<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article article-type="research-article" dtd-version="2.3" xml:lang="EN" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Epigenet. Epigenom.</journal-id>
<journal-title>Frontiers in Epigenetics and Epigenomics</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Epigenet. Epigenom.</abbrev-journal-title>
<issn pub-type="epub">2813-706X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="publisher-id">1535838</article-id>
<article-id pub-id-type="doi">10.3389/freae.2025.1535838</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Epigenetics and Epigenomics</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>High-throughput, pan-leukocyte biomarkers for the detection of inflammation in human breastmilk and stool</article-title>
<alt-title alt-title-type="left-running-head">Dunnet et al.</alt-title>
<alt-title alt-title-type="right-running-head">
<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3389/freae.2025.1535838">10.3389/freae.2025.1535838</ext-link>
</alt-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Dunnet</surname>
<given-names>M. J.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2977901/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
<role content-type="https://credit.niso.org/contributor-roles/resources/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Morison</surname>
<given-names>I. M.</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/resources/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
</contrib>
<contrib contrib-type="author" corresp="yes" equal-contrib="yes">
<name>
<surname>Bond</surname>
<given-names>D. M.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2883270/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
</contrib>
<contrib contrib-type="author" corresp="yes" equal-contrib="yes">
<name>
<surname>Hore</surname>
<given-names>T. A.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/926419/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
<role content-type="https://credit.niso.org/contributor-roles/resources/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Department of Anatomy</institution>, <institution>University of Otago</institution>, <addr-line>Dunedin</addr-line>, <country>New Zealand</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Department of Biochemistry</institution>, <institution>University of Otago</institution>, <addr-line>Dunedin</addr-line>, <country>New Zealand</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Department of Pathology</institution>, <institution>University of Otago</institution>, <addr-line>Dunedin</addr-line>, <country>New Zealand</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>
<bold>Edited by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1535716/overview">Zhenyu Xuan</ext-link>, The University of Texas at Dallas, United States</p>
</fn>
<fn fn-type="edited-by">
<p>
<bold>Reviewed by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1525837/overview">Mushan Li</ext-link>, The Pennsylvania State University (PSU), United States</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/2894462/overview">Jin Woo Oh</ext-link>, Lunit, Republic of Korea</p>
</fn>
<corresp id="c001">&#x2a;Correspondence: T. A. Hore, <email>tim.hore@otago.ac.nz</email>; D. M. Bond, <email>donna.bond@otago.ac.nz</email>
</corresp>
<fn fn-type="equal" id="fn001">
<label>
<sup>&#x2020;</sup>
</label>
<p>These authors have contributed equally to this work and share last authorship</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>28</day>
<month>02</month>
<year>2025</year>
</pub-date>
<pub-date pub-type="collection">
<year>2025</year>
</pub-date>
<volume>3</volume>
<elocation-id>1535838</elocation-id>
<history>
<date date-type="received">
<day>27</day>
<month>11</month>
<year>2024</year>
</date>
<date date-type="accepted">
<day>05</day>
<month>02</month>
<year>2025</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2025 Dunnet, Morison, Bond and Hore.</copyright-statement>
<copyright-year>2025</copyright-year>
<copyright-holder>Dunnet, Morison, Bond and Hore</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<sec>
<title>Background</title>
<p>DNA methylation can be used to track cellular identity. We have previously developed a high-throughput, cost-effective DNA methylation pipeline containing two loci, <italic>HOXA3</italic> and <italic>MAP4K1</italic>, that can quantify leukocyte proportion amongst a range of background tissues. Here, we apply this pipeline to two clinically relevant tissue samples: breastmilk and stool.</p>
</sec>
<sec>
<title>Results</title>
<p>We report that our leukocyte methylation assay can quantify the proportion of leukocytes in breastmilk, and find leukocyte levels fluctuate dramatically in concert with infection severity. We benchmarked our leukocyte methylation pipeline in stool samples against the commonly used faecal calprotectin assay. Our results show a high concordance between the two methods indicating the viability of our DNA methylation biomarkers in the context of intestinal inflammation.</p>
</sec>
<sec>
<title>Conclusion:</title>
<p>The data presented here emphasise the clinical applicability of our high-throughput DNA methylation assay in the context of mastitis and intestinal inflammation.</p>
</sec>
</abstract>
<kwd-group>
<kwd>DNA methylation</kwd>
<kwd>biomarker</kwd>
<kwd>leukocytes</kwd>
<kwd>inflammation</kwd>
<kwd>mastitis</kwd>
<kwd>inflammatory bowel disease</kwd>
</kwd-group>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-at-acceptance</meta-name>
<meta-value>Epigenomic Tools</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1">
<title>Introduction</title>
<p>DNA methylation is the covalent bonding of a methyl group to the 5&#x2032; carbon of a cytosine nucleotide. DNA methylation is dynamically added and removed throughput development; indeed, approximately 20% of all human autosomal CpG sites are differentially methylated or unmethylated based upon cell type and stage of development (<xref ref-type="bibr" rid="B70">Ziller et al., 2013</xref>). As such, cell-specific DNA methylation patterns can be used to identify the cell-of-origin for a particular DNA molecule. In cases where there is no genetic difference between healthy and diseased tissue or where information on cellular origin is required, DNA methylation assays will likely be useful for detection, diagnosis, and management decisions. For example, cell-free DNA (cfDNA), which can originate from apoptotic or necrotic cells, can enter the circulatory system and be collected easily and non-invasively for diagnostic purposes. Analysis of the methylation pattern of cfDNA in healthy individuals shows its cellular origins: 55% from leukocytes, 30% from erythrocyte progenitors, 10% from vascular endothelial cells, and 1% from hepatocytes (<xref ref-type="bibr" rid="B42">Moss et al., 2018</xref>; <xref ref-type="bibr" rid="B31">Lam et al., 2020</xref>). In addition, in cases of trauma, autoimmunity, ischaemia, infection, or cancer, previously undetectable cfDNA molecules from affected organs can be measured (<xref ref-type="bibr" rid="B35">Lehmann-Werman et al., 2016</xref>; <xref ref-type="bibr" rid="B10">Cisneros-Villanueva et al., 2022</xref>; <xref ref-type="bibr" rid="B69">Zemmour et al., 2018</xref>; <xref ref-type="bibr" rid="B34">Lehmann-Werman et al., 2018</xref>; <xref ref-type="bibr" rid="B9">Cheng et al., 2021</xref>).</p>
<p>Local inflammation is difficult to detect with cfDNA because of the large amount of blood-cell-derived DNA already present in plasma. Several deconvolution algorithms based on Illumina 450K methylation array and EPIC array systems have been utilised for this analysis; for example, EPIDish (<xref ref-type="bibr" rid="B59">Teschendorff et al., 2017</xref>), can determine the proportion of leukocyte subpopulations from a given sample. However, these systems require thousands of CpG sites, are relatively expensive, and are low throughput. We have previously described a high throughput, cost-effective, pipeline that uses the locus-specific methylation to detect immune cells from a mixed sample (<xref ref-type="bibr" rid="B13">Dunnet et al., 2022</xref>). This involves bisulfite amplicon sequencing of <italic>HOXA3</italic> and <italic>MAP4K1</italic> (<xref ref-type="bibr" rid="B13">Dunnet et al., 2022</xref>). To expand on this work here, we examined the ability of this pipeline to infer the level of inflammation from clinically relevant samples, specifically, breastmilk and stool. These samples were chosen because of their relevance to common inflammatory conditions: mastitis and inflammatory bowel disease.</p>
<p>Mastitis is defined as the inflammation of the breast tissue, which typically, but not exclusively, occurs during lactation (<xref ref-type="bibr" rid="B7">Boakes et al., 2018</xref>). The fraction of leukocytes markedly increases from less than 5% in healthy mothers to up to 90% during mastitis (<xref ref-type="bibr" rid="B21">Hassiotou et al., 2013a</xref>). Flow cytometry approaches to measure the leukocyte fraction in breastmilk have already been proposed as a diagnostic tool to assess the health status of the mother/infant dyad (<xref ref-type="bibr" rid="B21">Hassiotou et al., 2013a</xref>). However, cellular composition in breastmilk is highly dynamic and sampling may be required more frequently than flow cytometry can conveniently provide.</p>
<p>Intestinal inflammation can be caused by a large number of factors, including cancer (<xref ref-type="bibr" rid="B64">von Roon et al., 2007</xref>), inflammatory bowel disease (<xref ref-type="bibr" rid="B32">Laserna-Mendieta and Lucendo, 2019</xref>), and coeliac disease (<xref ref-type="bibr" rid="B15">Ertekin et al., 2010</xref>). Detection of intestinal inflammation is most commonly performed with the faecal calprotectin assay (FCA), which measures the concentration of calprotectin, an antimicrobial complex highly abundant in the granules of neutrophils and, to a lesser extent in monocytes and macrophages (<xref ref-type="bibr" rid="B45">Odink et al., 1987</xref>; <xref ref-type="bibr" rid="B55">R&#xf8;seth PNSMKF, 1999</xref>). The amount of calprotectin is proportional to the severity of an immune response, making it a useful non-invasive marker for intestinal inflammation (<xref ref-type="bibr" rid="B54">R&#xf8;seth et al., 1992</xref>). While an extremely valuable tool, the FCA is limited in several ways. Firstly, the FCA kits are proprietary, and the inter-kit variability is large (<xref ref-type="bibr" rid="B66">Whitehead et al., 2013</xref>; <xref ref-type="bibr" rid="B28">Kittanakom et al., 2017</xref>; <xref ref-type="bibr" rid="B30">Labaere et al., 2014</xref>). Second, the calprotectin complex degrades in stool after 48&#x2013;72&#xa0;h at room temperature and requires refrigeration to remain stable (<xref ref-type="bibr" rid="B30">Labaera et al., 2014</xref>; <xref ref-type="bibr" rid="B33">Lasson et al., 2015</xref>; <xref ref-type="bibr" rid="B47">Oyaert et al., 2017</xref>). Finally, the age of the patient, medications they are taking, and some pathologies (in particular, pancreatic insufficiency) can result in variation in faecal calprotectin levels (<xref ref-type="bibr" rid="B32">Laserna-Mendieta and Lucendo, 2019</xref>; <xref ref-type="bibr" rid="B11">Degraeuwe et al., 2015</xref>; <xref ref-type="bibr" rid="B24">Henderson et al., 2014</xref>; <xref ref-type="bibr" rid="B48">Padoan et al., 2018</xref>; <xref ref-type="bibr" rid="B37">Lundgren et al., 2019</xref>; <xref ref-type="bibr" rid="B14">Ellemunter et al., 2017</xref>).</p>
<p>The high-throughput DNA methylation biomarker pipeline we have previously described (<xref ref-type="bibr" rid="B13">Dunnet et al., 2022</xref>) has the potential to address limitations in the current diagnostic assays. In particular, the ability to sample repeatedly, to avoid proprietary kits, and to capitalize on the stability of DNA methylation have the potential to improve the diagnostic capabilities for mastitis and intestinal inflammation.</p>
<p>In this study, we sampled numerous breastmilk samples from the same individual over the course of 1&#xa0;month. We show the proportion of leukocytes varied markedly, even within a 24-hour period. The two biomarker loci, <italic>HOXA3</italic> and <italic>MAP4K1</italic>, were strongly correlated in milk samples, and the total level of estimated leukocytes was consistent with instances of mastitis. Furthermore, we examined the leukocyte proportion in stool samples with associated faecal calprotectin scores. We observed that the proportion of leukocyte-derived reads was extremely high (&#x3e;70%) in all samples with even slightly elevated faecal calprotectin, suggesting that leukocyte DNA vastly exceeds epithelial cell DNA in stool with even minor inflammation. Our high-throughput, cost-effective DNA methylation assay has clinical relevance in the context of mastitis and intestinal inflammation.</p>
</sec>
<sec sec-type="methods" id="s2">
<title>Methods</title>
<sec id="s2-1">
<title>Human breastmilk sample collection and cell isolation</title>
<p>Human breastmilk was obtained from a single donor with informed consent per the New Zealand Human Tissue Act 2008. Over 1&#xa0;month, from the 22nd of November 2018 to the 21st of December 2018, 1&#xa0;mL of excess pump-expressed milk was collected by the donor where possible. Pumping occurred either exclusively from one breast or was a mixture of the two breasts; while breast of origin was often recorded by the donor, in many cases it was not. The start of the collection date was approximately 5&#xa0;weeks postpartum and seventy-five milk samples were collected in total. Milk was stored at &#x2212;20&#xb0;C, or colder, until use.</p>
<p>Cell isolation was performed by centrifugation. First, milk samples were centrifuged at 500 x g for 15&#xa0;min to pellet the cells. Next, milk fats and liquid were removed, and the pellet was resuspended in 500&#xa0;&#x3bc;L of 0.01&#xa0;M PBS. Centrifugation and washing were repeated an additional two times. Finally, the cells were pelleted at 500x g for 15&#xa0;min before resuspension in a lysis buffer consisting of 8&#xa0;&#x3bc;L of 0.01&#xa0;M PBS, 8&#xa0;&#x3bc;L of the Zymo 2x M-Digestion Buffer, and 1&#xa0;&#x3bc;L of 20&#xa0;mg/mL Proteinase K (Zymo EZ-96 DNA Methylation-Direct&#x2122; MagPrep Kit) and incubated at 50&#xb0;C for 20&#xa0;min. Cell lysates were directly added to the bisulphite conversion protocol (see below) with no additional handling.</p>
</sec>
<sec id="s2-2">
<title>Saliva cell isolation and DNA extraction</title>
<p>Saliva samples were collected as previously described (<xref ref-type="bibr" rid="B13">Dunnet et al., 2022</xref>; <xref ref-type="bibr" rid="B60">Theda et al., 2018</xref>). Briefly, in the 30&#xa0;min prior to collection only water was consumed. Five mL of saliva was collected via passive drool and transferred to a 15&#xa0;mL plastic centrifuge tube. The saliva was centrifuged at 400&#xa0;g and supernatant removed to isolate the cells. The cell pellets were resuspended and washed with 0.01 M PBS three times. DNA was extracted using the BOMB.bio protocol 6.3: extraction of TNA from mammalian tissues (<xref ref-type="bibr" rid="B44">Oberacker et al., 2019</xref>) (<ext-link ext-link-type="uri" xlink:href="https://bomb.bio/protocols/">bomb.bio/protocols/</ext-link>). DNA quality was assessed by gel electrophoresis and concentration by the HS dsDNA Qubit assay (Thermo Scientific).</p>
</sec>
<sec id="s2-3">
<title>K562 cell culture and DNA extraction</title>
<p>K562 cells were cultured as previously described (<xref ref-type="bibr" rid="B50">Pencovich et al., 2011</xref>). The cells were lysed with 1&#xa0;mL of GITC lysis buffer (4&#xa0;M GITC, 2% w/v SDS, 50&#xa0;mM Tris-HCl pH 8.0, 0.1% v/v antifoam 204 (Sigma-Aldrich), and 20&#xa0;mM EDTA). DNA extraction was performed with the BOMB.Bio protocol 6.1: TNA extraction of mammalian cells with GITC (<xref ref-type="bibr" rid="B44">Oberacker et al., 2019</xref>) (<ext-link ext-link-type="uri" xlink:href="https://bomb.bio/protocols/">bomb.bio/protocols/</ext-link>). DNA quality was assessed by gel electrophoresis and concentration by the HSdsDNA Qubit assay.</p>
</sec>
<sec id="s2-4">
<title>Leukocyte isolation and DNA extraction</title>
<p>Leukocytes were isolated from saliva (see above) by sequential cellular filtration as previously described (<xref ref-type="bibr" rid="B13">Dunnet et al., 2022</xref>). Briefly, cellular isolates from saliva were first filtered through a 40-&#x3bc;m, then a 20-&#x3bc;m mesh filter to exclude buccal cells. The purity of the isolated leukocytes was assessed by microscopy. We counted a minimum of 100 cells across two fields per slide. We observed a purity of &#x3e;99% for each sample.</p>
</sec>
<sec id="s2-5">
<title>Stool sample preparation and DNA extraction</title>
<p>The use of human stool samples was approved by the University of Otago Human Ethics Committee (Health) (approval number H21/138). Stool samples were obtained from Southern Community Laboratories (SCL), Dunedin. SCL had previously processed the stool samples for use in a FCA; specifically, they were homogenised and diluted in a proprietary extraction buffer. After the faecal calprotectin samples were received, they were heat-inactivated at 75&#xa0;&#xb0;C before DNA extraction with the Zymo Research&#x2122; Quick-DNA Fecal/Soil Microbe Miniprep Kit. DNA extractions were performed starting at step four of the protocol (steps 1-3 are for homogenisation). Furthermore, to improve overall DNA yield per sample, the volume of homogenised stool sample and genomic lysis buffer was increased four-fold from 400&#xa0;&#x3bc;L to 1,200&#xa0;&#x3bc;L to 1,600&#xa0;&#x3bc;L and 4,800&#xa0;&#x3bc;L, respectively. The entirety of each sample was run through the extraction column over multiple spin cycles. The remainder of the DNA extraction was performed as above. Other than these modifications, extraction was carried out as per the manufacturer&#x2019;s instructions. Total DNA concentration was measured with the HS dsDNA Qubit assay, and DNA quality was assessed by gel electrophoresis.</p>
</sec>
<sec id="s2-6">
<title>Bisulfite conversion of DNA</title>
<p>Bisulphite conversion for all samples was performed with the Zymo EZ-DNA Methylation Direct MagPrep kit per the manufacturer&#x2019;s instructions. This protocol suggests various initial conversion parameters specific to the amount and quality of input DNA. Lysates with breastmilk-derived DNA were converted under standard conditions for optimal cytosine conversion: 8&#xa0;min at 98&#xb0;C followed by 3&#xa0;h and 30&#xa0;min at 64&#xb0;C. Stool-derived DNA samples were converted for 8&#xa0;min at 98&#xb0;C followed by 3&#xa0;h and 30&#xa0;min at 53&#xb0;C to reduce DNA degradation at the cost of less efficient conversion. Bisulfite converted DNA was quantified using the Qubit ssDNA Qubit assay (Thermo Scientific).</p>
</sec>
<sec id="s2-7">
<title>Bisulfite amplicon sequencing</title>
<p>A dual-index, two-step PCR protocol was used to amplify bisulphite-converted DNA with the KAPA HiFi HotStart Uracil &#x2b; kit (Roche) as described here (<xref ref-type="bibr" rid="B13">Dunnet et al., 2022</xref>). Briefly, in the first round of PCR, the target region is amplified with primers containing an overhanging linker sequence. The second round of PCR uses primers comprised of the complementary linker sequence attached to the Illumina P5 and P7 adapters and TruSeq indexes. Each PCR reaction contained the KAPA HiFi HotStart Uracil &#x2b; ReadyMix, 0.3&#xa0;&#x3bc;M of each primer, and 200&#xa0;ng of bisulphite-converted DNA topped up to 25&#xa0;&#x3bc;L with nuclease-free water. All primer sequences are shown in <xref ref-type="table" rid="T1">Table 1</xref>.</p>
<table-wrap id="T1" position="float">
<label>TABLE 1</label>
<caption>
<p>The primer sequences used in this study. Bold text indicates linker sequences for bisulphite amplicon sequencing. Note that this linker sequence is the reverse complement of the P5 and P7 adapters.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left">Primer ID</th>
<th align="left">Sequence</th>
<th align="left">Target strand</th>
<th align="left">Target location (hg38)</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">Bisulfite HOXA3_long Forward</td>
<td align="left">
<bold>ACA&#x200b;CTC&#x200b;TTT&#x200b;CCC&#x200b;TAC&#x200b;ACG&#x200b;ACG&#x200b;CTC&#x200b;TTC&#x200b;CGA&#x200b;TCT&#x200b;</bold>GGT&#x200b;TTT&#x200b;GTT&#x200b;TGG&#x200b;GTT&#x200b;AGT&#x200b;GGT&#x200b;AT</td>
<td align="center">&#x2b;</td>
<td align="left">chr7:27,113,959-27,114,117</td>
</tr>
<tr>
<td align="left">Bisulfite HOXA3_long Reverse</td>
<td align="left">
<bold>GTG&#x200b;ACT&#x200b;GGA&#x200b;GTT&#x200b;CAG&#x200b;ACG&#x200b;TGT&#x200b;GCT&#x200b;CTT&#x200b;CCG&#x200b;ATC&#x200b;T</bold>CC&#x200b;AAC&#x200b;AAA&#x200b;AAA&#x200b;ACC&#x200b;CCT&#x200b;TTA&#x200b;TAA&#x200b;A</td>
<td align="center">&#x2b;</td>
<td align="left">chr7:27,113,959-27,114,117</td>
</tr>
<tr>
<td align="left">Bisulfite MAP4K1_long Forward</td>
<td align="left">
<bold>ACA&#x200b;CTC&#x200b;TTT&#x200b;CCC&#x200b;TAC&#x200b;ACG&#x200b;ACG&#x200b;CTC&#x200b;TTC&#x200b;CGA&#x200b;TCT&#x200b;</bold>TGT&#x200b;TTT&#x200b;TAT&#x200b;ATG&#x200b;GAA&#x200b;GTT&#x200b;ATA&#x200b;TTT&#x200b;ATT</td>
<td align="center">-</td>
<td align="left">chr19:38,596,411&#x2013;38,596,696</td>
</tr>
<tr>
<td align="left">Bisulfite MAP4K1_long Reverse</td>
<td align="left">
<bold>GTG&#x200b;ACT&#x200b;GGA&#x200b;GTT&#x200b;CAG&#x200b;ACG&#x200b;TGT&#x200b;GCT&#x200b;CTT&#x200b;CCG&#x200b;ATC&#x200b;T</bold>AA&#x200b;CAA&#x200b;CTC&#x200b;AAA&#x200b;ACC&#x200b;TAA&#x200b;CCC</td>
<td align="center">-</td>
<td align="left">chr19:38,596,411&#x2013;38,596,696</td>
</tr>
<tr>
<td align="left">Bisulfite MAP4K1_short Forward</td>
<td align="left">
<bold>ACA&#x200b;CTC&#x200b;TTT&#x200b;CCC&#x200b;TAC&#x200b;ACG&#x200b;ACG&#x200b;CTC&#x200b;TTC&#x200b;CGA&#x200b;TCT&#x200b;</bold>TTA&#x200b;GAA&#x200b;ATG&#x200b;TTA&#x200b;GGG&#x200b;GAT&#x200b;AAG&#x200b;GTT&#x200b;T</td>
<td align="center">&#x2b;</td>
<td align="left">chr19:38,596,606-38,596,816</td>
</tr>
<tr>
<td align="left">Bisulfite MAP4K1_short Reverse</td>
<td align="left">
<bold>GTG&#x200b;ACT&#x200b;GGA&#x200b;GTT&#x200b;CAG&#x200b;ACG&#x200b;TGT&#x200b;GCT&#x200b;CTT&#x200b;CCG&#x200b;ATC&#x200b;T</bold>TT&#x200b;CCT&#x200b;CAA&#x200b;ACT&#x200b;CAA&#x200b;TAC&#x200b;TAC&#x200b;CAC&#x200b;TC</td>
<td align="center">&#x2b;</td>
<td align="left">chr19:38,596,606-38,596,816</td>
</tr>
<tr>
<td align="left">Illumina P5 adapter with TruSeq index</td>
<td align="left">AATGATACGGCGACCACCGAGATCTACACNNNNNN<bold>ACACTCTTTCCCTACACGACGCTCTTCCGATCT</bold>
</td>
<td align="center">N/A</td>
<td align="left">N/A</td>
</tr>
<tr>
<td align="left">Illumina P7 adapter with TruSeq index</td>
<td align="left">CAAGCAGAAGACGGCATACGAGATNNNNNN<bold>GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</bold>
</td>
<td align="center">N/A</td>
<td align="left">N/A</td>
</tr>
</tbody>
</table>
</table-wrap>
<p>Breastmilk-derived DNA was first amplified with the <italic>HOXA3_long</italic> and <italic>MAP4K1_long</italic> primer pairs. The following cycle parameters were used: 95&#xb0;C for 2&#xa0;min, 23 cycles of 98&#xb0;C for 20&#xa0;s, 59&#xb0;C for 10&#xa0;s, and 72&#xb0;C for 20&#xa0;s. A final elongation step was performed for 5&#xa0;min at 72&#xb0;C. Reactions were centrifuged briefly to remove condensate on the tube walls. Next, the products were cleaned using solid-phase reverse immobilisation of carboxyl-coated magnetic beads suspended in standard PEG buffer (18% w/v polyethylene glycol 8000 (PEG), 1&#xa0;M NaCl, 10&#xa0;mM Tris (pH 8.0), 1&#xa0;mM EDTA, 0.05% v/v Tween-20), followed by two washes in 70% ethanol. The cleaned PCR products were eluted in 11.5&#xa0;&#x3bc;L of filter sterile Milli-Q<sup>&#xae;</sup> water. The eluted DNA was combined with 12.5&#xa0;&#x3bc;L of the KAPA HiFi HotStart Uracil &#x2b; ReadyMix and 0.5&#xa0;&#x3bc;L of each indexing primer (Illumina P5 and P7 adapters with TruSeq index combined with the complementary linker sequence). Amplification was repeated as above for an additional five cycles.</p>
<p>Saliva, K562, and human stool-derived DNA were amplified with the <italic>MAP4K1_short</italic> primer pair. The same approach as above was followed with modifications to thermocycling to improve PCR efficiency. The first amplification step was performed with the following parameters: 95&#xb0;C for 2&#xa0;min, 25 cycles of 98&#xb0;C for 20&#xa0;s, 59&#xb0;C for 40&#xa0;s, and 72&#xb0;C for 40&#xa0;s. A final elongation step was performed for 5&#xa0;min at 72&#xa0;&#xb0;C. The PCR product solid-phase reverse immobilisation clean-up was performed similarly as above. The second amplification step used the following parameters: 95&#xb0;C for 2&#xa0;min, 5 cycles of 98&#xb0;C for 20&#xa0;s, 59&#xb0;C for 40&#xa0;s, and 72&#xb0;C for 40&#xa0;s, followed a final 5&#xa0;min elongation step at 72&#xb0;C.</p>
<p>Prior to sequencing, all amplicons were cleaned using solid-phase reverse immobilisation of carboxyl-coated magnetic beads suspended in standard PEG buffer (as above). Sequencing was performed on the Illumina iSeq100 as per the manufactures instructions.</p>
</sec>
<sec id="s2-8">
<title>Bioinformatic and statistical analyses</title>
<p>Raw read adapter and quality trimming were performed with Cutadapt and TrimGalore (v.0.6.7) (<xref ref-type="bibr" rid="B38">Martin, 2011</xref>). Reads were mapped to a custom &#x201c;genome&#x201d; consisting of only the amplicon sequence using Bismark (v0.14.3) (<xref ref-type="bibr" rid="B29">Krueger and Andrews, 2011</xref>). The sequences used for mapping were obtained from the UCSC genome browser (<italic>HOXA3_long</italic>: chr7:27,113,957&#x2013;27,114,300 (hg38); <italic>MAP4K1_long:</italic> chr19:38,596,411&#x2013;38,596,696 (hg38); <italic>MAP4K1_short</italic>: chr19:38,596,606-38,596,816 (hg38)). Heatmaps, linear regression, bionomical regression, cell-of-origin read classification, and ROC curve generation were performed with custom R scripts and the pROC package. The cut-off for a read to be classified as leukocyte derived was &#x2265;6 methylated CpG sites for the <italic>HOXA3_long</italic> amplicon, &#x2265;3 for the <italic>MAP4K1_long</italic> amplicon, and &#x2265;4 for the <italic>MAP4K1_short</italic> amplicon. All statistical analyses were performed in R.</p>
</sec>
</sec>
<sec sec-type="results" id="s3">
<title>Results</title>
<sec id="s3-1">
<title>DNA methylation at the <italic>HOXA3</italic> and <italic>MAP4K1</italic> loci can determine the proportion of blood-derived cells in human breastmilk.</title>
<p>Human breastmilk contains three principal cell populations (<xref ref-type="bibr" rid="B70">Ziller et al., 2013</xref>): blood-derived cells, comprised of both mature leukocytes and hematopoietic stem cells (<xref ref-type="bibr" rid="B42">Moss et al., 2018</xref>), breast-derived cells, comprised of lactocytes, myoepithelial cells, and progenitor cells; and (<xref ref-type="bibr" rid="B31">Lam et al., 2020</xref>) probiotic bacteria (<xref ref-type="bibr" rid="B68">Witkowska-Zimny and Kaminska-El-Hassan, 2017</xref>). In a healthy mother/child dyad, the proportion of leukocytes is high in the colostrum (between 13% and 70%), defined as the first milk until approximately 4&#xa0;days postpartum, but rapidly decreases after that to less than 1% of the total cells in breastmilk (<xref ref-type="bibr" rid="B21">Hassiotou et al., 2013a</xref>; <xref ref-type="bibr" rid="B68">Witkowska-Zimny and Kaminska-El-Hassan, 2017</xref>). In contrast, when either the mother or child is ill, leukocyte proportions increase; during mastitis, leukocytes can constitute upwards of 90% of total breastmilk cells (<xref ref-type="bibr" rid="B21">Hassiotou et al., 2013a</xref>). Therefore we first aimed to determine if the previously described <italic>HOXA3</italic> and <italic>MAP4K1</italic> DNA methylation biomarkers (<xref ref-type="bibr" rid="B13">Dunnet et al., 2022</xref>) can accurately deconvolute blood-derived cells from breast-derived cells in human breastmilk. Seventy-five breastmilk samples from a single individual were gathered over the course of 1&#xa0;month with various levels of meta-data (<xref ref-type="fig" rid="F1">Figure 1A</xref>). Samples were recorded as originating from either the left or right breast during the first week of collection; samples after week one were either pooled together from both breasts or had no associated information. We examined DNA methylation at the <italic>HOXA3</italic> and <italic>MAP4K1</italic> loci and applied a previously described leukocyte estimation pipeline for each sample (<xref ref-type="bibr" rid="B13">Dunnet et al., 2022</xref>). Reads were either highly methylated or highly unmethylated with considerable concordance between both loci (<italic>R</italic>
<sup>2</sup> &#x3d; 0.95, <xref ref-type="fig" rid="F1">Figures 1B, C</xref>), suggesting both biomarkers function similarly in breastmilk.</p>
<fig id="F1" position="float">
<label>FIGURE 1</label>
<caption>
<p>
<italic>HOXA3</italic> and <italic>MAP4K1</italic> leukocyte estimates correlate in human milk samples. <bold>(A)</bold> Overview of the milk collection period <bold>(B)</bold> Example of bisulphite amplicon heatmaps for <italic>HOXA3</italic> (left) and <italic>MAP4K1</italic> (right) from human milk samples. Sequencing reads run from left to right across the rows, and columns represent individual CpG positions. Red indicates a methylated CpG, and blue indicates an unmethylated CpG. <bold>(C)</bold> Scatterplot of leukocyte estimates for <italic>MAP4K1</italic> (X-axis) vs. <italic>HOXA3</italic> (Y-axis).</p>
</caption>
<graphic xlink:href="freae-03-1535838-g001.tif"/>
</fig>
<p>Next, we examined the leukocyte proportions from samples with available meta-data on the breast of origin (<xref ref-type="fig" rid="F2">Figure 2</xref>). During the time these samples were taken, there was mastitis in the left breast and an injury to the right breast resulting from breastfeeding. We observed a high proportion of leukocytes in the left-breast-associated milk throughout the week and elevated leukocyte proportions in right-breast-associated milk occurring at the peak of mastitis in the left breast and during the injury to the right breast (<xref ref-type="fig" rid="F2">Figure 2A</xref>). Outside of these time points, the number of leukocytes in the right breast decreased to approximately 60% of the total cell population. These results suggest that during mastitis, the proportion of leukocytes is elevated primarily in the infected breast; however, a severe infection can produce elevated leukocyte proportions in both breasts regardless of where the infection is located.</p>
<fig id="F2" position="float">
<label>FIGURE 2</label>
<caption>
<p>Tracking leukocytes in breastmilk over time <bold>(A)</bold> The proportion of leukocytes in milk from either the left (red line) or right (blue line) breast over 1&#xa0;week as measured by <italic>HOXA3</italic> (top) and <italic>MAP4K1</italic> (bottom). Dotted vertical lines indicate the timepoint of events (<xref ref-type="bibr" rid="B70">Ziller et al., 2013</xref>): onset of flu-like symptoms as a result of left breast mastitis (<xref ref-type="bibr" rid="B42">Moss et al., 2018</xref>), peak of left-breast mastitis, including fever (<xref ref-type="bibr" rid="B31">Lam et al., 2020</xref>), injury to the right breast as a result of breastfeeding. <bold>(B)</bold> Scatterplot of <italic>HOXA3</italic> vs. <italic>MAP4K1</italic> methylation (top) and leukocyte estimate (bottom) for each sample with breast-of-origin meta-data. <bold>(C)</bold> Proportion of leukocytes measured by <italic>HOXA3</italic> and <italic>MAP4K1</italic> from milk known to be pooled from both breasts. <bold>(D)</bold> Proportion of leukocytes measured by <italic>HOXA3</italic> and <italic>MAP4K1</italic> from milk where breast of origin (or its mixing) was not recorded.</p>
</caption>
<graphic xlink:href="freae-03-1535838-g002.tif"/>
</fig>
<p>Throughout the month-long period of sample collection, we observed a high proportion of leukocytes. Indeed, the mean leukocyte estimation across the collection period was 72.3% for <italic>HOXA3</italic> (median 76.6%) and 70.9% for <italic>MAP4K1</italic> (median &#x3d; 73.8%); the sample with the lowest leukocyte proportion was estimated at 23.5% by <italic>HOXA3</italic> and 21.6% by <italic>MAP4K1</italic>. Nevertheless, this was not unexpected because of continued mastitis in the left breast and damage to the right breast. Interestingly, leukocyte estimates did not shift dramatically on a day-to-day basis when either the breast of origin was known or the samples were comprised of milk from both breasts (<xref ref-type="fig" rid="F2">Figures 2A, C</xref>); however, we observed striking changes between milk samples collected on the same day when breast-of-origin meta-data was not available (maximum difference of 69%, <xref ref-type="fig" rid="F2">Figure 2D</xref>, see methods). Therefore, we hypothesise that these rapid changes in cellular composition are partly the result of milk samples obtained from different breasts. Indeed, the cellular composition of breast milk is dynamic and changes based on the period of lactation, infection status, and infant feeding habits (<xref ref-type="bibr" rid="B21">Hassiotou et al., 2013a</xref>; <xref ref-type="bibr" rid="B68">Witkowska-Zimny and Kaminska-El-Hassan, 2017</xref>; <xref ref-type="bibr" rid="B52">Riskin et al., 2012</xref>). It is, therefore, unsurprising that each breast&#x2019;s cellular composition can differ depending on circumstance, especially in cases of infection.</p>
</sec>
<sec id="s3-2">
<title>Validation of a <italic>MAP4K1</italic> bisulfite amplicon for application with stool-derived human DNA</title>
<p>Total genomic DNA extracted from stool samples contains an amalgamation of bacterial-, fungal-, viral-, and host-derived DNA. In healthy individuals, the human component constitutes less than 1% of the total DNA (<xref ref-type="bibr" rid="B63">Vincent et al., 2015</xref>). In contrast, chronic intestinal inflammation damages the surrounding tissues and subsequently results in cell death (<xref ref-type="bibr" rid="B1">Anderton et al., 2020</xref>), leading to the hypothesis that more host-derived DNA will be present in the stool. Indeed, it has been shown that both mitochondrial DNA and genomic DNA amounts increase based on the severity of inflammatory bowel disease (IBD)-related intestinal inflammation (<xref ref-type="bibr" rid="B8">Casellas et al., 2004</xref>; <xref ref-type="bibr" rid="B65">Vrablicova et al., 2020</xref>). We hypothesized that under inflammatory conditions, DNA from neutrophils that have migrated into the intestinal lumen, could be detected with our DNA methylation assay. We obtained 48 faecal samples that had previously undergone FCA testing for our analysis. We initially examined a subset of these samples with the <italic>HOXA3</italic> and <italic>MAP4K1</italic> (<xref ref-type="bibr" rid="B13">Dunnet et al., 2022</xref>) amplicons described above; however, we were unable to obtain sufficient amplicon copies for sequencing within 30 PCR cycles. Over-amplification with more than 30 cycles can lead to clonal amplification of only a few DNA molecules, leading to a misinterpretation of DNA methylation patterns. As a result, shorter amplicons were designed to improve PCR yield (<xref ref-type="table" rid="T1">Table 1</xref>; Bisulfite <italic>MAP4K1_short</italic>). We sequenced leukocyte and K562 DNA (the latter is unmethylated in the <italic>HOXA3</italic> and <italic>MAP4K1</italic> loci of interest (<xref ref-type="bibr" rid="B13">Dunnet et al., 2022</xref>)) to ensure the DNA methylation patterns are consistent between the short and long amplicons. As expected, we observed that leukocytes were highly methylated (84.9%), while K562 DNA was virtually devoid of DNA methylation (4.6%) (<xref ref-type="fig" rid="F3">Figure 3A</xref>). The near absence of methylation of K562 cells parallels the methylation of these loci in colonic epithelial cells (<xref ref-type="bibr" rid="B13">Dunnet et al., 2022</xref>). The two cell types cluster separately from one another based upon the number of methylated CpG sites per read (<xref ref-type="fig" rid="F3">Figure 3B</xref>). To classify reads as either derived from mature leukocyte DNA or K562 DNA we employed a binomial logistic regression model and constructed a receiver operating characteristic (ROC) curve using the &#x2018;pROC&#x2019; package in R. The optimal threshold for leukocyte classification was if &#x2265;4 of seven CpG sites were methylated (sensitivity &#x3d; 98.3%, specificity &#x3d; 99.98%, <xref ref-type="fig" rid="F3">Figure 3C</xref>). Furthermore, the area under the ROC curve was 0.998, indicating that the methylation patterns obtained from this amplicon perform exceptionally well at distinguishing blood leukocyte-derived DNA from K562 DNA (<xref ref-type="fig" rid="F3">Figure 3D</xref>).</p>
<fig id="F3" position="float">
<label>FIGURE 3</label>
<caption>
<p>Validity of short <italic>MAP4K1</italic> amplicon primer sets. <bold>(A)</bold> Example bisulfite amplicon sequencing heatmaps from leukocyte derived DNA (left) and K562 DNA (right). <bold>(B)</bold> Density plot for the number of methylated CpG sites per read in K562- (blue) and Leukocyte-derived (red) DNA samples. The Y-axis represent the probability per unit on the X-axis such that the area under the curve for a specific interval is equal to the probability of the number of methylated CpG sites for that interval. Bandwidth 0.45 <bold>(C)</bold> Binomial regression analysis for the <italic>MAP4K1</italic> short amplicon using leukocyte and K562 DNA. <bold>(D)</bold> ROC curve for the <italic>MAP4K1</italic> short amplicon using leukocyte and K562 DNA. <bold>(E)</bold> Scatterplot of observed vs. expected read classification for leukocyte and K562 DNA mixes. The dotted red line indicates a perfect fit, the solid grey line indicates the observed trendline, and the horizontal dotted grey line indicates a 50% leukocyte estimate. <bold>(F)</bold> Bar chart of leukocyte estimates from two-fold, serially diluted saliva-derived DNA.</p>
</caption>
<graphic xlink:href="freae-03-1535838-g003.tif"/>
</fig>
<p>We next asked if the short <italic>MAP4K1</italic> PCR showed preferential amplification of methylated or unmethylated alleles and if leukocyte estimates are consistent across differing amounts of input DNA. We combined blood leukocyte derived DNA and K562 DNA at a 50:50 ratio and observed a leukocyte estimate of 51.5%. With leukocyte and K562 DNA alone we observed leukocyte estimates of 98.3% and 0.2% respectively (<xref ref-type="fig" rid="F3">Figure 3E</xref>). Finally, we performed a two-fold serial dilution with saliva-derived DNA (a combination of salivary leukocytes and buccal epithelium (<xref ref-type="bibr" rid="B60">Theda et al., 2018</xref>)) and observed consistent levels of leukocyte estimates until 0.98&#xa0;ng of DNA, where the result became discordant (<xref ref-type="fig" rid="F3">Figure 3F</xref>). This suggests the assay can accurately determine the proportion of leukocyte-derived DNA with as little as 2&#xa0;ng of input DNA.</p>
</sec>
<sec id="s3-3">
<title>
<italic>MAP4K1</italic> DNA methylation can identify intestinal inflammation as measured by faecal calprotectin</title>
<p>To determine if our bisulfite amplicon sequencing pipeline could be used to detect intestinal inflammation we applied the pipeline (with the shorter <italic>MAP4K1</italic> amplicon) to stool samples that had previously undergone a FCA. The cutoff for a positive faecal calprotectin test result in the laboratory we obtained samples from is 50&#xa0;&#x3bc;g/g. However, various cut-off thresholds have been suggested in the literature to best balance sensitivity and specificity (<xref ref-type="bibr" rid="B26">Jha et al., 2018</xref>; <xref ref-type="bibr" rid="B53">Rogler et al., 2013</xref>; <xref ref-type="bibr" rid="B51">Ricciuto and Griffiths, 2019</xref>). The reference interval of calprotectin is 10&#x2013;100&#xa0;&#x3bc;g/g for Caucasians, depending on the kit (<xref ref-type="bibr" rid="B6">Bjarnason, 2017</xref>), although the interval between 50 and 100&#xa0;&#x3bc;g/g is thought to have some diagnostic value (<xref ref-type="bibr" rid="B51">Ricciuto and Griffiths, 2019</xref>). In contrast, a calprotectin score of up to 200&#xa0;&#x3bc;g/g can be considered normal for people of African-Caribbean descent (<xref ref-type="bibr" rid="B6">Bjarnason, 2017</xref>). Furthermore, thresholds as high as 250&#xa0;&#x3bc;g/g have been shown to markedly increase specificity at the cost of sensitivity (<xref ref-type="bibr" rid="B26">Jha et al., 2018</xref>; <xref ref-type="bibr" rid="B53">Rogler et al., 2013</xref>). For this reason, we examined the leukocyte estimates in three discrete bands: calprotectin scores less than 50&#xa0;&#x3bc;g/g (low), between 50 and 250&#xa0;&#x3bc;g/g (moderate), and greater than 250&#xa0;&#x3bc;g/g (high). Low, moderate, and high calprotectin samples had mean leukocyte estimates of 51.8% (S.D. &#x3d; 28.4%), 77.9% (S.D. &#x3d; 22.9%), and 94.2% (S.D. &#x3d; 4.2%), respectively (<xref ref-type="fig" rid="F4">Figure 4A</xref>). The percentages of leukocyte-derived DNA in stool from low calprotectin samples were extremely variable, ranging from 3.4% to 88.7%. In contrast, leukocyte estimates in moderate and high samples were extremely similar and all above 70% (with the exception of one moderate sample with a calprotectin level of 52&#xa0;&#x3bc;g/g and a leukocyte estimate of 11.4%). We observed a statistically significant difference between groups when either 50&#xa0;&#x3bc;g/g (one tailed t-test, p-value &#x3d; 4.7E-03) or 250&#xa0;&#x3bc;g/g (one tailed t-test, p-value &#x3d; 0.02) were used as the threshold for a positive test; however, there was no significant difference between moderate and high calprotectin samples (one tailed t-test, p-value &#x3d; 0.07). Our results suggest that human DNA in stool from even a mildly inflamed intestine, as measured by faecal calprotectin, is almost completely derived from leukocytes. In a low inflammatory environment, the proportion of leukocytes in stool is extremely variable, although this might be the result of a relatively small amount of colonic epithelial cells being sloughed out of the lumen.</p>
<fig id="F4" position="float">
<label>FIGURE 4</label>
<caption>
<p>Comparison of the <italic>MAP4K1</italic> bisulfite amplicon sequencing assay to the FCA. <bold>(A)</bold> Scatterplot of leukocyte estimates based on <italic>MAP4K1</italic> methylation in stool samples vs. associated faecal calprotectin score. <bold>(B)</bold> ROC curve for the <italic>MAP4K1</italic> bisulfite amplicon sequencing assay using FCA as the reference standard.</p>
</caption>
<graphic xlink:href="freae-03-1535838-g004.tif"/>
</fig>
<p>We next examined how well the methylation assay could function as a diagnostic marker. Since we did not have access to the clinical outcomes of each patient, we used the calprotectin level. With a 50&#xa0;&#x3bc;g/g threshold, the FCA has a sensitivity and specificity of approximately 97% and 80%, respectively (<xref ref-type="bibr" rid="B32">Laserna-Mendieta and Lucendo, 2019</xref>; <xref ref-type="bibr" rid="B11">Degraeuwe et al., 2015</xref>; <xref ref-type="bibr" rid="B24">Henderson et al., 2014</xref>), so while not perfect, offers some indication of assay applicability. We constructed an ROC curve and observed an area under the curve of 0.847, indicating an high level of agreement between assays (<xref ref-type="fig" rid="F4">Figure 4B</xref>). Using these data, the optimal threshold for the methylation assay to identify elevated FCA is a leukocyte estimate of &#x2265;54.9%, with a sensitivity of 0.94 and specificity of 0.67. While promising, future studies will need to apply this in the context of clinical outcomes.</p>
</sec>
</sec>
<sec sec-type="discussion" id="s4">
<title>Discussion</title>
<p>In this proof-of-concept study we have applied two previously identified pan-leukocyte biomarkers (<xref ref-type="bibr" rid="B13">Dunnet et al., 2022</xref>), one each at the <italic>HOXA3</italic> and <italic>MAP4K1</italic> loci, to clinically relevant tissue samples: breastmilk and stool. With high-throughput sampling of breastmilk, we have shown that the proportion of leukocytes is extremely variable over short periods of time and between each breast. In the process, we have incorporated a new primer set into the pipeline, highlighting its ease of use and modifiability. Finally, we have demonstrated that even slight intestinal inflammation results in the majority of stool-derived DNA to be of leukocyte origin. Overall, our results show the assay pipeline can accurately and precisely determine the proportion of leukocytes from low levels of DNA.</p>
<sec id="s4-1">
<title>Demonstration of cost-effectiveness</title>
<p>Cost-effectiveness is crucial in screening assay design; an assay that is too expensive to run has limited clinical value regardless of its performance metrics. The total reagent cost of performing either the <italic>HOXA3</italic> or <italic>MAP4K1</italic> dual-index PCR is the sum of costs for DNA extraction, bisulfite conversion, PCR amplification, and DNA sequencing per sample (<xref ref-type="table" rid="T2">Tables 2</xref>, <xref ref-type="table" rid="T3">3</xref>). The per-sample cost is dramatically reduced as more individual samples are multiplexed together; thus, the high-throughput nature of the assay enables consumable cost reduction, down to $23 NZD per stool sample or $11 NZD per breastmilk sample.</p>
<table-wrap id="T2" position="float">
<label>TABLE 2</label>
<caption>
<p>Total reagent cost of performing the <italic>HOXA3</italic> and <italic>MAP4K1</italic> bisulfite amplicon sequencing assay. Per-sample costs are calculated as the total cost of purchasing the reagent divided by the proportion of the reagent used for a single reaction. Kit prices are at retail price. All costs are in New Zealand Dollars (NZD).</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left">Reagent</th>
<th align="left">Use</th>
<th align="left">Total cost</th>
<th align="left">Number of reactions</th>
<th align="left">Cost per sample</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">Zymo Research&#x2122; Quick-DNA Fecal/Soil Microbe Miniprep Kit</td>
<td align="left">DNA extraction</td>
<td align="left">$604.00</td>
<td align="left">50</td>
<td align="left">$12.08</td>
</tr>
<tr>
<td align="left">Zymo EZ-DNA Methylation Direct MagPrep kit (4 &#xd7; 96 reactions)</td>
<td align="left">Bisulfite conversion</td>
<td align="left">$1,349.00</td>
<td align="left">384</td>
<td align="left">$3.51</td>
</tr>
<tr>
<td align="left">PCR reagents</td>
<td align="left">PCR amplification</td>
<td align="left">$540.00</td>
<td align="left">100</td>
<td align="left">$5.40</td>
</tr>
<tr>
<td align="left">iSeq100 v2 cartridge and flow cell</td>
<td align="left">DNA Sequencing</td>
<td align="left">$990.00</td>
<td align="left">1</td>
<td align="left">varies</td>
</tr>
</tbody>
</table>
</table-wrap>
<table-wrap id="T3" position="float">
<label>TABLE 3</label>
<caption>
<p>The cost per sample of the <italic>HOXA3</italic> and <italic>MAP4K1</italic> bisulfite amplicon sequencing assay. Breastmilk cell lysis is performed in conjunction with the bisulfite conversion as part of the Zymo EZ-DNA Methylation Direct MagPrep kit. All costs are in New Zealand Dollars (NZD).</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left">Sample type</th>
<th align="left">Number of multiplex sequencing samples</th>
<th align="left">Per sample DNA extraction cost</th>
<th align="left">Per sample bisulfite conversion cost</th>
<th align="left">Per sample PCR amplification cost</th>
<th align="left">Per sample DNA sequencing cost</th>
<th align="left">Total per sample cost</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td rowspan="4" align="left">Stool</td>
<td align="left">50</td>
<td align="left">$12.08</td>
<td align="left">$3.51</td>
<td align="left">$5.40</td>
<td align="left">$19.80</td>
<td align="left">$40.79</td>
</tr>
<tr>
<td align="left">100</td>
<td align="left">$12.08</td>
<td align="left">$3.51</td>
<td align="left">$5.40</td>
<td align="left">$9.90</td>
<td align="left">$30.89</td>
</tr>
<tr>
<td align="left">250</td>
<td align="left">$12.08</td>
<td align="left">$3.51</td>
<td align="left">$5.40</td>
<td align="left">$3.96</td>
<td align="left">$24.95</td>
</tr>
<tr>
<td align="left">500</td>
<td align="left">$12.08</td>
<td align="left">$3.51</td>
<td align="left">$5.40</td>
<td align="left">$1.98</td>
<td align="left">$22.97</td>
</tr>
<tr>
<td rowspan="4" align="left">Breastmilk</td>
<td align="left">50</td>
<td align="left">-</td>
<td align="left">$3.51</td>
<td align="left">$5.40</td>
<td align="left">$19.80</td>
<td align="left">$28.71</td>
</tr>
<tr>
<td align="left">100</td>
<td align="left">-</td>
<td align="left">$3.51</td>
<td align="left">$5.40</td>
<td align="left">$9.90</td>
<td align="left">$18.81</td>
</tr>
<tr>
<td align="left">250</td>
<td align="left">-</td>
<td align="left">$3.51</td>
<td align="left">$5.40</td>
<td align="left">$3.96</td>
<td align="left">$12.87</td>
</tr>
<tr>
<td align="left">500</td>
<td align="left">-</td>
<td align="left">$3.51</td>
<td align="left">$5.40</td>
<td align="left">$1.98</td>
<td align="left">$10.89</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s4-2">
<title>High-throughput assaying of leukocyte fractions in human breastmilk</title>
<p>Leukocytes comprise a relatively small proportion of cells within human breastmilk. For example, in colostrum, leukocytes make up 8%&#x2013;10% of total cells but are drastically reduced to approximately 1% of cells after 1-week post-partum (<xref ref-type="bibr" rid="B21">Hassiotou et al., 2013a</xref>; <xref ref-type="bibr" rid="B61">Trend et al., 2015</xref>). However, the fraction of leukocytes increases during illness to the mother or child, with the highest increase attributed to mastitis, where the percentage can exceed 90% (<xref ref-type="bibr" rid="B21">Hassiotou et al., 2013a</xref>). Thus, leukocyte proportions are an adequate measure of the overall health of the mother/infant dyad.</p>
<p>We applied the <italic>HOXA3</italic> and <italic>MAP4K1</italic> DNA methylation biomarkers (<xref ref-type="bibr" rid="B13">Dunnet et al., 2022</xref>) to milk samples collected from one individual during a lengthy bout of mastitis and were able to track increases and decreases in the leukocyte fraction with considerable consistency between the two biomarker loci. At times during the study period, leukocyte proportions approached normal baseline levels (<xref ref-type="fig" rid="F2">Figure 2D</xref>); however, mostly we recorded high leukocyte production on account of the ongoing infection and injury.</p>
<p>Over the timepoints where breast-of-origin for milk samples could be tracked, we observed clear differences in leukocyte proportions. The primary site of mastitis (the left breast) maintained very high leukocyte levels throughout the peak of infection and in the days immediately following. Interestingly however, milk from the unaffected right breast produced greater than 90% leukocytes at the peak of the infection in the left breast (<xref ref-type="fig" rid="F2">Figure 2A</xref>), but this dropped to 60% in the days immediately following infection.</p>
<p>Previous studies have shown that the levels of leukocytes in breastmilk increase when either the mother or infant is unwell and are dependent on the illness (<xref ref-type="bibr" rid="B21">Hassiotou et al., 2013a</xref>). Gastrointestinal infections and vaginal thrush in the mother induce small increases in leukocyte fraction, as do infant-only infections. However, illness in the mother can induce an increase in leukocyte fractions (<xref ref-type="bibr" rid="B21">Hassiotou et al., 2013a</xref>). When the mother has mastitis, leukocyte proportions in the unaffected breast have been reported to increase above baseline levels (<xref ref-type="bibr" rid="B21">Hassiotou et al., 2013a</xref>). In our time series, the unaffected right breast had a greatly elevated proportion of leukocytes, perhaps indicative of a non-symptomatic infection or injury in that breast.</p>
<p>Leukocyte fractions in breastmilk have been suggested as a diagnostic marker to assess the health of mother/infant dyads (<xref ref-type="bibr" rid="B21">Hassiotou et al., 2013a</xref>). However, cellular composition studies employing flow cytometry often only examine milk from one or two timepoints (<xref ref-type="bibr" rid="B52">Riskin et al., 2012</xref>; <xref ref-type="bibr" rid="B25">Indumathi et al., 2013</xref>). One study on mastitis follows a case/control study design but does not explore the initiation and recovery from mastitis (<xref ref-type="bibr" rid="B52">Riskin et al., 2012</xref>). Furthermore, longitudinal studies frequently collect samples weeks apart (<xref ref-type="bibr" rid="B21">Hassiotou et al., 2013a</xref>; <xref ref-type="bibr" rid="B61">Trend et al., 2015</xref>; <xref ref-type="bibr" rid="B22">Hassiotou et al., 2013b</xref>; <xref ref-type="bibr" rid="B43">Nyquist et al., 2022</xref>). Given that the cellular components of human breastmilk are dynamic based on the stage of lactation (<xref ref-type="bibr" rid="B61">Trend et al., 2015</xref>), degree of breast fullness (<xref ref-type="bibr" rid="B22">Hassiotou et al., 2013b</xref>), infant feeding habits (<xref ref-type="bibr" rid="B68">Witkowska-Zimny and Kaminska-El-Hassan, 2017</xref>), the health of the mother infant dyad (<xref ref-type="bibr" rid="B21">Hassiotou et al., 2013a</xref>), and that the macronutrients within breastmilk are variable throughout the day (<xref ref-type="bibr" rid="B19">Hahn-Holbrook et al., 2019</xref>; <xref ref-type="bibr" rid="B49">Paulaviciene et al., 2020</xref>), it is not unexpected that the cell proportions of breastmilk change on a near daily basis. Indeed, the breastmilk samples employed in this study were collected almost daily over a 1-month period where continuous collection enabled the tracking of marked leukocyte dynamics within very short timeframes. High-throughput technology such as DNA methylation biomarkers can enable extensive sampling of breastmilk to characterise the cellular dynamics before, during, and after mastitis events with minimal cost and resources. While the process of bisulphite conversion and DNA sequencing is more time-consuming than flow cytometry for individual samples, batch testing of hundreds of samples simultaneously affords considerable efficiency of testing. As such, there is potential for this technology to be applied in a population-wide screen to track breast-related illness in lactating mothers or to further the understanding of the events leading up to mastitis provides more opportunities to prevent severe illness and guide treatment protocol.</p>
</sec>
<sec id="s4-3">
<title>Benchmarking a DNA methylation-based assay for the detection of leukocytes in stool against the faecal calprotectin assay</title>
<p>Stool is a tissue source for identifying intestinal tract pathologies and the clinical benefits of the FCA are well documented. For example, it may be used to aid diagnosis of infection (<xref ref-type="bibr" rid="B58">S&#xfd;kora et al., 2010</xref>; <xref ref-type="bibr" rid="B57">Shastri et al., 2008</xref>), colorectal cancer (<xref ref-type="bibr" rid="B64">von Roon et al., 2007</xref>), coeliac disease (<xref ref-type="bibr" rid="B15">Ertekin et al., 2010</xref>), or inflammatory bowel disease (IBD) (<xref ref-type="bibr" rid="B32">Laserna-Mendieta and Lucendo, 2019</xref>; <xref ref-type="bibr" rid="B2">Ayling and Kok, 2018</xref>). While FCAs often do not determine the cause of inflammation, they are extensively used because of their ability to distinguish between IBD and functional bowel disorders, such as irritable bowel syndrome (IBS) (<xref ref-type="bibr" rid="B3">Banerjee et al., 2015</xref>).</p>
<p>Inflammatory bowel disease describes a group of chronic inflammatory diseases affecting the gastrointestinal tract. There are two main types of IBD: ulcerative colitis (UC) and Crohn&#x2019;s disease (CD). Ulcerative colitis explicitly occurs in the colon and manifests as inflammation of the mucosal layer, while CD can present in any area of the gastrointestinal tract and is distinguished by granulomatous inflammation that can penetrate deep into the surrounding tissues (<xref ref-type="bibr" rid="B2">Ayling and Kok, 2018</xref>; <xref ref-type="bibr" rid="B39">Matsuoka and Kanai, 2015</xref>; <xref ref-type="bibr" rid="B4">Baumgart and Carding, 2007</xref>). In contrast, IBS has no identifiable pathophysiological features, and accordingly, no inflammation (<xref ref-type="bibr" rid="B56">Saha, 2014</xref>). Despite this, abdominal pain and diarrhoea are common symptoms in both IBD and IBS. Therefore, an endoscopy, occasionally followed by a histological examination of biopsied tissue, is required to diagnose IBD (<xref ref-type="bibr" rid="B5">Bharadwaj et al., 2018</xref>). Unfortunately, endoscopies are time-consuming, highly invasive for the patient (with some risk of complications), and require healthcare resources (<xref ref-type="bibr" rid="B17">Fisher et al., 2011</xref>). Using faecal calprotectin to distinguish between IBD and IBS minimises unnecessary endoscopies by screening prospective patients and monitoring patient remission to ensure that current treatment regimens are effective (<xref ref-type="bibr" rid="B2">Ayling and Kok, 2018</xref>; <xref ref-type="bibr" rid="B62">van Rheenen et al., 2010</xref>). Several meta-analyses have reported high sensitivities and excellent negative predictive values for the FCA (reviewed in <xref ref-type="bibr" rid="B32">Laserna-Mendieta and Lucendo (2019)</xref>) for diagnosing and monitoring IBD.</p>
</sec>
<sec id="s4-4">
<title>Rational for benchmarking a new intestinal inflammation detection tool</title>
<p>While the FCA has clinical utility when IBD is suspected, several limitations exist. Most commercial assays recommend &#x2265;50&#xa0;&#x3bc;g/g of calprotectin as the threshold for a positive test (<xref ref-type="bibr" rid="B2">Ayling and Kok, 2018</xref>). However, young children and adults over 65 have a higher baseline faecal calprotectin level. An initial meta-analysis suggested that the sensitivity of the FCA was significantly reduced in paediatric populations (<xref ref-type="bibr" rid="B62">van Rheenen et al., 2010</xref>). Contrary to this, more recent meta-analyses demonstrate that paediatric sensitivity is high (0.97&#x2013;0.98) but specificity is reduced in comparison to adults for a 50&#xa0;&#x3bc;g/g cut-off (<xref ref-type="bibr" rid="B32">Laserna-Mendieta and Lucendo, 2019</xref>; <xref ref-type="bibr" rid="B11">Degraeuwe et al., 2015</xref>; <xref ref-type="bibr" rid="B24">Henderson et al., 2014</xref>). The FCA has a lower sensitivity for adults over 65, resulting in lower diagnostic accuracy in this demographic (<xref ref-type="bibr" rid="B48">Padoan et al., 2018</xref>). Several studies have proposed various increases to cut-off thresholds in these groups, but these have not yet been implemented in a clinical setting (<xref ref-type="bibr" rid="B48">Padoan et al., 2018</xref>; <xref ref-type="bibr" rid="B27">Joshi et al., 2010</xref>; <xref ref-type="bibr" rid="B40">Mindemark and Larsson, 2012</xref>; <xref ref-type="bibr" rid="B16">Ezri and Nydegger, 2011</xref>). The exact reason elderly individuals have an increase in faecal calprotectin is currently unknown; however, one possible explanation is &#x2018;inflammaging&#x2019; &#x2013; an age-associated low-grade chronic inflammation in the absence of infection (<xref ref-type="bibr" rid="B36">Leonardi et al., 2018</xref>). In our study, methylation-based analysis detected a leukocyte signal in faecal samples that had a negative FCA result. Our previous work (<xref ref-type="bibr" rid="B13">Dunnet et al., 2022</xref>) showed specificity of the methylation pattern to leukocytes, whereas calprotectin is relatively specific to neutrophils raising the possibilities that we have detected non-neutrophlic leukocytes, such as monocyte/macrophages, eosinophils or lymphocytes. Alternatively the negative FCA result might reflect some of the factors that result in its low sensitivity.</p>
<p>The stability of faecal calprotectin over time has been extensively studied since the test was first proposed. An initial study reported that faecal calprotectin is stable at room temperature for up to 7&#xa0;days (<xref ref-type="bibr" rid="B54">R&#xf8;seth et al., 1992</xref>). Since then, several studies have shown that calprotectin is significantly degraded after 48&#x2013;72&#xa0;h at 20&#xb0;C (<xref ref-type="bibr" rid="B20">Haisma et al., 2019</xref>; <xref ref-type="bibr" rid="B33">Lasson et al., 2015</xref>; <xref ref-type="bibr" rid="B47">Oyaert et al., 2017</xref>). Storage at 4&#xb0;C significantly reduces sample degradation for up to a week (<xref ref-type="bibr" rid="B20">Haisma et al., 2019</xref>). Calprotectin stability may prove problematic when samples must be transported long distances to testing facilities (for example, from rural communities) unless samples can be chilled during travel. In contrast, DNA methylation is a very stable epigenetic mark, although DNA itself is susceptible to hydrolysis when stored in an aqueous solution. However, storage of DNA in an appropriate conservation buffer can drastically decrease degradation. For example, in an experiment measuring DNA stability in stool samples, <xref ref-type="bibr" rid="B46">Olson et al. (2005)</xref> (<xref ref-type="bibr" rid="B46">Olson et al., 2005</xref>) show no DNA loss after 144&#xa0;h of storage (the longest time point measured) at room temperature in three of four buffers tested. Their data suggest that DNA can be stable at least twice as long as calprotectin at room temperature.</p>
<p>Measuring faecal calprotectin is performed with an enzyme immunoassay, and each manufacturer uses unique proprietary antibodies. Different FCAs correlate well to patient outcomes, but absolute values cannot be compared between assays (<xref ref-type="bibr" rid="B32">Laserna-Mendieta and Lucendo, 2019</xref>; <xref ref-type="bibr" rid="B2">Ayling and Kok, 2018</xref>). For example, one study showed a 3.8-fold difference in the amount of calprotectin measured by different assays in a quality assurance scheme sample (<xref ref-type="bibr" rid="B66">Whitehead et al., 2013</xref>), while significant inter-assay differences have been observed in paediatric and adult IBD cases (<xref ref-type="bibr" rid="B28">Kittanakom et al., 2017</xref>; <xref ref-type="bibr" rid="B30">Labaere et al., 2014</xref>). Therefore, to achieve accurate follow-up testing during patient treatment, medical testing facilities must use a standardised FCA (<xref ref-type="bibr" rid="B2">Ayling and Kok, 2018</xref>). Alternatively, this may be alleviated with an open-source PCR-based DNA methylation assay where primer sequences and reaction conditions are known.</p>
<p>Calprotectin is also elevated in patients with pancreatic insufficiency (such as those with cystic fibrosis) (<xref ref-type="bibr" rid="B14">Ellemunter et al., 2017</xref>). This is likely due to a reduction of trypsin, which readily degrades calprotectin (<xref ref-type="bibr" rid="B12">Dumoulin et al., 2015</xref>). Here, a DNA methylation-based approach to identify leukocyte DNA might provide a more accurate representation than faecal calprotectin.</p>
<p>In healthy individuals, host DNA in stool is thought to predominately originate from sloughed colonic epithelial cells (<xref ref-type="bibr" rid="B23">He et al., 2019</xref>); however, cancers of the intestinal tract also shed DNA into the intestinal lumen (<xref ref-type="bibr" rid="B67">Whitney et al., 2004</xref>). Amplification of stool-derived DNA has been proposed as a non-invasive cancer detection tool (<xref ref-type="bibr" rid="B41">Mojtabanezhad Shariatpanahi et al., 2018</xref>). We hypothesized that the <italic>MAP4K1</italic> pan-leukocyte DNA biomarker coupled with the our high-throughput pipeline would detect an increase in leukocytes during inflammation which may be clinically relevant. Indeed, the high level of agreement between our pipeline and the FCA emphasises its clinical potential. We have shown that under even mild inflammatory states (as assessed by FCA), DNA from leukocytes is the dominant fraction of human-derived DNA. Interestingly, low calprotectin stool samples (under 50&#xa0;&#x3bc;g/g) exhibited extremely variable proportions of leukocytes. This observation could be the result of a relatively low amount of sloughed epithelial cells such that even minor increases in leukocytes dramatically alters the overall proportion of cell types in each sample. Alternatively, this could be attributed to imprecisions in either the faecal calprotectin or DNA methylation assays. Patients with high levels of intestinal inflammation contain increased human DNA in their stool (<xref ref-type="bibr" rid="B63">Vincent et al., 2015</xref>), so it is likely the assay will perform better under higher levels of inflammation where more DNA is accessible for amplification. The FCA has high negative predictive value, but has been reported to generate a significant number of false positives (<xref ref-type="bibr" rid="B18">Freeman et al., 2021</xref>). As such, one possible application of our pipeline is for it to be used in tandem with the FCA to reduce the number of false positive results and subsequently the number of patients requiring an endoscopy.</p>
</sec>
</sec>
<sec sec-type="conclusion" id="s5">
<title>Conclusion</title>
<p>In conclusion, we have applied a high-throughput, cost-effective DNA methylation biomarker pipeline to identify leukocytes from a mixed tissue. By employing a rapid sampling approach, we show that leukocyte proportions in breastmilk vary greatly with short periods of time. Leukocyte proportions in breastmilk are a useful health indictor of the mother/infant dyad, so a rapid sampling approach may provide the most accurate clinical information in this context. In addition, we have also shown that leukocyte-derived DNA can be detected in stool using our pipeline. We observed that even with low levels of intestinal inflammation as measured by faecal calprotectin, leukocyte-derived DNA dominates the human DNA fraction in stool samples.</p>
</sec>
</body>
<back>
<sec sec-type="data-availability" id="s6">
<title>Data availability statement</title>
<p>The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: <ext-link ext-link-type="uri" xlink:href="https://github.com/TimHore-Otago/Dunnet_NZ_Pan-leukocyte_Inflammation_Biomarkers">https://github.com/TimHore-Otago/Dunnet_NZ_Pan-leukocyte_Inflammation_Biomarkers</ext-link>.</p>
</sec>
<sec sec-type="ethics-statement" id="s7">
<title>Ethics statement</title>
<p>The use of human stool samples was approved by the University of Otago Human Ethics Committee (Health) (approval number H21/138). Human breastmilk and saliva were collected from the researchers with informed consent. The studies were conducted in accordance with the local legislation and institutional requirements.</p>
</sec>
<sec sec-type="author-contributions" id="s8">
<title>Author contributions</title>
<p>MD: Data curation, Formal Analysis, Investigation, Methodology, Project administration, Resources, Software, Validation, Visualization, Writing&#x2013;original draft, Writing&#x2013;review and editing. IM: Conceptualization, Resources, Supervision, Writing&#x2013;review and editing. DB: Conceptualization, Data curation, Investigation, Methodology, Project administration, Supervision, Writing&#x2013;review and editing, Formal Analysis, Software. TH: Conceptualization, Funding acquisition, Project administration, Resources, Supervision, Writing&#x2013;review and editing, Methodology, Software.</p>
</sec>
<sec sec-type="funding-information" id="s9">
<title>Funding</title>
<p>The author(s) declare that financial support was received for the research, authorship, and/or publication of this article. This study was funded by the University of Otago.</p>
</sec>
<ack>
<p>We thank Awanui Labs (formerly Southern Community Laboratories) for providing faecal calprotectin samples, and Jisha Antony for supplying K562 cells.</p>
</ack>
<sec sec-type="COI-statement" id="s10">
<title>Conflict of interest</title>
<p>TH and DB are shareholders and directors of Totovision/Totogen Ltd, a small agricultural and biotechnology consultancy.</p>
<p>The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec sec-type="ai-statement" id="s11">
<title>Generative AI statement</title>
<p>The author(s) declare that no Generative AI was used in the creation of this manuscript.</p>
</sec>
<sec sec-type="disclaimer" id="s12">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s13">
<title>Abbreviations</title>
<p>CpG, CG dinucleotide; cfDNA, cell-free DNA; FCA, Faecal Calprotectin Assay; ROC, Receiver Operating Characteristic; AUC, Area Under the Curve; IBD, Inflammatory Bowel Disease; IBS, Irritable Bowel Syndrome; UC, Ulcerative Colitis; CD, Crohn&#x2019;s Disease; PEG, polyethylene glycol.</p>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Anderton</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Wicks</surname>
<given-names>I. P.</given-names>
</name>
<name>
<surname>Silke</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Cell death in chronic inflammation: breaking the cycle to treat rheumatic disease</article-title>. <source>Nat. Rev. Rheumatol.</source> <volume>16</volume> (<issue>9</issue>), <fpage>496</fpage>&#x2013;<lpage>513</lpage>. <pub-id pub-id-type="doi">10.1038/s41584-020-0455-8</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ayling</surname>
<given-names>R. M.</given-names>
</name>
<name>
<surname>Kok</surname>
<given-names>K.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Fecal calprotectin</article-title>. <source>Adv. Clin. Chem.</source> <volume>87</volume>, <fpage>161</fpage>&#x2013;<lpage>190</lpage>. <pub-id pub-id-type="doi">10.1016/bs.acc.2018.07.005</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Banerjee</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Srinivas</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Eyre</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Ellis</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Waugh</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Bardhan</surname>
<given-names>K. D.</given-names>
</name>
<etal/>
</person-group> (<year>2015</year>). <article-title>Faecal calprotectin for differentiating between irritable bowel syndrome and inflammatory bowel disease: a useful screen in daily gastroenterology practice</article-title>. <source>Frontline gastroenterol.</source> <volume>6</volume> (<issue>1</issue>), <fpage>20</fpage>&#x2013;<lpage>26</lpage>. <pub-id pub-id-type="doi">10.1136/flgastro-2013-100429</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Baumgart</surname>
<given-names>D. C.</given-names>
</name>
<name>
<surname>Carding</surname>
<given-names>S. R.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Inflammatory bowel disease: cause and immunobiology</article-title>. <source>Lancet</source> <volume>369</volume> (<issue>9573</issue>), <fpage>1627</fpage>&#x2013;<lpage>1640</lpage>. <pub-id pub-id-type="doi">10.1016/s0140-6736(07)60750-8</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bharadwaj</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Narula</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Tandon</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Yaghoobi</surname>
<given-names>M.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Role of endoscopy in inflammatory bowel disease</article-title>. <source>Gastroenterol. Rep.</source> <volume>6</volume> (<issue>2</issue>), <fpage>75</fpage>&#x2013;<lpage>82</lpage>. <pub-id pub-id-type="doi">10.1093/gastro/goy006</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bjarnason</surname>
<given-names>I.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>The use of fecal calprotectin in inflammatory bowel disease</article-title>. <source>Gastroenterol. Hepatol. (N Y).</source> <volume>13</volume> (<issue>1</issue>), <fpage>53</fpage>&#x2013;<lpage>56</lpage>.</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Boakes</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Woods</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Johnson</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Kadoglou</surname>
<given-names>N.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Breast infection: a review of diagnosis and management practices</article-title>. <source>Eur. J. breast health</source> <volume>14</volume> (<issue>3</issue>), <fpage>136</fpage>&#x2013;<lpage>143</lpage>. <pub-id pub-id-type="doi">10.5152/ejbh.2018.3871</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Casellas</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Antol&#x131;&#x301;n</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Varela</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Garc&#x131;&#x301;a-lafuente</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Guarner</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Borruel</surname>
<given-names>N.</given-names>
</name>
<etal/>
</person-group> (<year>2004</year>). <article-title>Fecal excretion of human deoxyribonucleic acid as an index of inflammatory activity in ulcerative colitis</article-title>. <source>Clin. Gastroenterology Hepatology</source> <volume>2</volume> (<issue>8</issue>), <fpage>683</fpage>&#x2013;<lpage>689</lpage>. <pub-id pub-id-type="doi">10.1016/s1542-3565(04)00291-5</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cheng</surname>
<given-names>A. P.</given-names>
</name>
<name>
<surname>Cheng</surname>
<given-names>M. P.</given-names>
</name>
<name>
<surname>Gu</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Sesing Lenz</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Hsu</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Schurr</surname>
<given-names>E.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Cell-free DNA tissues of origin by methylation profiling reveals significant cell, tissue, and organ-specific injury related to COVID-19 severity</article-title>. <source>Med</source> <volume>2</volume> (<issue>4</issue>), <fpage>411</fpage>&#x2013;<lpage>422.e5</lpage>. <pub-id pub-id-type="doi">10.1016/j.medj.2021.01.001</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cisneros-Villanueva</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Hidalgo-P&#xe9;rez</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Rios-Romero</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Cedro-Tanda</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Ruiz-Villavicencio</surname>
<given-names>C. A.</given-names>
</name>
<name>
<surname>Page</surname>
<given-names>K.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>Cell-free DNA analysis in current cancer clinical trials: a review</article-title>. <source>Br. J. cancer</source> <volume>126</volume> (<issue>3</issue>), <fpage>391</fpage>&#x2013;<lpage>400</lpage>. <pub-id pub-id-type="doi">10.1038/s41416-021-01696-0</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Degraeuwe</surname>
<given-names>P. L. J.</given-names>
</name>
<name>
<surname>Beld</surname>
<given-names>M. P. A.</given-names>
</name>
<name>
<surname>Ashorn</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Canani</surname>
<given-names>R. B.</given-names>
</name>
<name>
<surname>Day</surname>
<given-names>A. S.</given-names>
</name>
<name>
<surname>Diamanti</surname>
<given-names>A.</given-names>
</name>
<etal/>
</person-group> (<year>2015</year>). <article-title>Faecal calprotectin in suspected paediatric inflammatory bowel disease</article-title>. <source>J. Pediatr. Gastroenterology Nutr.</source> <volume>60</volume> (<issue>3</issue>), <fpage>339</fpage>&#x2013;<lpage>346</lpage>. <pub-id pub-id-type="doi">10.1097/mpg.0000000000000615</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dumoulin</surname>
<given-names>E. N.</given-names>
</name>
<name>
<surname>Van Biervliet</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Langlois</surname>
<given-names>M. R.</given-names>
</name>
<name>
<surname>Delanghe</surname>
<given-names>J. R.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Proteolysis is a confounding factor in the interpretation of faecal calprotectin</article-title>. <source>Clin. Chem. Laboratory Med. (CCLM)</source> <volume>53</volume> (<issue>1</issue>), <fpage>65</fpage>&#x2013;<lpage>71</lpage>. <pub-id pub-id-type="doi">10.1515/cclm-2014-0568</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dunnet</surname>
<given-names>M. J.</given-names>
</name>
<name>
<surname>Ortega-Recalde</surname>
<given-names>O. J.</given-names>
</name>
<name>
<surname>Waters</surname>
<given-names>S. A.</given-names>
</name>
<name>
<surname>Weeks</surname>
<given-names>R. J.</given-names>
</name>
<name>
<surname>Morison</surname>
<given-names>I. M.</given-names>
</name>
<name>
<surname>Hore</surname>
<given-names>T. A.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Leukocyte-specific DNA methylation biomarkers and their implication for pathological epigenetic analysis</article-title>. <source>Epigenetics Commun.</source> <volume>2</volume> (<issue>1</issue>), <fpage>5</fpage>. <pub-id pub-id-type="doi">10.1186/s43682-022-00011-z</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ellemunter</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Engelhardt</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Sch&#xfc;ller</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Steinkamp</surname>
<given-names>G.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Fecal calprotectin in cystic fibrosis and its relation to disease parameters: a longitudinal analysis for 12 years</article-title>. <source>J. Pediatr. Gastroenterology Nutr.</source> <volume>65</volume> (<issue>4</issue>), <fpage>438</fpage>&#x2013;<lpage>442</lpage>. <pub-id pub-id-type="doi">10.1097/mpg.0000000000001544</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ertekin</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Selimo&#x11f;lu</surname>
<given-names>M. A.</given-names>
</name>
<name>
<surname>Turgut</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Bakan</surname>
<given-names>N.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Fecal calprotectin concentration in celiac disease</article-title>. <source>J. Clin. gastroenterology</source> <volume>44</volume> (<issue>8</issue>), <fpage>544</fpage>&#x2013;<lpage>546</lpage>. <pub-id pub-id-type="doi">10.1097/mcg.0b013e3181cadbc0</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ezri</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Nydegger</surname>
<given-names>A.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>P&#xe9;diatrie. 4. La calprotectine f&#xe9;cale en p&#xe9;diatrie: utilisation et interpr&#xe9;tation</article-title>. <source>Rev. M&#xe9;dicale Suisse</source> <volume>7</volume> (<issue>277</issue>), <fpage>69</fpage>&#x2013;<lpage>70</lpage>. <pub-id pub-id-type="doi">10.53738/revmed.2011.7.277.0069</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fisher</surname>
<given-names>D. A.</given-names>
</name>
<name>
<surname>Maple</surname>
<given-names>J. T.</given-names>
</name>
<name>
<surname>Ben-Menachem</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Cash</surname>
<given-names>B. D.</given-names>
</name>
<name>
<surname>Decker</surname>
<given-names>G. A.</given-names>
</name>
<name>
<surname>Early</surname>
<given-names>D. S.</given-names>
</name>
<etal/>
</person-group> (<year>2011</year>). <article-title>Complications of colonoscopy</article-title>. <source>Gastrointest. Endosc.</source> <volume>74</volume> (<issue>4</issue>), <fpage>745</fpage>&#x2013;<lpage>752</lpage>. <pub-id pub-id-type="doi">10.1016/j.gie.2011.07.025</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Freeman</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Taylor-Phillips</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Willis</surname>
<given-names>B. H.</given-names>
</name>
<name>
<surname>Ryan</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Clarke</surname>
<given-names>A.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Test accuracy of faecal calprotectin for inflammatory bowel disease in UK primary care: a retrospective cohort study of the THIN data</article-title>. <source>BMJ open</source> <volume>11</volume> (<issue>2</issue>), <fpage>e044177</fpage>. <pub-id pub-id-type="doi">10.1136/bmjopen-2020-044177</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hahn-Holbrook</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Saxbe</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Bixby</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Steele</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Glynn</surname>
<given-names>L.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Human milk as &#x201c;chrononutrition&#x201d;: implications for child health and development</article-title>. <source>Pediatr. Res.</source> <volume>85</volume> (<issue>7</issue>), <fpage>936</fpage>&#x2013;<lpage>942</lpage>. <pub-id pub-id-type="doi">10.1038/s41390-019-0368-x</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Haisma</surname>
<given-names>S. M.</given-names>
</name>
<name>
<surname>Verkade</surname>
<given-names>H. J.</given-names>
</name>
<name>
<surname>Scheenstra</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>van der Doef</surname>
<given-names>H. P. J.</given-names>
</name>
<name>
<surname>Bodewes</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>van Rheenen</surname>
<given-names>P. F.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Time-to-reach target calprotectin level in newly diagnosed patients with inflammatory bowel disease</article-title>. <source>J. Pediatr. Gastroenterol. Nutr.</source> <volume>69</volume> (<issue>4</issue>), <fpage>466</fpage>&#x2013;<lpage>473</lpage>. <pub-id pub-id-type="doi">10.1097/mpg.0000000000002458</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hassiotou</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Hepworth</surname>
<given-names>A. R.</given-names>
</name>
<name>
<surname>Metzger</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Tat Lai</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Trengove</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Hartmann</surname>
<given-names>P. E.</given-names>
</name>
<etal/>
</person-group> (<year>2013a</year>). <article-title>Maternal and infant infections stimulate a rapid leukocyte response in breastmilk</article-title>. <source>Clin. and Transl. Immunol.</source> <volume>2</volume> (<issue>4</issue>), <fpage>e3</fpage>&#x2013;<lpage>e</lpage>. <pub-id pub-id-type="doi">10.1038/cti.2013.1</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hassiotou</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Hepworth</surname>
<given-names>A. R.</given-names>
</name>
<name>
<surname>Williams</surname>
<given-names>T. M.</given-names>
</name>
<name>
<surname>Twigger</surname>
<given-names>A.-J.</given-names>
</name>
<name>
<surname>Perrella</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Lai</surname>
<given-names>C. T.</given-names>
</name>
<etal/>
</person-group> (<year>2013b</year>). <article-title>Breastmilk cell and fat contents respond similarly to removal of breastmilk by the infant</article-title>. <source>PLOS ONE</source> <volume>8</volume> (<issue>11</issue>), <fpage>e78232</fpage>. <pub-id pub-id-type="doi">10.1371/journal.pone.0078232</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>He</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Fujiwara</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Zajac</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Sandford</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Reddy</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Choi</surname>
<given-names>S. W.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>A pipeline for faecal host DNA analysis by absolute quantification of LINE-1 and mitochondrial genomic elements using ddPCR</article-title>. <source>Sci. Rep.</source> <volume>9</volume> (<issue>1</issue>), <fpage>5599</fpage>. <pub-id pub-id-type="doi">10.1038/s41598-019-41753-6</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Henderson</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Anderson</surname>
<given-names>N. H.</given-names>
</name>
<name>
<surname>Wilson</surname>
<given-names>D. C.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>The diagnostic accuracy of fecal calprotectin during the investigation of suspected pediatric inflammatory bowel disease: a systematic review and meta-analysis</article-title>. <source>Am. J. Gastroenterology</source> <volume>109</volume> (<issue>5</issue>), <fpage>637</fpage>&#x2013;<lpage>645</lpage>. <pub-id pub-id-type="doi">10.1038/ajg.2013.131</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Indumathi</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Dhanasekaran</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Rajkumar</surname>
<given-names>J. S.</given-names>
</name>
<name>
<surname>Sudarsanam</surname>
<given-names>D.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Exploring the stem cell and non-stem cell constituents of human breast milk</article-title>. <source>Cytotechnology</source> <volume>65</volume> (<issue>3</issue>), <fpage>385</fpage>&#x2013;<lpage>393</lpage>. <pub-id pub-id-type="doi">10.1007/s10616-012-9492-8</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jha</surname>
<given-names>A. K.</given-names>
</name>
<name>
<surname>Chaudhary</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Dayal</surname>
<given-names>V. M.</given-names>
</name>
<name>
<surname>Kumar</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Jha</surname>
<given-names>S. K.</given-names>
</name>
<name>
<surname>Jha</surname>
<given-names>P.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Optimal cut-off value of fecal calprotectin for the evaluation of ulcerative colitis: an unsolved issue?</article-title> <source>JGH Open</source> <volume>2</volume> (<issue>5</issue>), <fpage>207</fpage>&#x2013;<lpage>213</lpage>. <pub-id pub-id-type="doi">10.1002/jgh3.12074</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Joshi</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Lewis</surname>
<given-names>S. J.</given-names>
</name>
<name>
<surname>Creanor</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Ayling</surname>
<given-names>R. M.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Age-related faecal calprotectin, lactoferrin and tumour M2-PK concentrations in healthy volunteers</article-title>. <source>Ann. Clin. Biochem. Int. J. Laboratory Med.</source> <volume>47</volume> (<issue>Pt 3</issue>), <fpage>259</fpage>&#x2013;<lpage>263</lpage>. <pub-id pub-id-type="doi">10.1258/acb.2009.009061</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kittanakom</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Shajib</surname>
<given-names>M. S.</given-names>
</name>
<name>
<surname>Garvie</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Turner</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Brooks</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Odeh</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2017</year>). <article-title>Comparison of fecal calprotectin methods for predicting relapse of pediatric inflammatory bowel disease</article-title>. <source>Can. J. Gastroenterology Hepatology</source> <volume>2017</volume>, <fpage>1</fpage>&#x2013;<lpage>10</lpage>. <pub-id pub-id-type="doi">10.1155/2017/1450970</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Krueger</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Andrews</surname>
<given-names>S. R.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Bismark: a flexible aligner and methylation caller for Bisulfite-Seq applications</article-title>. <source>Bioinformatics</source> <volume>27</volume> (<issue>11</issue>), <fpage>1571</fpage>&#x2013;<lpage>1572</lpage>. <pub-id pub-id-type="doi">10.1093/bioinformatics/btr167</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Labaere</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Smismans</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Van Olmen</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Christiaens</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>D&#x27;Haens</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Moons</surname>
<given-names>V.</given-names>
</name>
<etal/>
</person-group> (<year>2014</year>). <article-title>Comparison of six different calprotectin assays for the assessment of inflammatory bowel disease</article-title>. <source>United Eur. gastroenterology J.</source> <volume>2</volume> (<issue>1</issue>), <fpage>30</fpage>&#x2013;<lpage>37</lpage>. <pub-id pub-id-type="doi">10.1177/2050640613518201</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lam</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Luu</surname>
<given-names>P. L.</given-names>
</name>
<name>
<surname>Song</surname>
<given-names>J. Z.</given-names>
</name>
<name>
<surname>Qu</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Risbridger</surname>
<given-names>G. P.</given-names>
</name>
<name>
<surname>Lawrence</surname>
<given-names>M. G.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Comprehensive evaluation of targeted multiplex bisulphite PCR sequencing for validation of DNA methylation biomarker panels</article-title>. <source>Clin. Epigenetics</source> <volume>12</volume> (<issue>1</issue>), <fpage>90</fpage>. <pub-id pub-id-type="doi">10.1186/s13148-020-00880-y</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Laserna-Mendieta</surname>
<given-names>E. J.</given-names>
</name>
<name>
<surname>Lucendo</surname>
<given-names>A. J.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Faecal calprotectin in inflammatory bowel diseases: a review focused on meta-analyses and routine usage limitations</article-title>. <source>Clin. Chem. laboratory Med.</source> <volume>57</volume> (<issue>9</issue>), <fpage>1295</fpage>&#x2013;<lpage>1307</lpage>. <pub-id pub-id-type="doi">10.1515/cclm-2018-1063</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lasson</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Stotzer</surname>
<given-names>P.-O.</given-names>
</name>
<name>
<surname>&#xd6;hman</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Isaksson</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Sapnara</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Strid</surname>
<given-names>H.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>The intra-individual variability of faecal calprotectin: a prospective study in patients with active ulcerative colitis</article-title>. <source>J. Crohn&#x27;s and colitis</source> <volume>9</volume> (<issue>1</issue>), <fpage>26</fpage>&#x2013;<lpage>32</lpage>. <pub-id pub-id-type="doi">10.1016/j.crohns.2014.06.002</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lehmann-Werman</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Magenheim</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Moss</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Neiman</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Abraham</surname>
<given-names>O.</given-names>
</name>
<name>
<surname>Piyanzin</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Monitoring liver damage using hepatocyte-specific methylation markers in cell-free circulating DNA</article-title>. <source>JCI Insight</source> <volume>3</volume> (<issue>12</issue>), <fpage>e120687</fpage>. <pub-id pub-id-type="doi">10.1172/jci.insight.120687</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lehmann-Werman</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Neiman</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Zemmour</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Moss</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Magenheim</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Vaknin-Dembinsky</surname>
<given-names>A.</given-names>
</name>
<etal/>
</person-group> (<year>2016</year>). <article-title>Identification of tissue-specific cell death using methylation patterns of circulating DNA</article-title>. <source>Proc. Natl. Acad. Sci. U. S. A.</source> <volume>113</volume> (<issue>13</issue>), <fpage>E1826</fpage>&#x2013;<lpage>E1834</lpage>. <pub-id pub-id-type="doi">10.1073/pnas.1519286113</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Leonardi</surname>
<given-names>G. C.</given-names>
</name>
<name>
<surname>Accardi</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Monastero</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Nicoletti</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Libra</surname>
<given-names>M.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Ageing: from inflammation to cancer</article-title>. <source>Immun. and Ageing</source> <volume>15</volume> (<issue>1</issue>), <fpage>1</fpage>. <pub-id pub-id-type="doi">10.1186/s12979-017-0112-5</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lundgren</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Ekl&#xf6;f</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Palmqvist</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Hultdin</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Karling</surname>
<given-names>P.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Proton pump inhibitor use is associated with elevated faecal calprotectin levels. A cross-sectional study on subjects referred for colonoscopy</article-title>. <source>Scand. J. Gastroenterology</source> <volume>54</volume> (<issue>2</issue>), <fpage>152</fpage>&#x2013;<lpage>157</lpage>. <pub-id pub-id-type="doi">10.1080/00365521.2019.1566493</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Martin</surname>
<given-names>M.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Cutadapt removes adapter sequences from high-throughput sequencing reads</article-title>. <source>EMBnet.J.</source> <volume>17</volume> (<issue>1</issue>), <fpage>10</fpage>. <pub-id pub-id-type="doi">10.14806/ej.17.1.200</pub-id>
</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Matsuoka</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Kanai</surname>
<given-names>T.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>The gut microbiota and inflammatory bowel disease</article-title>. <source>Seminars Immunopathol.</source> <volume>37</volume> (<issue>1</issue>), <fpage>47</fpage>&#x2013;<lpage>55</lpage>. <pub-id pub-id-type="doi">10.1007/s00281-014-0454-4</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mindemark</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Larsson</surname>
<given-names>A.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Ruling out IBD: estimation of the possible economic effects of pre-endoscopic screening with F-calprotectin</article-title>. <source>Clin. Biochem.</source> <volume>45</volume> (<issue>7</issue>), <fpage>552</fpage>&#x2013;<lpage>555</lpage>. <pub-id pub-id-type="doi">10.1016/j.clinbiochem.2011.10.015</pub-id>
</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mojtabanezhad Shariatpanahi</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Yassi</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Nouraie</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Sahebkar</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Varshoee Tabrizi</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Kerachian</surname>
<given-names>M. A.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>The importance of stool DNA methylation in colorectal cancer diagnosis: a meta-analysis</article-title>. <source>PLoS One</source> <volume>13</volume> (<issue>7</issue>), <fpage>e0200735</fpage>. <pub-id pub-id-type="doi">10.1371/journal.pone.0200735</pub-id>
</citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Moss</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Magenheim</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Neiman</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Zemmour</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Loyfer</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Korach</surname>
<given-names>A.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Comprehensive human cell-type methylation atlas reveals origins of circulating cell-free DNA in health and disease</article-title>. <source>Nat. Commun.</source> <volume>9</volume> (<issue>1</issue>), <fpage>5068</fpage>. <pub-id pub-id-type="doi">10.1038/s41467-018-07466-6</pub-id>
</citation>
</ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nyquist</surname>
<given-names>S. K.</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Haining</surname>
<given-names>T. K. J.</given-names>
</name>
<name>
<surname>Retchin</surname>
<given-names>M. R.</given-names>
</name>
<name>
<surname>Golan</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Drake</surname>
<given-names>R. S.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>Cellular and transcriptional diversity over the course of human lactation</article-title>. <source>Proc. Natl. Acad. Sci. U. S. A.</source> <volume>119</volume> (<issue>15</issue>), <fpage>e2121720119</fpage>. <pub-id pub-id-type="doi">10.1073/pnas.2121720119</pub-id>
</citation>
</ref>
<ref id="B44">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Oberacker</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Stepper</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Bond</surname>
<given-names>D. M.</given-names>
</name>
<name>
<surname>H&#xf6;hn</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Focken</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Meyer</surname>
<given-names>V.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Bio-On-Magnetic-Beads (BOMB): open platform for high-throughput nucleic acid extraction and manipulation</article-title>. <source>PLOS Biol.</source> <volume>17</volume> (<issue>1</issue>), <fpage>e3000107</fpage>. <pub-id pub-id-type="doi">10.1371/journal.pbio.3000107</pub-id>
</citation>
</ref>
<ref id="B45">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Odink</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Cerletti</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Br&#xfc;ggen</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Clerc</surname>
<given-names>R. G.</given-names>
</name>
<name>
<surname>Tarcsay</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Zwadlo</surname>
<given-names>G.</given-names>
</name>
<etal/>
</person-group> (<year>1987</year>). <article-title>Two calcium-binding proteins in infiltrate macrophages of rheumatoid arthritis</article-title>. <source>Nature</source> <volume>330</volume> (<issue>6143</issue>), <fpage>80</fpage>&#x2013;<lpage>82</lpage>. <pub-id pub-id-type="doi">10.1038/330080a0</pub-id>
</citation>
</ref>
<ref id="B46">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Olson</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Whitney</surname>
<given-names>D. H.</given-names>
</name>
<name>
<surname>Durkee</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Shuber</surname>
<given-names>A. P.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>DNA stabilization is critical for maximizing performance of fecal DNA-based colorectal cancer tests</article-title>. <source>Diagn. Mol. Pathol.</source> <volume>14</volume> (<issue>3</issue>), <fpage>183</fpage>&#x2013;<lpage>191</lpage>. <pub-id pub-id-type="doi">10.1097/01.pas.0000176768.18423.7e</pub-id>
</citation>
</ref>
<ref id="B47">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Oyaert</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Van den Bremt</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Boel</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Bossuyt</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Van Hoovels</surname>
<given-names>L.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Do not forget about pre-analytics in faecal calprotectin measurement</article-title>. <source>Clin. Chim. Acta</source> <volume>473</volume>, <fpage>124</fpage>&#x2013;<lpage>126</lpage>. <pub-id pub-id-type="doi">10.1016/j.cca.2017.08.025</pub-id>
</citation>
</ref>
<ref id="B48">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Padoan</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>D&#x27;Inc&#xe0;</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Scapellato</surname>
<given-names>M. L.</given-names>
</name>
<name>
<surname>De Bastiani</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Caccaro</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Mescoli</surname>
<given-names>C.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Improving IBD diagnosis and monitoring by understanding preanalytical, analytical and biological fecal calprotectin variability</article-title>. <source>Clin. Chem. laboratory Med.</source> <volume>56</volume> (<issue>11</issue>), <fpage>1926</fpage>&#x2013;<lpage>1935</lpage>. <pub-id pub-id-type="doi">10.1515/cclm-2018-0134</pub-id>
</citation>
</ref>
<ref id="B49">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Paulaviciene</surname>
<given-names>I. J.</given-names>
</name>
<name>
<surname>Liubsys</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Molyte</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Eidukaite</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Usonis</surname>
<given-names>V.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Circadian changes in the composition of human milk macronutrients depending on pregnancy duration: a cross-sectional study</article-title>. <source>Int. Breastfeed. J.</source> <volume>15</volume> (<issue>1</issue>), <fpage>49</fpage>. <pub-id pub-id-type="doi">10.1186/s13006-020-00291-y</pub-id>
</citation>
</ref>
<ref id="B50">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pencovich</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Jaschek</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Tanay</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Groner</surname>
<given-names>Y.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Dynamic combinatorial interactions of RUNX1 and cooperating partners regulates megakaryocytic differentiation in cell line models</article-title>. <source>Blood</source> <volume>117</volume> (<issue>1</issue>), <fpage>e1</fpage>&#x2013;<lpage>e14</lpage>. <pub-id pub-id-type="doi">10.1182/blood-2010-07-295113</pub-id>
</citation>
</ref>
<ref id="B51">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ricciuto</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Griffiths</surname>
<given-names>A. M.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Clinical value of fecal calprotectin</article-title>. <source>Crit. Rev. Clin. laboratory Sci.</source> <volume>56</volume> (<issue>5</issue>), <fpage>307</fpage>&#x2013;<lpage>320</lpage>. <pub-id pub-id-type="doi">10.1080/10408363.2019.1619159</pub-id>
</citation>
</ref>
<ref id="B52">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Riskin</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Almog</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Peri</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Halasz</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Srugo</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Kessel</surname>
<given-names>A.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Changes in immunomodulatory constituents of human milk in response to active infection in the nursing infant</article-title>. <source>Pediatr. Res.</source> <volume>71</volume> (<issue>2</issue>), <fpage>220</fpage>&#x2013;<lpage>225</lpage>. <pub-id pub-id-type="doi">10.1038/pr.2011.34</pub-id>
</citation>
</ref>
<ref id="B53">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rogler</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Aldeguer</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Kruis</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Lasson</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Mittmann</surname>
<given-names>U.</given-names>
</name>
<name>
<surname>Nally</surname>
<given-names>K.</given-names>
</name>
<etal/>
</person-group> (<year>2013</year>). <article-title>Concept for a rapid point-of-care calprotectin diagnostic test for diagnosis and disease activity monitoring in patients with inflammatory bowel disease: expert clinical opinion</article-title>. <source>J. Crohn&#x27;s Colitis</source> <volume>7</volume> (<issue>8</issue>), <fpage>670</fpage>&#x2013;<lpage>677</lpage>. <pub-id pub-id-type="doi">10.1016/j.crohns.2013.02.014</pub-id>
</citation>
</ref>
<ref id="B54">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>R&#xf8;seth</surname>
<given-names>A. G.</given-names>
</name>
<name>
<surname>Fagerhol</surname>
<given-names>M. K.</given-names>
</name>
<name>
<surname>Aadland</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Schj&#xf8;nsby</surname>
<given-names>H.</given-names>
</name>
</person-group> (<year>1992</year>). <article-title>Assessment of the neutrophil dominating protein calprotectin in feces: a methodologic study</article-title>. <source>Scand. J. Gastroenterology</source> <volume>27</volume> (<issue>9</issue>), <fpage>793</fpage>&#x2013;<lpage>798</lpage>. <pub-id pub-id-type="doi">10.3109/00365529209011186</pub-id>
</citation>
</ref>
<ref id="B55">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>R&#xf8;seth Pnsmkf</surname>
<given-names>A. G.</given-names>
</name>
</person-group> (<year>1999</year>). <article-title>Correlation between faecal excretion of indium-111-labelled granulocytes and calprotectin, a granulocyte marker protein, in patients with inflammatory bowel disease</article-title>. <source>Scand. J. Gastroenterology</source> <volume>34</volume> (<issue>1</issue>), <fpage>50</fpage>&#x2013;<lpage>54</lpage>. <pub-id pub-id-type="doi">10.1080/00365529950172835</pub-id>
</citation>
</ref>
<ref id="B56">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Saha</surname>
<given-names>L.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Irritable bowel syndrome: pathogenesis, diagnosis, treatment, and evidence-based medicine</article-title>. <source>World J. gastroenterology</source> <volume>20</volume> (<issue>22</issue>), <fpage>6759</fpage>&#x2013;<lpage>6773</lpage>. <pub-id pub-id-type="doi">10.3748/wjg.v20.i22.6759</pub-id>
</citation>
</ref>
<ref id="B57">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shastri</surname>
<given-names>Y. M.</given-names>
</name>
<name>
<surname>Bergis</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Povse</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Sch&#xe4;fer</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Shastri</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Weindel</surname>
<given-names>M.</given-names>
</name>
<etal/>
</person-group> (<year>2008</year>). <article-title>Prospective multicenter study evaluating fecal calprotectin in adult acute bacterial diarrhea</article-title>. <source>Am. J. Med.</source> <volume>121</volume> (<issue>12</issue>), <fpage>1099</fpage>&#x2013;<lpage>1106</lpage>. <pub-id pub-id-type="doi">10.1016/j.amjmed.2008.06.034</pub-id>
</citation>
</ref>
<ref id="B58">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>S&#xfd;kora</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Siala</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Huml</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Varva&#x159;ovsk&#xe1;</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Schwarz</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Pomaha&#x10d;ov&#xe1;</surname>
<given-names>R.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Evaluation of faecal calprotectin as a valuable non-invasive marker in distinguishing gut pathogens in young children with acute gastroenteritis</article-title>. <source>Acta Paediatr. (Oslo, Nor. 1992)</source> <volume>99</volume> (<issue>9</issue>), <fpage>1389</fpage>&#x2013;<lpage>1395</lpage>. <pub-id pub-id-type="doi">10.1111/j.1651-2227.2010.01843.x</pub-id>
</citation>
</ref>
<ref id="B59">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Teschendorff</surname>
<given-names>A. E.</given-names>
</name>
<name>
<surname>Breeze</surname>
<given-names>C. E.</given-names>
</name>
<name>
<surname>Zheng</surname>
<given-names>S. C.</given-names>
</name>
<name>
<surname>Beck</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>A comparison of reference-based algorithms for correcting cell-type heterogeneity in Epigenome-Wide Association Studies</article-title>. <source>BMC Bioinforma.</source> <volume>18</volume> (<issue>1</issue>), <fpage>105</fpage>. <pub-id pub-id-type="doi">10.1186/s12859-017-1511-5</pub-id>
</citation>
</ref>
<ref id="B60">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Theda</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Hwang</surname>
<given-names>S. H.</given-names>
</name>
<name>
<surname>Czajko</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Loke</surname>
<given-names>Y. J.</given-names>
</name>
<name>
<surname>Leong</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Craig</surname>
<given-names>J. M.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Quantitation of the cellular content of saliva and buccal swab samples</article-title>. <source>Sci. Rep.</source> <volume>8</volume> (<issue>1</issue>), <fpage>6944</fpage>. <pub-id pub-id-type="doi">10.1038/s41598-018-25311-0</pub-id>
</citation>
</ref>
<ref id="B61">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Trend</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>de Jong</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Lloyd</surname>
<given-names>M. L.</given-names>
</name>
<name>
<surname>Kok</surname>
<given-names>C. H.</given-names>
</name>
<name>
<surname>Richmond</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Doherty</surname>
<given-names>D. A.</given-names>
</name>
<etal/>
</person-group> (<year>2015</year>). <article-title>Leukocyte populations in human preterm and term breast milk identified by multicolour flow cytometry</article-title>. <source>PLoS One</source> <volume>10</volume> (<issue>8</issue>), <fpage>e0135580</fpage>. <pub-id pub-id-type="doi">10.1371/journal.pone.0135580</pub-id>
</citation>
</ref>
<ref id="B62">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>van Rheenen</surname>
<given-names>P. F.</given-names>
</name>
<name>
<surname>Van de Vijver</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Fidler</surname>
<given-names>V.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Faecal calprotectin for screening of patients with suspected inflammatory bowel disease: diagnostic meta-analysis</article-title>. <source>BMJ Clin. Res.</source> <volume>341</volume>, <fpage>c3369</fpage>. <pub-id pub-id-type="doi">10.1136/bmj.c3369</pub-id>
</citation>
</ref>
<ref id="B63">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vincent</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Mehrotra</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Loo</surname>
<given-names>V. G.</given-names>
</name>
<name>
<surname>Dewar</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Manges</surname>
<given-names>A. R.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Excretion of host DNA in feces is associated with risk of <italic>Clostridium difficile</italic> infection</article-title>. <source>J. Immunol. Res.</source> <volume>2015</volume>, <fpage>1</fpage>&#x2013;<lpage>7</lpage>. <pub-id pub-id-type="doi">10.1155/2015/246203</pub-id>
</citation>
</ref>
<ref id="B64">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>von Roon</surname>
<given-names>A. C.</given-names>
</name>
<name>
<surname>Karamountzos</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Purkayastha</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Reese</surname>
<given-names>G. E.</given-names>
</name>
<name>
<surname>Darzi</surname>
<given-names>A. W.</given-names>
</name>
<name>
<surname>Teare</surname>
<given-names>J. P.</given-names>
</name>
<etal/>
</person-group> (<year>2007</year>). <article-title>Diagnostic precision of fecal calprotectin for inflammatory bowel disease and colorectal malignancy</article-title>. <source>Am. J. gastroenterology</source> <volume>102</volume> (<issue>4</issue>), <fpage>803</fpage>&#x2013;<lpage>813</lpage>. <pub-id pub-id-type="doi">10.1111/j.1572-0241.2007.01126.x</pub-id>
</citation>
</ref>
<ref id="B65">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vrablicova</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Tomova</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Tothova</surname>
<given-names>&#x13d;.</given-names>
</name>
<name>
<surname>B&#xe1;b&#xed;&#x10d;kov&#xe1;</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Gromova</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Kone&#x10d;n&#xe1;</surname>
<given-names>B.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Nuclear and mitochondrial circulating cell-free DNA is increased in patients with inflammatory bowel disease in clinical remission</article-title>. <source>Front. Med.</source> <volume>7</volume>, <fpage>593316</fpage>. <pub-id pub-id-type="doi">10.3389/fmed.2020.593316</pub-id>
</citation>
</ref>
<ref id="B66">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Whitehead</surname>
<given-names>S. J.</given-names>
</name>
<name>
<surname>French</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Brookes</surname>
<given-names>M. J.</given-names>
</name>
<name>
<surname>Ford</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Gama</surname>
<given-names>R.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Between-assay variability of faecal calprotectin enzyme-linked immunosorbent assay kits</article-title>. <source>Ann. Clin. Biochem. Int. J. Laboratory Med.</source> <volume>50</volume> (<issue>Pt 1</issue>), <fpage>53</fpage>&#x2013;<lpage>61</lpage>. <pub-id pub-id-type="doi">10.1258/acb.2012.011272</pub-id>
</citation>
</ref>
<ref id="B67">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Whitney</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Skoletsky</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Moore</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Boynton</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Kann</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Brand</surname>
<given-names>R.</given-names>
</name>
<etal/>
</person-group> (<year>2004</year>). <article-title>Enhanced retrieval of DNA from human fecal samples results in improved performance of colorectal cancer screening test</article-title>. <source>J. Mol. Diagnostics</source> <volume>6</volume> (<issue>4</issue>), <fpage>386</fpage>&#x2013;<lpage>395</lpage>. <pub-id pub-id-type="doi">10.1016/s1525-1578(10)60536-3</pub-id>
</citation>
</ref>
<ref id="B68">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Witkowska-Zimny</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Kaminska-El-Hassan</surname>
<given-names>E.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Cells of human breast milk</article-title>. <source>Cell. and Mol. Biol. Lett.</source> <volume>22</volume>, <fpage>11</fpage>. <pub-id pub-id-type="doi">10.1186/s11658-017-0042-4</pub-id>
</citation>
</ref>
<ref id="B69">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zemmour</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Planer</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Magenheim</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Moss</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Neiman</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Gilon</surname>
<given-names>D.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Non-invasive detection of human cardiomyocyte death using methylation patterns of circulating DNA</article-title>. <source>Nat. Commun.</source> <volume>9</volume> (<issue>1</issue>), <fpage>1443</fpage>. <pub-id pub-id-type="doi">10.1038/s41467-018-03961-y</pub-id>
</citation>
</ref>
<ref id="B70">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ziller</surname>
<given-names>M. J.</given-names>
</name>
<name>
<surname>Gu</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Muller</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Donaghey</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Tsai</surname>
<given-names>L. T.</given-names>
</name>
<name>
<surname>Kohlbacher</surname>
<given-names>O.</given-names>
</name>
<etal/>
</person-group> (<year>2013</year>). <article-title>Charting a dynamic DNA methylation landscape of the human genome</article-title>. <source>Nature</source> <volume>500</volume> (<issue>7463</issue>), <fpage>477</fpage>&#x2013;<lpage>481</lpage>. <pub-id pub-id-type="doi">10.1038/nature12433</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>