This study received ethical approval from the Gansu Provincial Maternal and Child Health Hospital (Gansu Provincial Central Hospital), and informed consent was obtained from each participant. The brothers with primary infertility and their mother were recruited from the Gansu Provincial Maternal and Child Health Hospital (Gansu Provincial Central Hospital).

Genomic DNA was isolated from peripheral blood lymphocytes of participants using QIAamp DNA Blood Kits (Qiagen, Hilden, Germany). Library preparation and exome enrichment were conducted using SureSelect Human All Exon V6 (Agilent Technologies, Santa Clara, CA, USA). The prepared libraries were sequenced using the Illumina NovaSeq^® 6000 system (Illumina, San Diego, CA, USA). The variants were filtered and prioritized using TGex (https://fa.shanyint.com/, accessed 4 January 2025) (17). The gene variants detected by WES were validated by Sanger sequencing, using the following primers for amplification and sequencing: SPAG17-c2188-F=CCGAGAACCTTCAGATCCTAGTC and SPAG17-c2188-R=AGGGTTGAAATAAAGAGAACTTATGG.

A comprehensive literature search was conducted using PubMed and Google Scholar to identify publications on the relationship between SPAG17 and male infertility in humans and animal models. Only English-language manuscripts and abstracts were considered. Cases reporting deleterious SPAG17 variants associated with male infertility due to asthenozoospermia were reviewed. The strength of the gene–disease association between SPAG17 and autosomal recessive severe asthenozoospermia was curated following the ClinGen Gene–Disease Validity SOP, version 11 (18).

Semen samples were collected by masturbation and incubated at 37 °C for 30 minutes to achieve liquefaction. Routine semen analysis (volume, sperm concentration, and motility) was performed using the Sperm Class Analyzer CASA System (SCA, Spain) following World Health Organization guidelines (5th Edition) (19). Semen samples from subjects were washed with PBS, fixed in 4% paraformaldehyde (PFA), and stained with Mayer’s hematoxylin and a 1% eosin Y solution (FUJIFILM WakoPure Chemical). Sperm morphology was assessed by examining at least 130 sperm from each sample.

Spermatozoa were immersed in a 2.5% glutaraldehyde solution, washed three times with 0.1 mol/L phosphate buffer (PB, pH 7.2), and postfixed with 1% osmium tetroxide in 0.1 mol/L PB for 1–1.5 hours at 4 °C. Dehydration was performed sequentially using ethanol solutions at concentrations of 50%, 70%, 80%, 95%, and 100%, followed by 100% acetone. Infiltration was then carried out by immersing the samples overnight at 37 °C in a 1:1 mixture of acetone and SPI-Chem resin (containing dodecenyl succinic anhydride, N-methylacetamide, SPI-Pon 812, and DMP-30). After infiltration and embedding in Epon 812 resin, ultrathin sections were stained with uranyl acetate and lead citrate. These sections were then examined and photographed using a TEM (TECNAI-10, Philips) operating at an accelerating voltage of 80 kV.

For comparative analyses in semen morphology and ultrastructural studies, normal control samples were obtained from three healthy fertile volunteers with normal semen parameters (progressive motility > 40%, normal morphology > 4%) and no history of reproductive disorders. Control samples were processed identically and simultaneously with patient samples under the same laboratory conditions, including fixation, staining, and TEM preparation, to minimize batch effects and pre-analytical variability.

The patient and his sibling, with primary infertility durations of 10 and 3 years, respectively, both exhibit severe asthenozoospermia. Sperm motility and progressive motility of them were both significantly below the normal reference values (Table 1). Hematoxylin and eosin (H&E) staining was utilized to evaluate sperm morphology. The sperm from the two patients both exhibited a reduced proportion of morphologically normal sperm and an increased prevalence of abnormalities in flagella, including absent, short, curly, angular, and irregularly calibrated flagella (Figure 1, Table 1). Additionally, transmission electron microscopy (TEM) was used to analyze the ultrastructure of spermatozoa from the two siblings. Strikingly, compared to the regular “9 + 2” axonemal arrangement observed in sperm flagella from normal controls, the spermatozoa from the two patients exhibited absent or disorganized central-pair microtubules (CPs) and irregular or absent outer dense fibers (ODFs) and microtubule doublets (MTDs) in the flagellar midpiece. Additionally, the principal piece showed a loss of most axonemal microtubules, which were irregularly arranged, and the peripheral MTDs or CPs were absent in the end piece.

Additionally, transmission electron microscopy (TEM) was used to analyze the ultrastructure of spermatozoa from the two siblings. A total of 60 cross-sectional flagellar images per individual were evaluated. Compared to the regular “9 + 2” axonemal arrangement observed in controls, patient spermatozoa exhibited absent central-pair microtubules in 82% of cross-sections, disorganized outer dense fibers in 75%, and irregular microtubule doublets in 68%. Representative images are shown in Figure 1C.

Prior to referral, both individuals had underwent unsuccessful intracytoplasmic sperm injection (ICSI) cycles at an external clinic. Subsequent diagnostic genetic testing identified an identical homozygous nonsense variant in SPAG17 (NM_206996.4: c.2188C>T; p.Q730*) in both siblings, resulting in a premature stop codon. Sanger sequencing confirmed homozygosity for the SPAG17 variant in both patients and revealed that their mother was heterozygous for the same variant (Figure 2), consistent with autosomal recessive inheritance. The father, now deceased, could not be tested due to the unavailability of DNA. Following another ICSI cycle combined with assisted oocyte activation (AOA), both individuals achieved live births: II:2 had a daughter, and II:3 had twin daughters.

The identification of a novel homozygous loss-of-function variant in SPAG17 associated with severe asthenozoospermia prompted a formal evaluation of the gene-disease validity between SPAG17 and severe asthenozoospermia. The curation considered both genetic and experimental evidence. The current cases contributed significant genetic evidence, with 3 points awarded based on the identification of a predicted null variant in an autosomal recessive condition. This was combined with evidence from 4 previous report male cases with infertility harboring two homozygous missense variants and two homozygous loss of function variants in SPAG17 (Table 2) (10–12). Collectively, the cumulative genetic evidence scored 9.4 out of a total of 12 points (Table 3) (15, 18).

The correlation between SPAG17 and severe asthenozoospermia is also supported by experimental evidence (Table 4). SPAG17 is crucial for the structure and function of motile cilia (20) and facilitates the translocation of protamines from the cytoplasm to the nucleus, a key process in sperm production (21). SPAG17 is highly expressed in testicular tissue, where spermatogenesis occurs (22). In SPAG17 knockout mice, primary cilia in chondrocytes, osteoblasts, and embryonic fibroblasts (MEFs) were shorter, and fewer cells exhibited primary cilia compared to wild-type mice (23). Spag17 knockout mice are infertile due to a severe spermatogenesis defect, with spermatogenesis arrested at the spermatid stage. Sperm retrieved from the cauda epididymis were immotile and displayed abnormal tail and head morphology (8). These data underscore the critical role of SPAG17 in male reproductive biology, with a cumulative evidence score of 4 out of 6 allowable points according to the ClinGen Gene–Disease Validity SOP (Table 4) (13, 18).

Combining the genetic (9.4 points) and experimental (4 points) evidence resulted in a total score of 13.4 points. According to the ClinGen Gene–Disease Validity SOP, the 3 points contributed by our cases upgraded the gene–disease validity between SPAG17 and autosomal recessive severe asthenozoospermia from “Moderate” (requiring 7–11 points) to “Strong” (requiring 12–18 points).

This study has certain limitations. Most notably, due to the scarcity and complete consumption of patient sperm samples for essential diagnostic and ultrastructural analyses (e.g., TEM), we were unable to perform direct protein-level validation, such as immunofluorescence or Western blotting, to confirm the absence of the SPAG17 protein. While the identification of a homozygous nonsense variant provides strong genetic evidence for a loss-of-function mechanism, future studies with access to relevant samples are encouraged to validate these findings at the protein level. Additionally, the functional link between SPAG17 deficiency and the observed need for assisted oocyte activation warrants further mechanistic investigation.