>
<td valign="top" align="left">Beta participants</td>
<td valign="top" align="center">66</td>
<td valign="top" align="center">Predicted DETECTR</td>
<td valign="top" align="center">0</td>
<td valign="top" align="center">29</td>
<td valign="top" align="center">12</td>
<td valign="top" align="center">0.803</td>
<td valign="top" align="center">&#x2004;&#x2004;&#x2004;0.003418</td>
</tr>
<tr>
<td/>
<td valign="top" align="center"/><td/>
<td valign="top" align="center">1</td>
<td valign="top" align="center">1</td>
<td valign="top" align="center">24</td>
<td/>
<td valign="top" align="center"/></tr>
</tbody>
</table></table-wrap>
</sec>
<sec id="S3.SS4">
<title>3.4 Assessing how user friendly the on-site assay is and improving it using a panel of participants</title>
<p>In order to facilitate the deployment of the new DETECTR assay designed here, a few modifications were made to the original protocol, as described in section &#x201C;2.6 Performance of the DETECTR and TaqMan<sup>&#x00AE;</sup> qPCR assays on environmental samples.&#x201D; To ensure that every end user with any experience background could handle this novel on-site detection assay, we ran a trial combining 22 participants with or without previous laboratory experience. The average time to completion was 66.6 min, where people with a scientific background fared slightly better regarding the time taken to perform the test. Accuracy of results obtained by these beta participants compared to the qPCR TaqMan<sup>&#x00AE;</sup> results are shown in the bottom part of the confusion matrix (<xref ref-type="table" rid="T2">Table 2</xref>). The accuracy of the DETECTR assay was calculated at just above 80% when compared to the qPCR reference. However, a total of 12 false-negative and one false-positive results (cross contamination from a manipulation) were recorded, lowering the <italic>P</italic>-value of the McNemar test below 0.05.</p>
<p>The trial was also used to gather feedback from participants in order to make the on-site DETECTR test more user-friendly and easily deployable. Their suggestions and comments strongly shaped the final version of the protocol presented in (<xref ref-type="supplementary-material" rid="DS1">Supplementary File 3</xref>). The factors and challenges most commonly pointed out by the participants were the wording and nomenclature of the protocol (i.e., replace technical terms like &#x201C;microtube, resuspend, incubation,&#x201D; etc. with non-scientific terms) and the manipulation of the transfer pipette. All participants agreed that performing the protocol a second time would be much easier and that mistakes would most certainly be avoided then.</p>
</sec>
</sec>
<sec id="S4" sec-type="discussion">
<title>4 Discussion</title>
<p>In this study, we report a new field detection assay using DETECTR technology that can confirm the presence of <italic>B. fagacearum</italic> on-site within 1 h. We first developed and validated a traditional qPCR TaqMan<sup>&#x00AE;</sup> assay that could detect specifically <italic>B. fagacearum</italic> and act as a reference when testing the new assay. We then designed and optimized the new DETECTR assay and benchmarked it to our gold standard qPCR TaqMan<sup>&#x00AE;</sup> assay. In addition, we used a panel of participants from various scientific backgrounds to estimate the ease of deployment of the DETECTR test with different users.</p>
<p>We strongly believe that biosurveillance of invasive forest pests would benefit from on-site DNA testing capability, hence the need to develop deployable, quick and reliable detection tests. Unfortunately, rapid detection is currently hampered by the requirement to send samples to a laboratory for confirmation. With the continued spread of oak wilt in the USA and concern over its introduction into Canada, rapid, on-site detection of <italic>B. fagacearum</italic> is critical.</p>
<p>The qPCR TaqMan<sup>&#x00AE;</sup> assay developed here is specific to <italic>B. fagacearum</italic>, with no cross-amplification, and is more sensitive than our previously reported assay (<xref ref-type="bibr" rid="B33">Lamarche et al., 2015</xref>). Unlike the nested PCR reported by <xref ref-type="bibr" rid="B54">Yang and Juzwik (2017)</xref>, this assay is quantitative, allowing an estimation of the biomass load of the target species in given samples, and does not require a post amplification step to visualize the results. <xref ref-type="bibr" rid="B36">McLaughlin et al. (2022)</xref> recently published a very interesting study where Yang&#x2019;s double-nested PCR successfully detected the oak wilt fungus from insects trapped in various locations in New York State, US. However, as mentioned before, this method not only requires sorting the content of the traps beforehand, it also needs more time than our qPCR TaqMan<sup>&#x00AE;</sup> assay to obtain results. Nonetheless, while this test is highly sensitive and very accurate, it can either be performed in laboratory settings or deployed using expensive and fragile equipment.</p>
<p>The on-site DETECTR assay designed here could detect DNA purified from axenic cultures of <italic>B. fagacearum</italic> with the same specificity as the qPCR TaqMan<sup>&#x00AE;</sup> assay. We successfully validated the DETECTR assay on environmental samples of mycelial mats, both fresh and older ones, as well as insect vectors. Although the sensitivity of the DETECTR assay was not as good as that of the qPCR TaqMan<sup>&#x00AE;</sup> test for very old mycelium mats, we still believe it can act as a useful tool to deploy and screen apparent symptoms in the field. Indeed, the current best way to identify <italic>B. fagacearum</italic> on insects is a timely culture-based method requiring 2&#x2013;4 weeks before <italic>B. fagacearum</italic> can be confirmed. And while confirmation of <italic>B. fagacearum</italic> is straightforward from fresh mats (the only diagnostic sign), it can be difficult from older, decayed mats, also requiring laborious culture work and microscopy. Moreover, since mycelial mats develop once the tree has been killed from a <italic>B. fagacearum</italic> infection, earlier detection in still living plant tissues such as wood and wilted twigs would increase the usefulness of the test and reduce disease spread and tree loss. Work is already underway in our laboratory to assess this possibility.</p>
<p>Additionally, results from insect vectors and serial dilution of spores clearly showed a relationship between spore loads and detection results. We found that target pathogen DNA concentrations that are lower than 10<sup>E</sup>4 copies most often yield false negatives detection results when using the DETECTR assay. Efforts to increase the quantity and quality of the DNA extracted might help circumvent this limitation. However, most protocols are lengthy, requiring more time than the Lucigen extraction method used here, and necessitate bulky laboratory equipment, such as a vortex or a centrifuge, which cannot be easily deployed out in the field. A recent study showed that <italic>B. fagacearum</italic> DNA could be detected from oak wilt infected wood chips using a simple alkaline DNA extraction procedure (<xref ref-type="bibr" rid="B37">Moore et al., 2022</xref>). The compatibility of other simple and deployable protocols reported for the DNA extraction of pathogens from symptomatic plants (<xref ref-type="bibr" rid="B11">Capron et al., 2020</xref>; <xref ref-type="bibr" rid="B42">Paul et al., 2020</xref>) with the DETECTR approach developed here is also being tested in our laboratory.</p>
<p>To facilitate the ease and speed of use and reduce costs of the DETECTR test, we simplified the whole process by using color-coded tubes, dehydrated pre-packed reagents, and disposable transfer pipets along with an affordable battery-powered heating block and a simple blue light box (see <xref ref-type="supplementary-material" rid="DS1">Supplementary File 3</xref>). The resulting kit is easily usable in any environment harboring a small flat surface to work on.</p>
<p>The panel of beta participants that had never performed this assay before, the majority of whom lacked laboratory experience, were able to use the kits and correctly identify 80% of samples as either a positive <italic>B. fagacearum</italic> target specimen or as a negative non-target specimen. These results suggest that by providing minimal training to phytosanitary inspectors, they could achieve very accurate on-site detection of the oak wilt pathogen. Previous investigators streamlined detection assays for on-site detection by end users (<xref ref-type="bibr" rid="B11">Capron et al., 2020</xref>). However, this study is one of the rare examples where the accuracy of a test is determined with a panel of untrained and inexperienced participants. We found that comments received from the panel improved the assay and the related protocol, mostly by simplifying the wording for non-scientific people and adding a few extra explanations.</p>
<p>Streamlining the assay by reducing the number of steps required would further facilitate the ease of use and time taken, but also potentially increase accuracy (less steps leading to fewer mistakes). Currently, the RPA amplification and Cas12a cleavage of the fluorescent ssDNA probe are being carried sequentially in two different tubes. However, recent publications have successfully combined the reagents of these two reactions into a single tube and performed the two reactions simultaneously (<xref ref-type="bibr" rid="B17">Chen et al., 2020</xref>; <xref ref-type="bibr" rid="B18">de Puig et al., 2021</xref>). We tested a one-step reaction with pure DNA according to <xref ref-type="bibr" rid="B17">Chen et al. (2020)</xref> protocol. In this preliminary work, the fluorescent signal was very weak and required an increased amount of DNA template as well as longer incubation times, which makes this method less suitable for a rapid on-site detection at this time (data not shown).</p>
<p>One major benefit of the DETECTR based detection is the ability to easily design assay components. In fact, in the present paper, primer F1, used for the RPA, consisted of a longer version of the primer used in the TaqMan<sup>&#x00AE;</sup> assay (primer extended of a few bases in 5&#x2032;), primer <italic>R</italic>2 was the same for both assays, and the gRNA was straightforwardly designed based on PAM site within the amplified region. Therefore, we believe that relatively little effort would be required to implement DETECTR assays from available TaqMan<sup>&#x00AE;</sup> assays containing discriminatory nucleotides. This is especially true if primers contain target specific SNPs, and the sequence amplified contains PAM sites with target specific polymorphisms in the 3&#x2032; end of the crRNA. On the other hand, and unlike TaqMan<sup>&#x00AE;</sup> technology, multiplexing multiple assays into one reaction tube is not possible due to the unspecific ssDNA <italic>trans-</italic>nuclease activity of the RNP complex upon binding to the target crRNA site.</p>
<p>In conclusion, we report in this study the development and validation of a new DETECTR assay detecting the presence of <italic>B. fagacearum</italic> in mycelial mats and insect vectors, both common environmental sample types. This reliable and cost-effective test has been optimized to be rapidly deployed on-site. We expect that training front line people such as wood industry workers and phytosanitary inspectors on how to use the DETECTR assay in the field will help prevent the establishment of oak wilt in Canada and reduce its spread in the USA. The qPCR TaqMan<sup>&#x00AE;</sup> assay designed in parallel is reliable, has a high sensitivity and can confidently be used to confirm results in a laboratory setting.</p>
</sec>
<sec id="S5" sec-type="data-availability">
<title>Data availability statement</title>
<p>The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/<xref ref-type="supplementary-material" rid="DS1">Supplementary material</xref>.</p>
</sec>
<sec id="S6" sec-type="author-contributions">
<title>Author contributions</title>
<p>PT, M-KG, and &#x00C9;B designed the study. DS performed the bioinformatics analyses. AP, &#x00C9;B, and M-KG performed the lab experiments. KC collected the field material. PT and &#x00C9;B conducted the statistical analyses. M-KG and PT drafted the initial manuscript with contributions from &#x00C9;B, AP, KC, and MS. All authors contributed to the article and approved the submitted version.</p>
</sec>
</body>
<back>
<sec id="S7" sec-type="funding-information">
<title>Funding</title>
<p>Findings for this project were received through the Natural Resources Canada Expanding Market Opportunities and Pest Risk Management programs. KC was funded through the Michigan Invasive Species Grant Program, Michigan State University Project GREEEN and Forrest Strong endowments. Both KC and MS were supported by HATCH project MICL02505 from the USDA National Institute of Food and Agriculture.</p>
</sec>
<ack><p>We would like to thank all 22 participants of the trial conducted to optimize the on-site DETECTR protocol.</p>
</ack>
<sec id="S8" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="S9" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="S10" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/ffgc.2022.1068135/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/ffgc.2022.1068135/full#supplementary-material</ext-link></p>
<supplementary-material xlink:href="Data_Sheet_1.PDF" id="DS1" mimetype="application/pdf" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table_1.DOCX" id="TS1" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table_2.DOCX" id="TS2" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document" xmlns:xlink="http://www.w3.org/1999/xlink"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Ahmed</surname> <given-names>A.</given-names></name> <name><surname>Linden van der</surname> <given-names>H.</given-names></name> <name><surname>Hartskeerl</surname> <given-names>R. A.</given-names></name></person-group> (<year>2014</year>). <article-title>Development of a recombinase polymerase amplification assay for the detection of pathogenic leptospira.</article-title> <source><italic>Int. J. Environ. Res.</italic></source> <volume>11</volume> <fpage>4953</fpage>&#x2013;<lpage>4964</lpage>. <pub-id pub-id-type="doi">10.3390/ijerph110504953</pub-id> <pub-id pub-id-type="pmid">24814943</pub-id></citation></ref>
<ref id="B2"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Ahmed</surname> <given-names>S. A.</given-names></name> <name><surname>Sande</surname> <given-names>W. W. J.</given-names></name> <name><surname>van de, Desnos-Ollivier</surname> <given-names>M.</given-names></name> <name><surname>Fahal</surname> <given-names>A. H.</given-names></name> <name><surname>Mhmoud</surname> <given-names>N. A.</given-names></name><etal/></person-group> (<year>2015</year>). <article-title>Application of isothermal amplification techniques for identification of madurella mycetomatis, the prevalent agent of human mycetoma.</article-title> <source><italic>J. Clin. Microbiol.</italic></source> <volume>53</volume> <fpage>3280</fpage>&#x2013;<lpage>3285</lpage>. <pub-id pub-id-type="doi">10.1128/jcm.01544-15</pub-id> <pub-id pub-id-type="pmid">26246484</pub-id></citation></ref>
<ref id="B3"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Arora</surname> <given-names>R.</given-names></name> <name><surname>Gupta</surname> <given-names>K.</given-names></name> <name><surname>Vijaykumar</surname> <given-names>A.</given-names></name> <name><surname>Krishna</surname> <given-names>S.</given-names></name></person-group> (<year>2020</year>). <article-title>DETECTing merkel cell polyomavirus in merkel tumors.</article-title> <source><italic>Front. Mol. Biosci.</italic></source> <volume>7</volume>:<issue>10</issue>. <pub-id pub-id-type="doi">10.3389/fmolb.2020.00010</pub-id> <pub-id pub-id-type="pmid">32118036</pub-id></citation></ref>
<ref id="B4"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Beer</surname> <given-names>Z. W.</given-names></name> <name><surname>de, Marincowitz</surname> <given-names>S.</given-names></name> <name><surname>Duong</surname> <given-names>T. A.</given-names></name> <name><surname>Wingfield</surname> <given-names>M. J.</given-names></name></person-group> (<year>2017</year>). <article-title><italic>Bretziella</italic>, a new genus to accommodate the oak wilt fungus, <italic>Ceratocystis fagacearum</italic> (Microascales, Ascomycota).</article-title> <source><italic>Mycokeys</italic></source> <volume>27</volume> <fpage>1</fpage>&#x2013;<lpage>19</lpage>. <pub-id pub-id-type="doi">10.3897/mycokeys.27.20657</pub-id></citation></ref>
<ref id="B5"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Bergeron</surname> <given-names>M.-J.</given-names></name> <name><surname>Feau</surname> <given-names>N.</given-names></name> <name><surname>Stewart</surname> <given-names>D.</given-names></name> <name><surname>Tanguay</surname> <given-names>P.</given-names></name> <name><surname>Hamelin</surname> <given-names>R. C.</given-names></name></person-group> (<year>2019</year>). <article-title>Genome-enhanced detection and identification of fungal pathogens responsible for pine and poplar rust diseases.</article-title> <source><italic>PLoS One</italic></source> <volume>14</volume>:<issue>e210952</issue>. <pub-id pub-id-type="doi">10.1371/journal.pone.0210952</pub-id> <pub-id pub-id-type="pmid">30726264</pub-id></citation></ref>
<ref id="B6"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Boyle</surname> <given-names>D. S.</given-names></name> <name><surname>Lehman</surname> <given-names>D. A.</given-names></name> <name><surname>Lillis</surname> <given-names>L.</given-names></name> <name><surname>Peterson</surname> <given-names>D.</given-names></name> <name><surname>Singhal</surname> <given-names>M.</given-names></name> <name><surname>Armes</surname> <given-names>N.</given-names></name><etal/></person-group> (<year>2013</year>). <article-title>Rapid detection of HIV-1 Proviral DNA for early infant diagnosis using recombinase polymerase amplification.</article-title> <source><italic>mBio</italic></source> <volume>4</volume> <fpage>e135</fpage>&#x2013;<lpage>e113</lpage>. <pub-id pub-id-type="doi">10.1128/mbio.00135-13</pub-id> <pub-id pub-id-type="pmid">23549916</pub-id></citation></ref>
<ref id="B7"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Bretz</surname> <given-names>T. W.</given-names></name></person-group> (<year>1953</year>). <article-title>Oak wilt, a new threat.</article-title> <source><italic>Yearb. Agric.</italic></source> <volume>1953</volume> <fpage>851</fpage>&#x2013;<lpage>855</lpage>.</citation></ref>
<ref id="B8"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Broughton</surname> <given-names>J. P.</given-names></name> <name><surname>Deng</surname> <given-names>X.</given-names></name> <name><surname>Yu</surname> <given-names>G.</given-names></name> <name><surname>Fasching</surname> <given-names>C. L.</given-names></name> <name><surname>Servellita</surname> <given-names>V.</given-names></name> <name><surname>Singh</surname> <given-names>J.</given-names></name><etal/></person-group> (<year>2020</year>). <article-title>CRISPR&#x2013;Cas12-based detection of SARS-CoV-2.</article-title> <source><italic>Nat. Biotechnol.</italic></source> <volume>38</volume> <fpage>870</fpage>&#x2013;<lpage>874</lpage>. <pub-id pub-id-type="doi">10.1038/s41587-020-0513-4</pub-id> <pub-id pub-id-type="pmid">32300245</pub-id></citation></ref>
<ref id="B9"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Brown</surname> <given-names>A. T.</given-names></name> <name><surname>McAloose</surname> <given-names>D.</given-names></name> <name><surname>Calle</surname> <given-names>P. P.</given-names></name> <name><surname>Auer</surname> <given-names>A.</given-names></name> <name><surname>Posautz</surname> <given-names>A.</given-names></name> <name><surname>Slavinski</surname> <given-names>S.</given-names></name><etal/></person-group> (<year>2020</year>). <article-title>Development and validation of a portable, point-of-care canine distemper virus qPCR test.</article-title> <source><italic>PLoS One</italic></source> <volume>15</volume>:<issue>e0232044</issue>. <pub-id pub-id-type="doi">10.1371/journal.pone.0232044</pub-id> <pub-id pub-id-type="pmid">32320441</pub-id></citation></ref>
<ref id="B10"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Bustin</surname> <given-names>S. A.</given-names></name> <name><surname>Benes</surname> <given-names>V.</given-names></name> <name><surname>Garson</surname> <given-names>J. A.</given-names></name> <name><surname>Hellemans</surname> <given-names>J.</given-names></name> <name><surname>Huggett</surname> <given-names>J.</given-names></name> <name><surname>Kubista</surname> <given-names>M.</given-names></name><etal/></person-group> (<year>2009</year>). <article-title>The MIQE guidelines: Minimum information for publication of quantitative Real-Time PCR experiments.</article-title> <source><italic>Clin. Chem.</italic></source> <volume>55</volume> <fpage>611</fpage>&#x2013;<lpage>622</lpage>. <pub-id pub-id-type="doi">10.1373/clinchem.2008.112797</pub-id> <pub-id pub-id-type="pmid">19246619</pub-id></citation></ref>
<ref id="B11"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Capron</surname> <given-names>A.</given-names></name> <name><surname>Stewart</surname> <given-names>D.</given-names></name> <name><surname>Hrywkiw</surname> <given-names>K.</given-names></name> <name><surname>Allen</surname> <given-names>K.</given-names></name> <name><surname>Feau</surname> <given-names>N.</given-names></name> <name><surname>Bilodeau</surname> <given-names>G.</given-names></name><etal/></person-group> (<year>2020</year>). <article-title>In situ processing and efficient environmental detection (iSPEED) of tree pests and pathogens using point-of-use real-time PCR.</article-title> <source><italic>PLoS One</italic></source> <volume>15</volume>:<issue>e0226863</issue>. <pub-id pub-id-type="doi">10.1371/journal.pone.0226863</pub-id> <pub-id pub-id-type="pmid">32240194</pub-id></citation></ref>
<ref id="B12"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Cease</surname> <given-names>K. R.</given-names></name> <name><surname>Juzwik</surname> <given-names>J.</given-names></name></person-group> (<year>2001</year>). <article-title>Predominant nitidulid species (Coleoptera: Nitidulidae) associated with spring oak wilt mats in Minnesota.</article-title> <source><italic>Can. J. For. Res.</italic></source> <volume>31</volume> <fpage>635</fpage>&#x2013;<lpage>643</lpage>. <pub-id pub-id-type="doi">10.1139/x00-201</pub-id></citation></ref>
<ref id="B13"><citation citation-type="journal"><collab>CFIA</collab> (<year>2020</year>). <source><italic>D-99-03: Phytosanitary import requirements to prevent the entry of oak wilt disease (Bretziella fagacearum (Bretz) Hunt) from the Continental United States.</italic></source> Available online at: <ext-link ext-link-type="uri" xlink:href="https://inspection.canada.ca/plant-health/invasive-species/directives/forest-products/d-99-03/eng/1323852753311/1323852875523">https://inspection.canada.ca/plant-health/invasive-species/directives/forest-products/d-99-03/eng/1323852753311/1323852875523</ext-link> <comment>(accessed April 11, 2022)</comment>.</citation></ref>
<ref id="B14"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Chahal</surname> <given-names>K.</given-names></name> <name><surname>Morris</surname> <given-names>O. R.</given-names></name> <name><surname>McCullough</surname> <given-names>D. G.</given-names></name> <name><surname>Cregg</surname> <given-names>B.</given-names></name> <name><surname>Sakalidis</surname> <given-names>M. L.</given-names></name></person-group> (<year>2021</year>). <article-title>Sporulation timing of the invasive oak wilt fungus, <italic>Bretziella fagacearum</italic> in Michigan, (Abstr.).</article-title> <source><italic>Phytopathology</italic></source> <volume>111</volume>:<fpage>S2.51.</fpage> <pub-id pub-id-type="doi">10.1094/PHYTO111-10-S2.1</pub-id></citation></ref>
<ref id="B15"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Chahal</surname> <given-names>K.</given-names></name> <name><surname>Morris</surname> <given-names>O.</given-names></name> <name><surname>McCullough</surname> <given-names>D. G.</given-names></name> <name><surname>Sakalidis</surname> <given-names>M. L.</given-names></name></person-group> (<year>2019</year>). <article-title>Biology, epidemiology and detection of oak wilt in Michigan. (Abstr)</article-title>. <source><italic>Phytopathology</italic></source> <volume>109</volume>:<fpage>S2.33.</fpage> <pub-id pub-id-type="doi">10.1094/PHYTO-109-10-S2.1</pub-id> <pub-id pub-id-type="pmid">31634045</pub-id></citation></ref>
<ref id="B16"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Chen</surname> <given-names>J. S.</given-names></name> <name><surname>Ma</surname> <given-names>E.</given-names></name> <name><surname>Harrington</surname> <given-names>L. B.</given-names></name> <name><surname>Costa</surname> <given-names>M. D.</given-names></name> <name><surname>Tian</surname> <given-names>X.</given-names></name> <name><surname>Palefsky</surname> <given-names>J. M.</given-names></name><etal/></person-group> (<year>2018</year>). <article-title>CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity.</article-title> <source><italic>Science</italic></source> <volume>360</volume> <fpage>436</fpage>&#x2013;<lpage>439</lpage>. <pub-id pub-id-type="doi">10.1126/science.aar6245</pub-id> <pub-id pub-id-type="pmid">29449511</pub-id></citation></ref>
<ref id="B17"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Chen</surname> <given-names>Y.</given-names></name> <name><surname>Mei</surname> <given-names>Y.</given-names></name> <name><surname>Zhao</surname> <given-names>X.</given-names></name> <name><surname>Jiang</surname> <given-names>X.</given-names></name></person-group> (<year>2020</year>). <article-title>Reagents-loaded, automated assay that integrates recombinase-aided amplification and Cas12a nucleic acid detection for a point-of-care test.</article-title> <source><italic>Anal. Chem.</italic></source> <volume>92</volume> <fpage>14846</fpage>&#x2013;<lpage>14852</lpage>. <pub-id pub-id-type="doi">10.1021/acs.analchem.0c03883</pub-id> <pub-id pub-id-type="pmid">33064442</pub-id></citation></ref>
<ref id="B18"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>de Puig</surname> <given-names>H., A.</given-names></name> <name><surname>Lee</surname> <given-names>R.</given-names></name> <name><surname>Najjar</surname> <given-names>D.</given-names></name> <name><surname>Tan</surname> <given-names>X.</given-names></name> <name><surname>Soeknsen</surname> <given-names>L.</given-names></name> <name><surname>Angenent-Mari</surname> <given-names>N.</given-names></name><etal/></person-group> (<year>2021</year>). <article-title>Minimally instrumented SHERLOCK (miSHERLOCK) for CRISPR-based point-of-care diagnosis of SARS-CoV-2 and emerging variants.</article-title> <source><italic>Sci. Adv.</italic></source> <volume>7</volume>:<issue>eabh2944</issue>. <pub-id pub-id-type="doi">10.1126/sciadv.abh2944</pub-id> <pub-id pub-id-type="pmid">34362739</pub-id></citation></ref>
<ref id="B19"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Ding</surname> <given-names>X.</given-names></name> <name><surname>Yin</surname> <given-names>K.</given-names></name> <name><surname>Li</surname> <given-names>Z.</given-names></name> <name><surname>Lalla</surname> <given-names>R. V.</given-names></name> <name><surname>Ballesteros</surname> <given-names>E.</given-names></name> <name><surname>Sfeir</surname> <given-names>M. M.</given-names></name><etal/></person-group> (<year>2020</year>). <article-title>Ultrasensitive and visual detection of SARS-CoV-2 using all-in-one dual CRISPR-Cas12a assay.</article-title> <source><italic>Nat. Commun.</italic></source> <volume>11</volume>:<issue>4711</issue>. <pub-id pub-id-type="doi">10.1038/s41467-020-18575-6</pub-id> <pub-id pub-id-type="pmid">32948757</pub-id></citation></ref>
<ref id="B20"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>EFSA</surname> <given-names>P.</given-names></name> <name><surname>On</surname> <given-names>P. H.</given-names></name> <name><surname>Bragard</surname> <given-names>C.</given-names></name> <name><surname>Dehnen-Schmutz</surname> <given-names>K.</given-names></name> <name><surname>Serio</surname> <given-names>F. D.</given-names></name> <name><surname>Jacques</surname> <given-names>M.</given-names></name><etal/></person-group> (<year>2020</year>). <article-title>Commodity risk assessment of oak logs with bark from the US for the oak wilt pathogen <italic>Bretziella fagacearum</italic> under an integrated systems approach.</article-title> <source><italic>EFSA J.</italic></source> <volume>18</volume>:<issue>e06352</issue>. <pub-id pub-id-type="doi">10.2903/j.efsa.2020.6352</pub-id> <pub-id pub-id-type="pmid">33363644</pub-id></citation></ref>
<ref id="B21"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Euler</surname> <given-names>M.</given-names></name> <name><surname>Wang</surname> <given-names>Y.</given-names></name> <name><surname>Nentwich</surname> <given-names>O.</given-names></name> <name><surname>Piepenburg</surname> <given-names>O.</given-names></name> <name><surname>Hufert</surname> <given-names>F. T.</given-names></name> <name><surname>Weidmann</surname> <given-names>M.</given-names></name></person-group> (<year>2012a</year>). <article-title>Recombinase polymerase amplification assay for rapid detection of rift valley fever virus.</article-title> <source><italic>J. Clin. Virol.</italic></source> <volume>54</volume> <fpage>308</fpage>&#x2013;<lpage>312</lpage>. <pub-id pub-id-type="doi">10.1016/j.jcv.2012.05.006</pub-id> <pub-id pub-id-type="pmid">22683006</pub-id></citation></ref>
<ref id="B22"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Euler</surname> <given-names>M.</given-names></name> <name><surname>Wang</surname> <given-names>Y.</given-names></name> <name><surname>Otto</surname> <given-names>P.</given-names></name> <name><surname>Tomaso</surname> <given-names>H.</given-names></name> <name><surname>Escudero</surname> <given-names>R.</given-names></name> <name><surname>Anda</surname> <given-names>P.</given-names></name><etal/></person-group> (<year>2012b</year>). <article-title>Recombinase polymerase amplification assay for rapid detection of <italic>Francisella tularensis</italic>.</article-title> <source><italic>J. Clin. Microbiol.</italic></source> <volume>50</volume> <fpage>2234</fpage>&#x2013;<lpage>2238</lpage>. <pub-id pub-id-type="doi">10.1128/jcm.06504-11</pub-id> <pub-id pub-id-type="pmid">22518861</pub-id></citation></ref>
<ref id="B23"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>French</surname> <given-names>D. W.</given-names></name> <name><surname>Stienstra</surname> <given-names>W. C.</given-names></name></person-group> (<year>1980</year>). <source><italic>Oak wilt.</italic></source> <publisher-loc>Minneapolis, MN</publisher-loc>: <publisher-name>University of Minnesota</publisher-name>.</citation></ref>
<ref id="B24"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Gibbs</surname> <given-names>J. N.</given-names></name> <name><surname>French</surname> <given-names>D. W.</given-names></name></person-group> (<year>1980</year>). <source><italic>The transmission of oak wilt.</italic></source> <publisher-loc>St Paul, MN</publisher-loc>: <publisher-name>U.S. Department of Agriculture</publisher-name>.</citation></ref>
<ref id="B25"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Haghighi</surname> <given-names>S.</given-names></name> <name><surname>Jasemi</surname> <given-names>M.</given-names></name> <name><surname>Hessabi</surname> <given-names>S.</given-names></name> <name><surname>Zolanvari</surname> <given-names>A.</given-names></name></person-group> (<year>2018</year>). <article-title>PyCM: Multiclass confusion matrix library in Python.</article-title> <source><italic>J. Open Source Softw.</italic></source> <volume>3</volume>:<issue>729</issue>. <pub-id pub-id-type="doi">10.21105/joss.00729</pub-id></citation></ref>
<ref id="B26"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Heid</surname> <given-names>C. A.</given-names></name> <name><surname>Stevens</surname> <given-names>J.</given-names></name> <name><surname>Livak</surname> <given-names>K. J.</given-names></name> <name><surname>Williams</surname> <given-names>P. M.</given-names></name></person-group> (<year>1996</year>). <article-title>Real time quantitative PCR.</article-title> <source><italic>Genome Res.</italic></source> <volume>6</volume> <fpage>986</fpage>&#x2013;<lpage>994</lpage>. <pub-id pub-id-type="doi">10.1101/gr.6.10.986</pub-id> <pub-id pub-id-type="pmid">8908518</pub-id></citation></ref>
<ref id="B27"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Henry</surname> <given-names>B. W.</given-names></name></person-group> (<year>1944</year>). <article-title><italic>Chalara quercina</italic> n. sp., the cause of oak wilt.</article-title> <source><italic>Phytopathology</italic></source> <volume>34</volume> <fpage>631</fpage>&#x2013;<lpage>635</lpage>.</citation></ref>
<ref id="B28"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Jensen-Tracy</surname> <given-names>S.</given-names></name> <name><surname>Kenaley</surname> <given-names>S.</given-names></name> <name><surname>Hudler</surname> <given-names>G.</given-names></name> <name><surname>Harrington</surname> <given-names>T.</given-names></name> <name><surname>Logue</surname> <given-names>C.</given-names></name></person-group> (<year>2009</year>). <article-title>First report of the oak wilt fungus, ceratocystis fagacearum, in New York state</article-title>. <source><italic>Plant Dis</italic></source>. <volume>93</volume>, <fpage>428</fpage>&#x2013;<lpage>428</lpage>. <pub-id pub-id-type="doi">10.1094/pdis-93-4-0428b</pub-id> <pub-id pub-id-type="pmid">30764247</pub-id></citation></ref>
<ref id="B29"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Juzwik</surname> <given-names>J.</given-names></name> <name><surname>Harrington</surname> <given-names>T. C.</given-names></name> <name><surname>MacDonald</surname> <given-names>W. L.</given-names></name> <name><surname>Appel</surname> <given-names>D. N.</given-names></name></person-group> (<year>2008</year>). <article-title>The Origin of <italic>Ceratocystis fagacearum</italic>, the Oak wilt fungus.</article-title> <source><italic>Annu. Rev. Phytopathol.</italic></source> <volume>46</volume> <fpage>13</fpage>&#x2013;<lpage>26</lpage>. <pub-id pub-id-type="doi">10.1146/annurev.phyto.45.062806.094406</pub-id> <pub-id pub-id-type="pmid">18680421</pub-id></citation></ref>
<ref id="B30"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Karakkat</surname> <given-names>B. B.</given-names></name> <name><surname>Hockemeyer</surname> <given-names>K.</given-names></name> <name><surname>Franchett</surname> <given-names>M.</given-names></name> <name><surname>Olson</surname> <given-names>M.</given-names></name> <name><surname>Mullenberg</surname> <given-names>C.</given-names></name> <name><surname>Koch</surname> <given-names>P. L.</given-names></name></person-group> (<year>2018</year>). <article-title>Detection of root-infecting fungi on cool-season turfgrasses using loop-mediated isothermal amplification and recombinase polymerase amplification.</article-title> <source><italic>J. Microbiol. Meth.</italic></source> <volume>151</volume> <fpage>90</fpage>&#x2013;<lpage>98</lpage>. <pub-id pub-id-type="doi">10.1016/j.mimet.2018.06.011</pub-id> <pub-id pub-id-type="pmid">29964073</pub-id></citation></ref>
<ref id="B31"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Koch</surname> <given-names>K. A.</given-names></name> <name><surname>Quiram</surname> <given-names>G. L.</given-names></name> <name><surname>Venette</surname> <given-names>R. C.</given-names></name></person-group> (<year>2010</year>). <article-title>A review of oak wilt management: A summary of treatment options and their efficacy.</article-title> <source><italic>Urban For. Urban Green.</italic></source> <volume>9</volume> <fpage>1</fpage>&#x2013;<lpage>8</lpage>. <pub-id pub-id-type="doi">10.1016/j.ufug.2009.11.004</pub-id></citation></ref>
<ref id="B32"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Lacoursi&#x00E8;re</surname> <given-names>E.</given-names></name></person-group> (<year>2015</year>). <source><italic>Oak, the Canadian encyclopedia.</italic></source> Available online at: <ext-link ext-link-type="uri" xlink:href="https://www.thecanadianencyclopedia.ca/en/article/oak">https://www.thecanadianencyclopedia.ca/en/article/oak</ext-link> <comment>(accessed June 15, 2022)</comment>.</citation></ref>
<ref id="B33"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Lamarche</surname> <given-names>J.</given-names></name> <name><surname>Potvin</surname> <given-names>A.</given-names></name> <name><surname>Pelletier</surname> <given-names>G.</given-names></name> <name><surname>Stewart</surname> <given-names>D.</given-names></name> <name><surname>Feau</surname> <given-names>N.</given-names></name> <name><surname>Alayon</surname> <given-names>D. I. O.</given-names></name><etal/></person-group> (<year>2015</year>). <article-title>Molecular detection of 10 of the most unwanted alien forest pathogens in Canada using real-time PCR.</article-title> <source><italic>PLoS One</italic></source> <volume>10</volume>:<issue>e0134265</issue>. <pub-id pub-id-type="doi">10.1371/journal.pone.0134265</pub-id> <pub-id pub-id-type="pmid">26274489</pub-id></citation></ref>
<ref id="B34"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Lucia</surname> <given-names>C.</given-names></name> <name><surname>Federico</surname> <given-names>P.-B.</given-names></name> <name><surname>Alejandra</surname> <given-names>G. C.</given-names></name></person-group> (<year>2020</year>). <article-title>An ultrasensitive, rapid, and portable coronavirus SARS-CoV-2 sequence detection method based on CRISPR-Cas12.</article-title> <source><italic>bioRxiv</italic></source> [<comment>Preprint</comment>]. <pub-id pub-id-type="doi">10.1101/2020.02.29.971127</pub-id></citation></ref>
<ref id="B35"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Luo</surname> <given-names>M.</given-names></name> <name><surname>Meng</surname> <given-names>F.-Z.</given-names></name> <name><surname>Tan</surname> <given-names>Q.</given-names></name> <name><surname>Yin</surname> <given-names>W.-X.</given-names></name> <name><surname>Luo</surname> <given-names>C.-X.</given-names></name></person-group> (<year>2021</year>). <article-title>Recombinase polymerase amplification/Cas12a-Based Identification of <italic>Xanthomonas arboricola</italic> pv. pruni on peach.</article-title> <source><italic>Front. Plant Sci.</italic></source> <volume>12</volume>:<issue>740177</issue>. <pub-id pub-id-type="doi">10.3389/fpls.2021.740177</pub-id> <pub-id pub-id-type="pmid">34887884</pub-id></citation></ref>
<ref id="B36"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>McLaughlin</surname> <given-names>K.</given-names></name> <name><surname>Snover-Clift</surname> <given-names>K.</given-names></name> <name><surname>Somers</surname> <given-names>L.</given-names></name> <name><surname>Cancelliere</surname> <given-names>J.</given-names></name> <name><surname>Cole</surname> <given-names>R.</given-names></name></person-group> (<year>2022</year>). <article-title>Early detection of the oak wilt fungus (<italic>Bretziella fagacearum</italic>) using trapped nitidulid beetle vectors.</article-title> <source><italic>For. Pathol.</italic></source> <volume>52</volume>. <pub-id pub-id-type="doi">10.1111/efp.12767</pub-id></citation></ref>
<ref id="B37"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Moore</surname> <given-names>M. J.</given-names></name> <name><surname>Juzwik</surname> <given-names>J.</given-names></name> <name><surname>Saiapina</surname> <given-names>O.</given-names></name> <name><surname>Ahmed</surname> <given-names>S.</given-names></name> <name><surname>Yang</surname> <given-names>A.</given-names></name> <name><surname>Abbas</surname> <given-names>A.</given-names></name></person-group> (<year>2022</year>). <article-title>Use of sodium hydroxide DNA extraction methods for nested PCR detection of <italic>Bretziella fagacearum</italic> in the sapwood of Oak Species in Minnesota.</article-title> <source><italic>Plant Health Prog.</italic></source> <volume>23</volume> <fpage>132</fpage>&#x2013;<lpage>139</lpage>. <pub-id pub-id-type="doi">10.1094/php-03-21-0057-rs</pub-id></citation></ref>
<ref id="B38"><citation citation-type="journal"><collab>Natural Resources Canada [NRCAN]</collab> (<year>2015</year>). <source><italic>Red oak.</italic></source> Available online at: <ext-link ext-link-type="uri" xlink:href="https://tidcf.nrcan.gc.ca/en/trees/factsheet/66">https://tidcf.nrcan.gc.ca/en/trees/factsheet/66</ext-link> <comment>(accessed July 21, 2022)</comment>.</citation></ref>
<ref id="B39"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>O&#x2019;Brien</surname> <given-names>J.</given-names></name> <name><surname>Mielke</surname> <given-names>M.</given-names></name> <name><surname>Starkey</surname> <given-names>D.</given-names></name> <name><surname>Juzwik</surname> <given-names>J.</given-names></name></person-group> (<year>2000</year>). <source><italic>How to identify, prevent and control oak wilt.</italic></source> <publisher-loc>St-Paul, MN</publisher-loc>: <publisher-name>USDA Forest Service</publisher-name>.</citation></ref>
<ref id="B40"><citation citation-type="journal"><collab>OWTAC</collab> (<year>2019</year>). <source><italic>Oak wilt response framework for Canada.</italic></source> Available online at: <ext-link ext-link-type="uri" xlink:href="https://inspection.canada.ca/plant-health/invasive-species/plant-diseases/oak-wilt/response-framework/eng/1563898431188/1563898479048">https://inspection.canada.ca/plant-health/invasive-species/plant-diseases/oak-wilt/response-framework/eng/1563898431188/1563898479048</ext-link> <comment>(accessed July 21, 2022)</comment>.</citation></ref>
<ref id="B41"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Parada-Rojas</surname> <given-names>C. H.</given-names></name> <name><surname>Quesada-Ocampo</surname> <given-names>L. M.</given-names></name></person-group> (<year>2018</year>). <article-title>Analysis of microsatellites from transcriptome sequences of <italic>Phytophthora capsici</italic> and applications for population studies.</article-title> <source><italic>Sci. Rep.</italic></source> <volume>8</volume>:<issue>5194</issue>. <pub-id pub-id-type="doi">10.1038/s41598-018-23438-8</pub-id> <pub-id pub-id-type="pmid">29581516</pub-id></citation></ref>
<ref id="B42"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Paul</surname> <given-names>R.</given-names></name> <name><surname>Ostermann</surname> <given-names>E.</given-names></name> <name><surname>Wei</surname> <given-names>Q.</given-names></name></person-group> (<year>2020</year>). <article-title>Advances in point-of-care nucleic acid extraction technologies for rapid diagnosis of human and plant diseases.</article-title> <source><italic>Biosens. Bioelectron.</italic></source> <volume>169</volume> <fpage>112592</fpage>&#x2013;<lpage>112592</lpage>. <pub-id pub-id-type="doi">10.1016/j.bios.2020.112592</pub-id> <pub-id pub-id-type="pmid">32942143</pub-id></citation></ref>
<ref id="B43"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Pedlar</surname> <given-names>J. H.</given-names></name> <name><surname>McKenney</surname> <given-names>D. W.</given-names></name> <name><surname>Hope</surname> <given-names>E.</given-names></name> <name><surname>Reed</surname> <given-names>S.</given-names></name> <name><surname>Sweeney</surname> <given-names>J.</given-names></name></person-group> (<year>2020</year>). <article-title>Assessing the climate suitability and potential economic impacts of Oak wilt in Canada.</article-title> <source><italic>Sci. Rep.</italic></source> <volume>10</volume>:<issue>19391</issue>. <pub-id pub-id-type="doi">10.1038/s41598-020-75549-w</pub-id> <pub-id pub-id-type="pmid">33173065</pub-id></citation></ref>
<ref id="B44"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Piepenburg</surname> <given-names>O.</given-names></name> <name><surname>Williams</surname> <given-names>C. H.</given-names></name> <name><surname>Stemple</surname> <given-names>D. L.</given-names></name> <name><surname>Armes</surname> <given-names>N. A.</given-names></name></person-group> (<year>2006</year>). <article-title>DNA detection using recombination proteins.</article-title> <source><italic>PLoS Biol.</italic></source> <volume>4</volume>:<issue>e204</issue>. <pub-id pub-id-type="doi">10.1371/journal.pbio.0040204</pub-id> <pub-id pub-id-type="pmid">16756388</pub-id></citation></ref>
<ref id="B45"><citation citation-type="journal"><collab>R Core Team</collab> (<year>2014</year>). <source><italic>R: A language and environment for statistical computing.</italic></source> <publisher-loc>Vienna</publisher-loc>: <publisher-name>R Core Team</publisher-name>.</citation></ref>
<ref id="B46"><citation citation-type="journal"><collab>R Studio Team</collab> (<year>2018</year>). <source><italic>RStudio: Integrated development environment for R.</italic></source> <publisher-loc>Boston, MA</publisher-loc>: <publisher-name>R Studio, Inc</publisher-name>.</citation></ref>
<ref id="B47"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Rutledge</surname> <given-names>R. G.</given-names></name></person-group> (<year>2011</year>). <article-title>A Java program for LRE-based real-time qPCR that enables large-scale absolute quantification.</article-title> <source><italic>PLoS One</italic></source> <volume>6</volume>:<issue>e17636</issue>. <pub-id pub-id-type="doi">10.1371/journal.pone.0017636</pub-id> <pub-id pub-id-type="pmid">21407812</pub-id></citation></ref>
<ref id="B48"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Schoch</surname> <given-names>C. L.</given-names></name> <name><surname>Seifert</surname> <given-names>K. A.</given-names></name> <name><surname>Huhndorf</surname> <given-names>S.</given-names></name> <name><surname>Robert</surname> <given-names>V.</given-names></name> <name><surname>Spouge</surname> <given-names>J. L.</given-names></name> <name><surname>Levesque</surname> <given-names>C. A.</given-names></name><etal/></person-group> (<year>2012</year>). <article-title>Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi.</article-title> <source><italic>Proc. Natl. Acad. Sci. U.S.A</italic></source> <volume>109</volume> <fpage>6241</fpage>&#x2013;<lpage>6246</lpage>.</citation></ref>
<ref id="B49"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Seabold</surname> <given-names>S.</given-names></name> <name><surname>Perktold</surname> <given-names>J.</given-names></name></person-group> (<year>2010</year>). &#x201C;<article-title>Econometric and statistical modeling with Python skipper seabold 1 1</article-title>,&#x201D; in <source><italic>Proceedings of the 9th python in science conference</italic></source>, <publisher-loc>Austin, TX.</publisher-loc></citation></ref>
<ref id="B50"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Shelstad</surname> <given-names>D.</given-names></name> <name><surname>Queen</surname> <given-names>L.</given-names></name> <name><surname>French</surname> <given-names>D.</given-names></name> <name><surname>Fitzpatrick</surname> <given-names>D.</given-names></name></person-group> (<year>1991</year>). <article-title>Describing the spread of Oak Wilt using a geographic information system.</article-title> <source><italic>Arboric. J.</italic></source> <volume>17</volume> <fpage>192</fpage>&#x2013;<lpage>199</lpage>. <pub-id pub-id-type="doi">10.48044/jauf.1991.047</pub-id></citation></ref>
<ref id="B51"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Singh</surname> <given-names>M.</given-names></name> <name><surname>Bindal</surname> <given-names>G.</given-names></name> <name><surname>Misra</surname> <given-names>C. S.</given-names></name> <name><surname>Rath</surname> <given-names>D.</given-names></name></person-group> (<year>2022</year>). <article-title>The era of Cas12 and Cas13 CRISPR-based disease diagnosis.</article-title> <source><italic>Crit. Rev. Microbiol.</italic></source> <volume>48</volume> <fpage>714</fpage>&#x2013;<lpage>729</lpage>. <pub-id pub-id-type="doi">10.1080/1040841x.2021.2025041</pub-id> <pub-id pub-id-type="pmid">35164636</pub-id></citation></ref>
<ref id="B52"><citation citation-type="journal"><collab>USDA-Forest Service Northern Research Station, and Forest Health Protection</collab> (<year>2019</year>). <italic>Alien forest pest explorer&#x2014;Species map</italic>. Available online at: <ext-link ext-link-type="uri" xlink:href="https://www.nrs.fs.fed.us/tools/afpe/maps">https://www.nrs.fs.fed.us/tools/afpe/maps</ext-link> <comment>(accessed April 11, 2022)</comment>.</citation></ref>
<ref id="B53"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Wilson</surname> <given-names>A. D.</given-names></name></person-group> (<year>2001</year>). <article-title>Oak Wilt, a potential threat to southern and western oak forests.</article-title> <source><italic>J. For.</italic></source> <volume>99</volume> <fpage>4</fpage>&#x2013;<lpage>11</lpage>.</citation></ref>
<ref id="B54"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Yang</surname> <given-names>A.</given-names></name> <name><surname>Juzwik</surname> <given-names>J.</given-names></name></person-group> (<year>2017</year>). <article-title>Use of nested and real-time PCR for the detection of ceratocystis fagacearum in the sapwood of diseased oak Species in Minnesota.</article-title> <source><italic>Plant Dis.</italic></source> <volume>101</volume> <fpage>480</fpage>&#x2013;<lpage>486</lpage>. <pub-id pub-id-type="doi">10.1094/pdis-07-16-0990-re</pub-id> <pub-id pub-id-type="pmid">30677343</pub-id></citation></ref>
<ref id="B55"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Yang</surname> <given-names>Y.</given-names></name> <name><surname>Qin</surname> <given-names>X.</given-names></name> <name><surname>Song</surname> <given-names>Y.</given-names></name> <name><surname>Zhang</surname> <given-names>W.</given-names></name> <name><surname>Hu</surname> <given-names>G.</given-names></name> <name><surname>Dou</surname> <given-names>Y.</given-names></name><etal/></person-group> (<year>2017</year>). <article-title>Development of real-time and lateral flow strip reverse transcription recombinase polymerase Amplification assays for rapid detection of peste des petits ruminants virus.</article-title> <source><italic>Virol. J.</italic></source> <volume>14</volume>:<issue>24</issue>. <pub-id pub-id-type="doi">10.1186/s12985-017-0688-6</pub-id> <pub-id pub-id-type="pmid">28173845</pub-id></citation></ref>
<ref id="B56"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Zetsche</surname> <given-names>B.</given-names></name> <name><surname>Gootenberg</surname> <given-names>J. S.</given-names></name> <name><surname>Abudayyeh</surname> <given-names>O. O.</given-names></name> <name><surname>Slaymaker</surname> <given-names>I. M.</given-names></name> <name><surname>Makarova</surname> <given-names>K. S.</given-names></name> <name><surname>Essletzbichler</surname> <given-names>P.</given-names></name><etal/></person-group> (<year>2015</year>). <article-title>Cpf1 is a single RNA-Guided endonuclease of a class 2 CRISPR-Cas system.</article-title> <source><italic>Cell</italic></source> <volume>163</volume> <fpage>759</fpage>&#x2013;<lpage>771</lpage>. <pub-id pub-id-type="doi">10.1016/j.cell.2015.09.038</pub-id> <pub-id pub-id-type="pmid">26422227</pub-id></citation></ref>
<ref id="B57"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname> <given-names>Y.</given-names></name> <name><surname>Zhang</surname> <given-names>Y.</given-names></name> <name><surname>Zhang</surname> <given-names>Y.</given-names></name> <name><surname>Xie</surname> <given-names>K.</given-names></name></person-group> (<year>2020</year>). <article-title>Evaluation of CRISPR/Cas12a-based DNA detection for fast pathogen diagnosis and GMO test in rice.</article-title> <source><italic>Mol. Breed.</italic></source> <volume>40</volume> <fpage>1</fpage>&#x2013;<lpage>12</lpage>. <pub-id pub-id-type="doi">10.1007/s11032-019-1092-2</pub-id></citation></ref>
<ref id="B58"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Zowawi</surname> <given-names>H. M.</given-names></name> <name><surname>Alenazi</surname> <given-names>T. H.</given-names></name> <name><surname>AlOmaim</surname> <given-names>W. S.</given-names></name> <name><surname>Wazzan</surname> <given-names>A.</given-names></name> <name><surname>Alsufayan</surname> <given-names>A.</given-names></name> <name><surname>Hasanain</surname> <given-names>R. A.</given-names></name><etal/></person-group> (<year>2021</year>). <article-title>Portable RT-PCR system: A rapid and scalable diagnostic tool for COVID-19 testing.</article-title> <source><italic>J. Clin. Microbiol.</italic></source> <volume>59</volume> <fpage>e3004</fpage>&#x2013;<lpage>e3020</lpage>. <pub-id pub-id-type="doi">10.1128/jcm.03004-20</pub-id> <pub-id pub-id-type="pmid">33674285</pub-id></citation></ref>
</ref-list>
</back>
</article>