<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Endocrinol.</journal-id>
<journal-title>Frontiers in Endocrinology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Endocrinol.</abbrev-journal-title>
<issn pub-type="epub">1664-2392</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fendo.2025.1606877</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Endocrinology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Elucidating the mechanism of triphenyl phosphate interference in bone metabolism via network toxicology and molecular docking methodologies</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Xu</surname>
<given-names>Min</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1547400/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Wu</surname>
<given-names>Yinxiang</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Meng</surname>
<given-names>Jiaqi</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2600453/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Chen</surname>
<given-names>Mengchen</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/3027536/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Ding</surname>
<given-names>Chen</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Department of Trauma Orthopedic, First Affiliated Hospital of Naval Medical University</institution>, <addr-line>Shanghai</addr-line>,&#xa0;<country>China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Department of Pulmonary and Critical Care Medicine, Third Affiliated Hospital of Naval Medical University</institution>, <addr-line>Shanghai</addr-line>,&#xa0;<country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Yonggang Ma, Yangzhou University, China</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Ming Chen, Chinese PLA General Hospital, China</p>
<p>Kanglei Zhang, Xinyang Agriculture and Forestry University, China</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Mengchen Chen, <email xlink:href="mailto:Chenmengchen9932@163.com">Chenmengchen9932@163.com</email>; Chen Ding, <email xlink:href="mailto:dcsmmu@163.com">dcsmmu@163.com</email>
</p>
</fn>
<fn fn-type="equal" id="fn003">
<p>&#x2020;These authors have contributed equally to this work</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>07</day>
<month>07</month>
<year>2025</year>
</pub-date>
<pub-date pub-type="collection">
<year>2025</year>
</pub-date>
<volume>16</volume>
<elocation-id>1606877</elocation-id>
<history>
<date date-type="received">
<day>06</day>
<month>04</month>
<year>2025</year>
</date>
<date date-type="accepted">
<day>09</day>
<month>06</month>
<year>2025</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2025 Xu, Wu, Meng, Chen and Ding</copyright-statement>
<copyright-year>2025</copyright-year>
<copyright-holder>Xu, Wu, Meng, Chen and Ding</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<sec>
<title>Objective</title>
<p>This study aims to elucidate the molecular mechanisms by which the widely used organophosphate flame retardant and plasticizer, triphenyl phosphate (TPhP), disrupts bone metabolism, highlighting the potential impact of environmental chemicals on bone homeostasis.</p>
</sec>
<sec>
<title>Methods</title>
<p>A combined approach of network toxicology and molecular docking was employed to investigate the molecular mechanisms underlying the effects of TPhP on bone metabolism. Potential targets associated with both TPhP and bone metabolism were identified through database searches in ChEMBL, STITCH, GeneCards, and OMIM. A protein&#x2013;protein interaction (PPI) network was constructed using the STRING database and analyzed with Cytoscape software. Functional enrichment analyses, including Gene Ontology (GO) annotation and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, were performed to determine the major pathways involved. Molecular docking was conducted to evaluate the binding affinity between TPhP and key target proteins. Additionally, <italic>in vitro</italic> experiments using MC3T3-E1 osteoblasts were conducted to validate the bioinformatics findings.</p>
</sec>
<sec>
<title>Results</title>
<p>78 potential targets related to both TPhP and bone metabolism were identified. STRING and Cytoscape revealed six key proteins: IGF1R, NR3C1, MAP3K1, BRAF, WNK4, and CNR2. GO and KEGG analyses indicated that these targets predominantly function through the MAPK signaling pathway. Molecular docking results demonstrated strong binding affinities between TPhP and key targets, particularly BRAF and WNK4. <italic>In vitro</italic>, TPhP inhibited osteoblast proliferation and migration in a dose-dependent manner and downregulated EMT-related proteins and key target genes via MAPK signaling.</p>
</sec>
<sec>
<title>Conclusion</title>
<p>TPhP disrupts bone metabolism by modulating key proteins and pathways, underscoring its potential health risks and the need for further epidemiological and clinical research.</p>
</sec>
</abstract>
<kwd-group>
<kwd>triphenyl phosphate (TPHP)</kwd>
<kwd>osteoporosis</kwd>
<kwd>network toxicology</kwd>
<kwd>MAPK signaling pathway</kwd>
<kwd>osteoblast</kwd>
</kwd-group>
<counts>
<fig-count count="6"/>
<table-count count="1"/>
<equation-count count="0"/>
<ref-count count="34"/>
<page-count count="13"/>
<word-count count="5363"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Bone Research</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>Triphenyl phosphate (TPhP) is a widely used organophosphate flame retardant and plasticizer, which has been detected in various environmental media such as indoor air, dust, soil, and wastewater treatment plant effluent (<xref ref-type="bibr" rid="B1">1</xref>, <xref ref-type="bibr" rid="B2">2</xref>). Due to its persistence and difficult degradability, TPhP remains in the environment for an extended period, exhibiting significant bioaccumulation effects, which pose potential threats to human health and environmental safety (<xref ref-type="bibr" rid="B3">3</xref>, <xref ref-type="bibr" rid="B4">4</xref>). On November 7, 2024, the European Chemicals Agency (ECHA) included TPhP on the list of substances of very high concern (SVHC), further highlighting its potential hazards.</p>
<p>Numerous studies have shown that TPhP can significantly impact biological health through multiple molecular mechanisms. Research has demonstrated that TPhP has clear developmental toxicity, interfering with cardiac development, skeletal formation, and embryonic development. In the nervous system, TPhP can inhibit acetylcholinesterase activity, disrupt blood-brain barrier integrity, and affect neural function by inducing the release of inflammatory factors and oxidative stress responses (<xref ref-type="bibr" rid="B5">5</xref>, <xref ref-type="bibr" rid="B6">6</xref>). In the reproductive system, TPhP can disrupt hormonal balance, impair reproductive cell development, reduce fertility, and pose a carcinogenic risk (<xref ref-type="bibr" rid="B7">7</xref>&#x2013;<xref ref-type="bibr" rid="B9">9</xref>). Moreover, TPhP accumulates strongly in the liver and can lead to metabolic disorders by affecting glucose and lipid metabolism and inducing oxidative stress (<xref ref-type="bibr" rid="B10">10</xref>&#x2013;<xref ref-type="bibr" rid="B13">13</xref>). Notably, TPhP also exhibits genotoxicity and immunotoxicity, influencing DNA methylation, inducing DNA damage, and disrupting immune responses by modulating immune cell function and inflammatory factor expression (<xref ref-type="bibr" rid="B14">14</xref>, <xref ref-type="bibr" rid="B15">15</xref>).</p>
<p>Osteoporosis is a systemic bone disease characterized by low bone mineral density (BMD), bone fragility, and damage to the bone microstructure (<xref ref-type="bibr" rid="B16">16</xref>). In recent years, the role of environmental factors in the pathogenesis of osteoporosis has garnered increasing attention. Studies have shown that heavy metal pollutants (such as lead, cadmium, and mercury) can interfere with bone cell function, inhibit osteoblast activity, and promote osteoclast differentiation, leading to increased bone resorption and decreased bone formation, ultimately resulting in osteoporosis (<xref ref-type="bibr" rid="B17">17</xref>). Additionally, populations exposed to long-term air pollutants such as PM2.5, PM10, and NO2 exhibit higher risks of osteoporosis and fractures (<xref ref-type="bibr" rid="B18">18</xref>). Furthermore, perfluorooctane sulfonate (PFOS) has been shown to be significantly associated with reduced spinal bone mineral density in women, possibly by affecting thyroid hormone and vitamin D metabolism, thereby disrupting bone mineralization (<xref ref-type="bibr" rid="B19">19</xref>). However, despite the confirmed multiple mechanisms through which TPhP affects biological health, its impact on bone metabolism has not been systematically studied.</p>
<p>With the rapid development of bioinformatics technology, system-wide analysis based on multi-omics data has provided new research strategies for investigating the mechanisms of environmental pollutants (<xref ref-type="bibr" rid="B20">20</xref>). This study aims to integrate resources from databases such as ChEMBL and STITCH, combined with modern bioinformatics methods, to systematically predict and analyze the potential targets of TPhP and its regulatory networks. Through protein-protein interaction network construction, Gene Ontology (GO) functional annotation, and KEGG pathway analysis, this study will provide a deeper understanding of the biological processes and signaling pathways in which these target molecules are involved. Additionally, molecular docking will be used to predict the binding mode of TPhP with key target proteins, and <italic>in vitro</italic> experiments will be conducted to verify the impact of TPhP on osteocyte function. This study will provide new scientific evidence for elucidating the molecular mechanisms of environmental pollutants inducing osteoporosis and has significant theoretical and practical implications for assessing the health risks of TPhP and developing intervention strategies.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<label>2</label>
<title>Materials and methods</title>
<sec id="s2_1">
<label>2.1</label>
<title>Cell culture and pharmacological intervention</title>
<p>The murine pre-osteoblastic MC3T3-E1 cell line (passages 5&#x2013;15) was obtained from Wuhan PriCells Biotechnology Co., Ltd. The cells were routinely cultured in &#x3b1;-MEM complete medium (PriCells, Wuhan) containing 10% premium-grade fetal bovine serum (FBS, PriCells, Wuhan) and 1% penicillin-streptomycin solution (100 U/mL, PriCells, Wuhan). Cultures were maintained at 37&#xb0;C in a humidified atmosphere with 5% CO<sub>2</sub>. TPhP Treatment: Triphenyl phosphate (TPhP) (Sigma-Aldrich) was dissolved in DMSO (Sigma-Aldrich) to create stock solutions and diluted in &#x3b1;-MEM complete medium to the required concentrations. MC3T3-E1 cells were treated with TPhP at 0 (vehicle control), 10, 20, and 40 &#x3bc;M for subsequent functional assays. For pathway validation experiments, cells were treated with TPhP (40 &#x3bc;M) alone or in combination with the MEK/ERK activator C16-PAF (MCE, at 1 &#x3bc;M) or the MEK inhibitor MEK-IN-6 (MCE 10 &#x3bc;M). Cells were co-incubated for 48 hours before collection for Transwell, CCK-8, or Western blot analysis.</p>
</sec>
<sec id="s2_2">
<label>2.2</label>
<title>Systematic prediction and analysis of the TPhP action network</title>
<p>The standardized chemical structure and SMILES formula of TPhP were retrieved from the PubChem database (<ext-link ext-link-type="uri" xlink:href="https://pubchem.ncbi.nlm.nih.gov/">https://pubchem.ncbi.nlm.nih.gov/</ext-link>). A ligand-based multi-target prediction strategy was employed, utilizing the SWISS Target Prediction platform (<ext-link ext-link-type="uri" xlink:href="http://www.swisstargetprediction.ch/">http://www.swisstargetprediction.ch/</ext-link>) and the SEA-DOCK reverse docking system for high-throughput screening of potential targets. The species parameter was set to &#x201c;Homo sapiens,&#x201d; with a prediction probability threshold &gt;0.6. The identified targets were imported into the UniProt database (<ext-link ext-link-type="uri" xlink:href="https://www.uniprot.org/">https://www.uniprot.org/</ext-link>) for standard annotation and functional classification, establishing a dataset of potential TPhP targets.</p>
</sec>
<sec id="s2_3">
<label>2.3</label>
<title>Multidimensional screening of bone metabolism-related targets</title>
<p>The DisGeNET disease-gene association database (<ext-link ext-link-type="uri" xlink:href="https://www.disgenet.org/">https://www.disgenet.org/</ext-link>) and the TTD therapeutic target database (<ext-link ext-link-type="uri" xlink:href="http://db.idrblab.net/ttd/">http://db.idrblab.net/ttd/</ext-link>) were integrated for systematic searches using keywords &#x201c;osteoporosis,&#x201d; &#x201c;bone metabolism,&#x201d; and &#x201c;bone remodeling.&#x201d; Highly relevant genes involved in bone metabolism regulation were screened based on evidence-level scoring (relevance score &#x2265;0.4) to establish a bone metabolism-specific target library. Overlapping genes between TPhP targets and bone metabolism-specific targets were identified using Venn diagram analysis on the BioVenn online platform, forming the candidate key targets for TPhP-mediated regulation of bone metabolism.</p>
</sec>
<sec id="s2_4">
<label>2.4</label>
<title>Construction and analysis of protein-protein interaction networks</title>
<p>The overlapping genes identified were imported into the STRING database (<ext-link ext-link-type="uri" xlink:href="https://string-db.org/">https://string-db.org/</ext-link>), with a combined confidence threshold &gt;0.4 to construct the protein-protein interaction (PPI) network. Cytoscape software (v3.10.1) was used for network visualization and topological analysis. Functional modules were identified using the MCODE clustering algorithm (degree cutoff = 2, node score cutoff = 0.2, k-core = 2). Core hub genes were determined using 12 ranking algorithms provided by the CytoHubba plugin, including Degree, Betweenness, and Closeness centrality measures.</p>
</sec>
<sec id="s2_5">
<label>2.5</label>
<title>Multilevel functional enrichment and pathway analysis</title>
<p>Functional enrichment analysis of TPhP&#x2019;s potential targets was performed using the Metascape platform (<ext-link ext-link-type="uri" xlink:href="https://metascape.org/">https://metascape.org/</ext-link>) and the DAVID annotation system (<ext-link ext-link-type="uri" xlink:href="https://david.ncifcrf.gov/">https://david.ncifcrf.gov/</ext-link>). GO analysis covered three aspects: Biological Processes (BP), Cellular Components (CC), and Molecular Functions (MF). Fisher&#x2019;s exact test was used to evaluate significance (P &lt; 0.05) with false discovery rate (FDR) correction. KEGG pathway enrichment focused on signaling pathways relevant to bone metabolism regulation, such as the Wnt, BMP, and MAPK pathways.</p>
</sec>
<sec id="s2_6">
<label>2.6</label>
<title>Structural validation and molecular docking analysis</title>
<p>Molecular docking was performed to investigate the binding characteristics between TPHP and six core target proteins (IGF1R, NR3C1, MAP3K1, BRAF, WNK4, and CNR2) using AutoDock software. The three-dimensional structures of these proteins were obtained from the Protein Data Bank (PDB). Prior to docking, all protein structures were preprocessed by removing water molecules and adding hydrogen atoms. The TPHP structure was energy-minimized before docking simulation. The binding sites were defined based on the surface cavities of each protein. The docking parameters were set to achieve optimal conformational sampling, and the most stable binding conformations were selected based on the lowest binding energy. The binding energy threshold was set at -5 kcal/mol to indicate excellent binding affinity. PyMOL software was utilized to visualize and analyze the three-dimensional configurations of the most stable binding conformations between TPHP and each target protein. The molecular interactions and binding modes were thoroughly examined to evaluate the stability of the protein-ligand complexes.</p>
</sec>
<sec id="s2_7">
<label>2.7</label>
<title>Core gene identification and validation</title>
<p>Core osteoporosis-related genes were identified using the LASSO (Least Absolute Shrinkage and Selection Operator) regression algorithm. The LASSO regression model was constructed using R software (version 4.1.2) with the &#x201c;glmnet&#x201d; package. The penalty parameter &#x3bb; was determined through 10-fold cross-validation to minimize mean squared error. The optimal &#x3bb; value was selected when the model achieved the best balance between bias and variance. To validate the screening results, receiver operating characteristic (ROC) curve analysis was performed for both the identified candidate genes and the established osteoporosis model. The area under the curve (AUC) was calculated to evaluate the predictive accuracy of the model, with an AUC threshold of 0.7 considered to indicate significant discriminatory power. The validation process was conducted using the &#x201c;pROC&#x201d; package in R.</p>
</sec>
<sec id="s2_8">
<label>2.8</label>
<title>Wound healing assay</title>
<p>A wound healing assay was conducted to assess the effect of TPhP on MC3T3-E1 cell migration. Cells were cultured to 90&#x2013;95% confluence, and a uniform scratch was created on the monolayer using a sterile 200 &#x3bc;L pipette tip. Detached cells were gently removed by washing twice with PBS. The cells were then treated with TPhP at 0 (vehicle control), 10, 25, 50, and 100 &#x3bc;M. Images of wound closure at 0 h and 48 h were captured using an inverted microscope equipped with a CCD camera (Nikon Ti2-U, Japan). Image-Pro Plus 6.0 software was used to measure wound areas, and cell migration rates.</p>
</sec>
<sec id="s2_9">
<label>2.9</label>
<title>Cell proliferation and viability assay</title>
<p>The CCK-8 assay was used to assess the effects of TPhP on cell proliferation. MC3T3-E1 cells in the logarithmic growth phase were seeded into 96-well plates at a density of 1&#xd7;10<sup>3</sup> cells/well. After adherence, the cells were treated with TPhP at concentrations ranging from 0 to 100 &#x3bc;M. At 24, 48, 72, 96, and 120 hours, 10 &#x3bc;L of CCK-8 reagent (Beyotime, Wuhan, China) was added to each well and incubated at 37&#xb0;C for 2 hours in the dark. Absorbance was measured at 450 nm using a microplate reader. Each concentration was tested in triplicate, and the experiments were independently repeated three times.</p>
</sec>
<sec id="s2_10">
<label>2.10</label>
<title>Transwell invasion and migration assays</title>
<p>A Transwell chamber assay was used to evaluate TPhP&#x2019;s effects on cell invasion and migration. For the invasion assay, Matrigel (BD, 1:8 dilution) was precoated onto polycarbonate membranes (8 &#x3bc;m pores, Corning) and incubated overnight at 4&#xb0;C. Cells pre-treated with serum starvation for 12 h were seeded into the upper chamber at 2&#xd7;10<sup>4</sup> cells/well in 200 &#x3bc;L serum-free medium containing different concentrations of TPhP. The lower chamber was filled with 600 &#x3bc;L complete medium containing 10% FBS as a chemoattractant. After 24 h, cells on the membrane&#x2019;s upper surface were gently removed, while invaded cells on the lower surface were fixed with methanol, stained with crystal violet, and counted in five randomly selected fields under a microscope. Migration assays followed the same procedure without Matrigel coating.</p>
</sec>
<sec id="s2_11">
<label>2.11</label>
<title>Western blot analysis</title>
<p>Cells treated with TPhP were lysed in RIPA buffer containing protease and phosphatase inhibitors (Beyotime, Wuhan) on ice for 30 min. Lysates were centrifuged at 12,000g for 15 min to collect the supernatant. Protein concentration was quantified using a BCA assay, and 30 &#x3bc;g of denatured protein per sample was resolved via SDS-PAGE and transferred onto PVDF membranes (0.45 &#x3bc;m, Millipore) using a semi-dry transfer system. After blocking with 5% BSA in TBST for 2 h, membranes were incubated overnight at 4&#xb0;C with specific primary antibodies. After washing, HRP-conjugated secondary antibodies (1:5000) were applied for 1 h at room temperature. Signals were developed using enhanced chemiluminescence substrate (Thermo Scientific&#x2122; SuperSignal&#x2122;) and visualized on a ChemiDoc&#x2122; MP Imaging System (Bio-Rad). Densitometric analysis was performed using ImageJ software, with &#x3b2;-actin as the loading control. All primary antibodies were obtained from Cell Signaling Technology (CST): p-ERK1/2 (CST, 1:1000); ERK1/2 (CST,1:1000); p-MEK (CST,1:1000); MEK (CST,1:1000); p-P38 (CST,1:1000);P38 (CST,1:1000); p-JNK (CST,1:1000); JNK (CST,1:1000; E-Cadherin (CST,1:1000); N-Cadherin (CST,1:1000); GAPDH (CST,1:1000)</p>
</sec>
<sec id="s2_12">
<label>2.12</label>
<title>Quantitative PCR</title>
<p>Total RNA was extracted using the TRIzol method (Yeasen, Shanghai), and 1 &#x3bc;g of RNA was reverse-transcribed into cDNA using the PrimeScript&#x2122; RT Master Mix (Yeasen, Shanghai). Gene expression was quantified using SYBR Green dye on an ABI QuantStudio&#x2122; 3 system. GAPDH was used as an internal control, and relative expression was calculated using the 2<sup>&#x2212;&#x394;&#x394;Ct</sup> method. Each sample was tested in triplicate, with experiments independently repeated three times. The primers for all targets are listed in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>The primers used in the study.</p>
</caption>
<table frame="hsides">
<tbody>
<tr>
<td valign="top" align="left">NR3C1-F</td>
<td valign="top" align="left">CCCAGCATGAGACCAGATGTAAGC</td>
</tr>
<tr>
<td valign="top" align="left">NR3C1-R</td>
<td valign="top" align="left">CAGAGCACACCAGGCAGAGTTTG</td>
</tr>
<tr>
<td valign="top" align="left">IGF1R-F</td>
<td valign="top" align="left">TCGACATCCGCAACGACTATC</td>
</tr>
<tr>
<td valign="top" align="left">IGF1R-R</td>
<td valign="top" align="left">CCAGGGCGTAGTTGTAGAAGAG</td>
</tr>
<tr>
<td valign="top" align="left">MAP3K1-F</td>
<td valign="top" align="left">GCACGAATGGTTGGAAAGGA</td>
</tr>
<tr>
<td valign="top" align="left">MAP3K1-R</td>
<td valign="top" align="left">GAGTTGCCAGGAGAAGGACT</td>
</tr>
<tr>
<td valign="top" align="left">BRAF-F</td>
<td valign="top" align="left">ATCACGGAACAACCC</td>
</tr>
<tr>
<td valign="top" align="left">BRAF-R</td>
<td valign="top" align="left">GACAACGGAAACCCT</td>
</tr>
<tr>
<td valign="top" align="left">WNK4-F</td>
<td valign="top" align="left">GTGAAGGCTGCGGAAGACTC</td>
</tr>
<tr>
<td valign="top" align="left">WNK4-R</td>
<td valign="top" align="left">CTGGGTCTCCATGTCCTCCTT</td>
</tr>
<tr>
<td valign="top" align="left">CNR2-F</td>
<td valign="top" align="left">ATCACATCCGACTGATCGGC</td>
</tr>
<tr>
<td valign="top" align="left">CNR2-R</td>
<td valign="top" align="left">GTGAAGGTCATAGTCACGCTG</td>
</tr>
<tr>
<td valign="top" align="left">GAPDH-F</td>
<td valign="top" align="left">CCTTCATTGACCTCAACTACATGG</td>
</tr>
<tr>
<td valign="top" align="left">GAPDH-R</td>
<td valign="top" align="left">CTCGCTCCTGGAAGATGGTG</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_13">
<label>2.13</label>
<title>Data processing and statistical analysis</title>
<p>Quantitative data were analyzed and plotted using GraphPad Prism 10.0 software. Results were expressed as mean &#xb1; standard deviation (Mean &#xb1; SD). Statistical comparisons between two groups were performed using independent sample tt-tests, while one-way analysis of variance (ANOVA) followed by Tukey&#x2019;s <italic>post&#xa0;hoc</italic> test was used for multiple group comparisons. A two-tailed P-value &lt; 0.05 was considered statistically significant. Significance levels were denoted as follows: *P &lt; 0.05, **P &lt; 0.01, and ***P &lt; 0.001. All experiments were conducted at least three times independently.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<label>3</label>
<title>Results</title>
<sec id="s3_1">
<label>3.1</label>
<title>Target identification of TPHP-induced osteoporosis</title>
<p>Through comprehensive research, we conducted systematic screening, initially predicting and evaluating TPHP toxicity in PubChem, which revealed active responses to estrogen receptor &#x3b1; (ER) (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;1</bold>
</xref>). It is well established that endogenous estrogen disruption is closely linked to osteoporosis, and previous studies have verified TPHP&#x2019;s impact on human hormone levels (<xref ref-type="bibr" rid="B21">21</xref>, <xref ref-type="bibr" rid="B22">22</xref>). These findings indicate a strong correlation between TPHP and osteoporosis. We initially identified 1,659 potential TPHP-related targets through CHEMBL, STTCH, and Swiss Target Prediction databases (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>). Subsequently, we screened 970 osteoporosis-related genes from GeneCard, OMIM, and DisGeNET databases (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref>). After thorough analysis and deduplication, we identified 78 overlapping target molecules, which were considered crucial candidates for TPHP-regulated bone metabolism. The distribution of TPHP and osteoporosis target molecules was visualized using a Venn diagram (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1C</bold>
</xref>).</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Target screening of TPHP-induced osteoporosis. <bold>(A)</bold> Union set of TPHP-related genes from three databases: CHEMBL, STTCH, and Swiss Target Prediction. <bold>(B)</bold> Union set of osteoporosis-related genes from GeneCard, OMIM, and DisGeNET databases. <bold>(C)</bold> Intersection set between TPHP-related genes and osteoporosis-related genes.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-16-1606877-g001.tif">
<alt-text content-type="machine-generated">Three Venn diagrams labeled A, B, and C show intersections of different data sets. Diagram A compares ChEMBL, STITCH, and SwissTargetPrediction with little overlap. Diagram B shows GeneCards, OMIM, and TTD with minimal shared elements. Diagram C compares DEP and Osteoporosis, indicating some commonality.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_2">
<label>3.2</label>
<title>Construction of target molecule interaction network and key gene identification</title>
<p>Using the STRING database, we constructed a PPI network of osteoporosis-related proteins and visualized their topological features using Cytoscape software. The network diagram clearly illustrated the correlation between relevant proteins, TPHP, and osteoporosis (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>). To further identify key proteins in TPHP-induced osteoporosis, we first conducted an in-depth analysis of osteoporosis-related gene sets in the GEO database to identify differentially expressed genes (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2B</bold>
</xref>). By intersecting these differential genes with the aforementioned osteoporosis-related genes, we ultimately identified 47 target molecules significantly influenced by TPHP in osteoporosis (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2C</bold>
</xref>).</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Molecular protein interaction network analysis. <bold>(A)</bold> PPI network analysis of TPHP-influenced osteoporosis-related genes. <bold>(B)</bold> Volcano plot of differentially expressed genes from the GSE230665 dataset. <bold>(C)</bold> Intersection between TPHP-influenced osteoporosis-related genes and differentially expressed genes from the GEO dataset.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-16-1606877-g002.tif">
<alt-text content-type="machine-generated">(A) Network diagram showing connections between osteoporosis and TPHP through various genes. (B) Volcano plot illustrating gene expression changes; red for upregulated, blue for downregulated, and gray for no change. (C) Venn diagram comparing GSE230665_diff and Osteoporosis_DEP, with overlapping and distinct numbers of genes highlighted.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_3">
<label>3.3</label>
<title>Pathway enrichment analysis of potential targets</title>
<p>To investigate the biological functions and signaling pathways of the 47 differentially expressed target proteins (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref>), we performed detailed Gene Ontology (GO) functional analysis using the DAVID database, focusing on human-specific aspects. The analysis revealed three major categories: biological processes, cellular components, and molecular functions. We ranked these functions by significance level and visualized the top 10 most significant entries from each category (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3B, C</bold>
</xref>). The results indicated that these molecules primarily participate in biological processes including enzyme activity regulation, organ development, signal transduction, and protein modification; in terms of cellular structure, they are mainly distributed in specialized membrane structures, enzyme complexes, and cell junctions; regarding molecular functions, they primarily involve various kinase activities and growth factor binding. Additionally, KEGG pathway enrichment analysis visualized the signaling pathways involving these molecules, which were primarily enriched in MAPK signaling pathway, cellular signal transduction, protein modification, and metabolic regulation pathways (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3D, E</bold>
</xref>).</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Pathway enrichment analysis of target genes. <bold>(A)</bold> Heatmap of 47 intersection genes between TPHP-influenced osteoporosis-related genes and differentially expressed genes from the GEO dataset. <bold>(B, C)</bold> GO enrichment analysis of target genes, including Biological Process (BP), Cellular Component (CC), and Molecular Function (MF) categories. <bold>(D, E)</bold> KEGG pathway enrichment analysis of target genes, where bubble size and histogram length represent the number of enriched genes.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-16-1606877-g003.tif">
<alt-text content-type="machine-generated">A series of bioinformatics plots and graphs analyze gene expression and pathway enrichment. Panel A shows a heatmap of various genes with differences between control and treatment groups, color-coded from blue to red. Panel B presents a dot plot highlighting enriched biological processes, cellular components, and molecular functions. Panel C is a bar chart depicting counts of gene ontology terms categorized by color. Panel D includes a dot plot showing pathway analysis results with significance levels in different colors. Panel E features a bar chart showing pathway counts and significance, aligned with the dot plot data.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_4">
<label>3.4</label>
<title>Core gene screening using machine learning algorithms</title>
<p>We employed LASSO regression machine learning algorithm to screen core osteoporosis-related genes. The LASSO regression algorithm established an osteoporosis-related model, identifying six disease-related candidate core target genes (IGF1R, NR3C1, MAP3K1, BRAF, WNK4, CNR2) (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4A, B</bold>
</xref>). To verify the accuracy of the selected candidate genes, we conducted ROC tests on both the candidate genes and the osteoporosis model. The ROC curve results showed AUC values greater than 0.7, confirming the scientific validity of the osteoporosis model construction (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4C, D</bold>
</xref>).</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Core target gene screening of TPHP-induced osteoporosis using machine learning algorithms. <bold>(A, B)</bold> Regression curves established by the LASSO regression model, selecting the optimal parameter value &#x3bb;. Six genes were identified as the most suitable candidate core targets at the lowest point of the curve. <bold>(C)</bold> ROC curve of the model, validating its accuracy. <bold>(D)</bold> ROC curves of six model candidate core genes, validating the scientific validity and accuracy of the selected candidate genes.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-16-1606877-g004.tif">
<alt-text content-type="machine-generated">A: Line graph showing binomial deviance versus Log(&#x3bb;). Red points indicate data with error bars. B: Line graph of coefficients against L1 norm with multiple colored lines. C: ROC curve titled &#x201c;Model&#x201d; with AUC of 1.000 and 95% CI of 1.000&#x2013;1.000. D: ROC curves for different models with legend showing AUC values; IGF1R, NR3C1, MAP3K1, PHKA2, WNK4 have AUC of 1.000, CNR2 has 0.972.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_5">
<label>3.5</label>
<title>Molecular docking of TPHP with core proteins</title>
<p>To explore the interaction characteristics between TPHP and the six key target proteins (IGF1R, NR3C1, MAP3K1, BRAF, WNK4, and CNR2), we conducted simulation analysis using AutoDock software. It is well known that binding energy below 0 kcal/mol indicates spontaneous binding between receptor and ligand without external energy, while binding energy below -5 kcal/mol indicates excellent binding. The molecular docking results showed that TPHP could tightly bind to the surface cavities of IGF1R, NR3C1, MAP3K1, BRAF, WNK4, and CNR2, with binding energies all below -5 kcal/mol (specifically -7.5, -6.2, -6.1, -8.9, -8.9, -6.4, -9.4 kcal/mol, respectively), indicating high binding stability. Using PyMOL software&#x2019;s three-dimensional visualization technology, we clearly demonstrated the most stable binding conformations (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5</bold>
</xref>), further confirming their tight interactions.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Molecular docking results and binding energies between core proteins and TPHP. <bold>(A)</bold> Binding of TPHP with Insulin-like growth factor 1 receptor (IGF1R), with a binding energy of -7.5 kcal/mol. <bold>(B)</bold> Binding of TPHP with Glucocorticoid receptor (NR3C1), with a binding energy of -6.2 kcal/mol. <bold>(C)</bold> Binding of TPHP with Mitogen-activated protein kinase kinase kinase 1 (MAP3K1), with a binding energy of -6.1 kcal/mol. <bold>(D)</bold> Binding of TPHP with B-Raf proto-oncogene serine/threonine-protein kinase (BRAF), with a binding energy of -8.9 kcal/mol. <bold>(E)</bold> Binding of TPHP with WNK lysine deficient protein kinase 4 (WNK4), with a binding energy of -6.4 kcal/mol. <bold>(F)</bold> Binding of TPHP with Cannabinoid receptor 2 (CNR2), with a binding energy of -9.4 kcal/mol.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-16-1606877-g005.tif">
<alt-text content-type="machine-generated">Six molecular interaction diagrams depicting protein-ligand complexes with binding energy values. A: IGF1R, -7.5 kcal/mol; B: NR3C1, -6.2 kcal/mol; C: MAP3K1, -6.1 kcal/mol; D: BRAF, -8.9 kcal/mol; E: WNK4, -6.4 kcal/mol; F: CNR2, -9.4 kcal/mol. Each structure features a zoomed-in view of the binding site.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_6">
<label>3.6</label>
<title>Cellular functional studies</title>
<p>To investigate the direct effects of TPHP on bone cells, we selected MC3T3-E1 mouse osteoblasts as our research model. Cells were exposed to TPHP at concentrations of 0, 10, 20, and 40 &#x3bc;M for 48 hours, and the effects were evaluated through scratch assays and CCK-8 detection. Results showed that TPHP significantly inhibited MC3T3-E1 cell migration in a concentration-dependent manner (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6A, B</bold>
</xref>). Cell viability assays further confirmed that TPHP exhibited significant inhibitory effects on cell proliferation, particularly pronounced at higher concentrations (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6C</bold>
</xref>). Migration and invasion assays verified TPHP&#x2019;s inhibitory effect on bone cell migration and invasion capabilities, while Western blot results indicated that TPHP could regulate EMT-related protein expression (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6D</bold>
</xref>). Based on previous pathway enrichment analysis, we further investigated whether TPHP affects bone cell function through the MAPK signaling pathway. Next, we explored its molecular mechanisms. Western blot analysis (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6F</bold>
</xref>) showed that TPhP treatment led to a significant decrease in the phosphorylation levels of p-MEK and p-ERK1/2 within the MAPK pathway, while p-P38 and p-JNK levels remained unchanged, suggesting that TPhP might specifically inhibit the MEK/ERK signaling axis. Concurrently, TPhP treatment upregulated the expression of the epithelial marker E-Cadherin and downregulated the mesenchymal marker N-Cadherin, indicating a potential impact on the cellular Epithelial-Mesenchymal Transition (EMT) process.</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Effects of TPHP on osteoblast function. <bold>(A, B)</bold> TPhP inhibits cell migration (Wound healing assay). <bold>(C)</bold> TPhP reduces cell proliferation (CCK-8 assay). <bold>(D, E)</bold> TPhP suppresses migration and invasion (Transwell assay). <bold>(F)</bold> Western blot showing TPhP effects on MAPK and EMT proteins. <bold>(G, H)</bold> MEK/ERK activator (C16-PAF) rescues TPhP-inhibited migration/invasion <bold>(G)</bold> and proliferation <bold>(H)</bold>, while an inhibitor (MEK-IN-6) does not. <bold>(I)</bold> Western blot confirming MAPK/ERK modulation in rescue experiments. <bold>(J)</bold> qPCR showing TPhP downregulates key target genes.(*P &lt; 0.05, **P &lt; 0.01, ***P &lt; 0.001).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-16-1606877-g006.tif">
<alt-text content-type="machine-generated">A series of scientific panels depicting cellular experiments. Panel A shows wound healing assays over different concentrations of a drug at 0 and 48 hours. Panel B presents a bar graph of migration rates with drug concentrations. Panel C is a line graph showing OD values over time. Panel D shows invasion and migration assays with varying drug concentrations. Panel E is a bar graph of relative cell counts in an invasion and migration study. Panel F illustrates invasion and migration with different treatments. Panel G is a bar graph comparing treatments' effects. Panel H shows a line graph of OD over time with various treatments. Panel I displays Western blots of protein expressions. Panel J is a bar graph of relative mRNA expression for different genes.</alt-text>
</graphic>
</fig>
<p>To validate the key role of the MAPK/ERK pathway, we employed a MEK/ERK activator (C16-PAF) and an inhibitor (MEK-IN-6). Results from Transwell (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6G</bold>
</xref>) and CCK-8 (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6H</bold>
</xref>) assays demonstrated that C16-PAF significantly reversed the TPhP-induced inhibition of cell invasion/migration and proliferation, indicating that reactivating the MEK/ERK pathway could &#x201c;rescue&#x201d; the negative effects of TPhP. In contrast, the MEK inhibitor MEK-IN-6 failed to reverse TPhP&#x2019;s effects. Correspondingly, Western blot results (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6I</bold>
</xref>) confirmed that C16-PAF restored the TPhP-suppressed phosphorylation levels of p-ERK1/2 and p-MEK1/2 and reversed the changes in E-Cadherin and N-Cadherin expression. Finally, we used qPCR to examine the effect of TPhP on the expression of the six previously identified key target genes. The results showed that, compared to the control group, 40 &#x3bc;M TPhP treatment significantly downregulated the mRNA levels of NR3C1, IGF1R, MAP3K1, BRAF, WNK4, and CNR2 (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6J</bold>
</xref>).</p>
<p>In summary, the results presented in <xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref> visually demonstrate that TPhP impairs the proliferation, migration, and invasion functions of MC3T3-E1 osteoblasts by inhibiting the MAPK/ERK signaling pathway and downregulating associated gene expression.</p>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<label>4</label>
<title>Discussion</title>
<p>This study systematically explored the potential effects of triphenyl phosphate (TPhP) on bone metabolism using network toxicology and molecular docking techniques. First, we integrated information from databases such as ChEMBL, STITCH, GeneCards, and OMIM, and combined this data with the STRING platform and Cytoscape software to construct a network of potential target interactions. Through this analysis, we identified six key targets, including IGF1R, NR3C1, MAP3K1, BRAF, WNK4, and CNR2, which revealed the core mechanisms by which TPhP affects bone metabolism and provided important clues for future research. Further, at the cellular functional level, we confirmed for the first time that TPhP significantly inhibits the proliferation and migration abilities of osteoblasts (MC3T3-E1 cells) in a dose-dependent manner. Specifically, exposure to high concentrations of TPhP led to significant inhibition of both cell migration and proliferation. Moreover, Western blot analysis indicated that TPhP regulates the expression of proteins related to epithelial-mesenchymal transition (EMT). qPCR results showed a significant downregulation of the expression levels of the six key target genes after TPhP treatment, which was highly consistent with the bioinformatics predictions. Through this multi-layered integrated approach, our study not only elucidated the potential molecular mechanisms of TPhP on bone metabolism but also provided a solid theoretical foundation for further investigation into its toxic effects.</p>
<p>Previous studies have highlighted that endocrine disruption and reproductive toxicity are significant effects of TPhP. Research has shown that TPhP can interfere with hormonal balance by binding to estrogen receptors or blocking related signaling pathways. For instance, in animal models, exposure to TPhP results in reduced sperm motility and abnormal morphology, which in turn affects reproductive ability (<xref ref-type="bibr" rid="B23">23</xref>). In females, TPhP affects ovarian development, decreases the expression of vitellogenin, and significantly weakens reproductive capability (<xref ref-type="bibr" rid="B24">24</xref>). Additionally, TPhP has been confirmed to activate tumor-related signaling pathways, promoting the proliferation of endometrial cancer cells, suggesting its potential carcinogenic risk (<xref ref-type="bibr" rid="B8">8</xref>). This aligns with our findings, as we identified 78 target molecules related to TPhP and osteoporosis, and the constructed PPI network, along with differential gene analysis, further focused on 47 significantly associated molecules. Pathway enrichment analysis indicated that TPhP can indirectly affect hormonal balance closely related to osteoporosis by actively interacting with estrogen receptor &#x3b1; (ER&#x3b1;). Estrogen plays a crucial role in bone remodeling, particularly in regulating the balance between osteoblasts and osteoclasts. Studies have shown that estrogen promotes osteoblast differentiation via the classic ER&#x3b1;-mediated gene transcription pathway, while inhibiting osteoclast formation and activity, thus reducing bone resorption (<xref ref-type="bibr" rid="B25">25</xref>). Other studies have shown that estrogen can inhibit the expression of RANKL and enhance the secretion of OPG, which suppresses osteoclast maturation while maintaining bone density (<xref ref-type="bibr" rid="B26">26</xref>). The significant decline in estrogen levels in peri-menopausal women is considered a major cause of osteoporosis, accompanied by accelerated bone resorption and degradation of trabecular structure (<xref ref-type="bibr" rid="B27">27</xref>, <xref ref-type="bibr" rid="B28">28</xref>). Increasing evidence suggests that estrogen plays an immune-regulatory role in maintaining the bone microenvironment, with studies showing that estrogen regulates macrophage and T-cell function, further affecting bone metabolism (<xref ref-type="bibr" rid="B29">29</xref>). Therefore, any exogenous chemicals that disrupt estrogen signaling pathways could significantly impact bone metabolism.</p>
<p>Our molecular docking results revealed stable binding characteristics between TPhP and the six key target proteins, with binding energies all below -5 kcal/mol, particularly showing a binding energy of -8.9 kcal/mol with BRAF and WNK4, indicating that these interactions may have biological significance. These results not only validate the key targets identified through bioinformatics methods but also aid in understanding the molecular&#xa0;mechanisms by which TPhP affects bone metabolism. Among the six targets, BRAF and MAP3K1 are key regulators of the MAPK signaling pathway, which is consistent with previous research as the&#xa0;MAPK pathway plays a critical role in osteoblast proliferation, differentiation, and apoptosis resistance (<xref ref-type="bibr" rid="B30">30</xref>, <xref ref-type="bibr" rid="B31">31</xref>). Abnormal activation or inhibition of BRAF could directly interfere with osteogenesis, while WNK4, a kinase primarily regulating ion transport and cellular homeostasis, shows a strong binding affinity with TPhP, suggesting that TPhP may promote osteoporosis by disrupting ion balance (<xref ref-type="bibr" rid="B32">32</xref>). Notably, the involvement of CNR2 provides a new direction for exploring the mechanism by which TPhP induces osteoporosis. CNR2, as a core receptor in the endogenous cannabinoid system, has been shown to play an active role in osteoblast differentiation and the regulation of bone resorption (<xref ref-type="bibr" rid="B33">33</xref>, <xref ref-type="bibr" rid="B34">34</xref>). Our molecular docking results show that TPhP has a high binding affinity with CNR2, which may suppress bone formation and accelerate bone resorption by interfering with CNR2 function. This finding is consistent with recent studies on the role of the endogenous cannabinoid system in bone metabolism, providing new targets for exploring the mechanisms by which environmental pollutants disrupt bone metabolism. <italic>In vitro</italic> experiments further validated the direct inhibitory effect of TPhP on osteoblasts. Scratch assays and CCK-8 assays showed that TPhP significantly inhibited the migration and proliferation abilities of MC3T3-E1 osteoblasts in a concentration-dependent manner. This inhibitory effect may be mediated through the MAPK signaling pathway, specifically as our Western blot results showed a significant downregulation of ERK phosphorylation in the MAPK pathway after TPhP treatment, while JNK and p38 pathways were not significantly altered; concurrently, qPCR analyses also showed downregulation of key genes related to upstream MAPK signaling. These findings collectively point toward TPhP interfering with osteoblast function by specifically affecting the MAPK/ERK signaling axis. The changes in the expression of EMT-related proteins particularly suggest that TPhP may further reduce osteoblast functional activity by affecting cell adhesion.</p>
<p>To further clarify the molecular mechanisms of TPhP on bone metabolism, experimental validation of the computational network analysis results is essential. However, there are some limitations in the current study. First, existing toxicity assessments primarily focus on cellular levels and have not fully considered the complex molecular disturbances that may occur <italic>in vivo</italic>, nor their conservation across different biological systems. Second, the causal relationship between TPhP exposure and bone metabolic abnormalities has not been clearly verified in animal models. The acute, high-dose exposure model used in the experiments may not accurately reflect the long-term, low-dose exposure scenario in humans due to environmental pollution and consumer product contact with TPhP. Moreover, the complexity of bone metabolic diseases, especially in aging populations, is often influenced by long-term, multifactorial factors, suggesting that short-term animal experiments may not fully reveal the cumulative effects of chronic low-dose TPhP exposure on human bone health.</p>
<p>In conclusion, this study provides strong evidence for the multi-layered mechanisms by which TPhP interferes with bone metabolism, including hormonal disruption, signaling pathway dysregulation, and ion homeostasis disturbance. These findings not only deepen our understanding of the toxic effects of TPhP on bone health but also highlight potential molecular targets for mitigating its adverse impacts. Future studies should focus on <italic>in vivo</italic> validation of these mechanisms and explore intervention strategies to address TPhP exposure.</p>
</sec>
</body>
<back>
<sec id="s5" sec-type="data-availability">
<title>Data availability statement</title>
<p>The original contributions presented in the study are included in the article/<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Material</bold>
</xref>. Further inquiries can be directed to the corresponding authors.</p>
</sec>
<sec id="s6" sec-type="author-contributions">
<title>Author contributions</title>
<p>MX: Conceptualization, Methodology, Software, Visualization, Writing &#x2013; original draft. YW: Conceptualization, Methodology, Software, Visualization, Writing &#x2013; original draft. JM: Conceptualization, Methodology, Software, Visualization, Writing &#x2013; original draft. MC: Conceptualization, Methodology, Project administration, Supervision, Validation, Writing &#x2013; review &amp; editing. CD: Conceptualization, Methodology, Software, Validation, Writing &#x2013; review &amp; editing.</p>
</sec>
<sec id="s7" sec-type="funding-information">
<title>Funding</title>
<p>The author(s) declare that no financial support was received for the research and/or publication of this article.</p>
</sec>
<ack>
<title>Acknowledgments</title>
<p>We appreciate the developers of the open-access bioinformatics tools and databases (ChEMBL, STITCH, STRING, DAVID, Metascape, and AutoDock) that facilitated our computational analyses. Finally, we thank all colleagues who provided critical insights during the revision process.</p>
</ack>
<sec id="s8" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s9" sec-type="ai-statement">
<title>Generative AI statement</title>
<p>The author(s) declare that no Generative AI was used in the creation of this manuscript.</p>
</sec>
<sec id="s10" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s11" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fendo.2025.1606877/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fendo.2025.1606877/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="DataSheet1.pdf" id="SM1" mimetype="application/pdf"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Guo</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>M</given-names>
</name>
<name>
<surname>Liao</surname> <given-names>M</given-names>
</name>
<name>
<surname>Su</surname> <given-names>S</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>W</given-names>
</name>
<name>
<surname>Gan</surname> <given-names>Z</given-names>
</name>
</person-group>. <article-title>Organophosphorus flame retardants and their metabolites in paired human blood and urine</article-title>. <source>Ecotoxicol Environ Saf</source>. (<year>2023</year>) <volume>268</volume>:<fpage>115696</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ecoenv.2023.115696</pub-id>, PMID: <pub-id pub-id-type="pmid">37979363</pub-id></citation></ref>
<ref id="B2">
<label>2</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ai</surname> <given-names>S</given-names>
</name>
<name>
<surname>Li</surname> <given-names>J</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>X</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>S</given-names>
</name>
<name>
<surname>Ge</surname> <given-names>G</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Z</given-names>
</name>
</person-group>. <article-title>Derivation of aquatic predicted no-effect concentration and ecological risk assessment for triphenyl phosphate and tris(1,3-dichloro-2-propyl) phosphate</article-title>. <source>Sci Total Environ</source>. (<year>2024</year>) <volume>913</volume>:<fpage>169756</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.scitotenv.2023.169756</pub-id>, PMID: <pub-id pub-id-type="pmid">38171460</pub-id></citation></ref>
<ref id="B3">
<label>3</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>He</surname> <given-names>CT</given-names>
</name>
<name>
<surname>Zheng</surname> <given-names>J</given-names>
</name>
<name>
<surname>Qiao</surname> <given-names>L</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>SJ</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>JZ</given-names>
</name>
<name>
<surname>Yuan</surname> <given-names>JG</given-names>
</name>
<etal/>
</person-group>. <article-title>Occurrence of organophosphorus flame retardants in indoor dust in multiple microenvironments of southern China and implications for human exposure</article-title>. <source>Chemosphere</source>. (<year>2015</year>) <volume>133</volume>:<fpage>47</fpage>&#x2013;<lpage>52</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.chemosphere.2015.03.043</pub-id>, PMID: <pub-id pub-id-type="pmid">25898308</pub-id></citation></ref>
<ref id="B4">
<label>4</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>M</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Y</given-names>
</name>
<etal/>
</person-group>. <article-title>Triphenyl phosphate interferes with the synthesis of steroid hormones through the PPAR&#x3b3;/CD36 pathway in human trophoblast JEG-3 cells</article-title>. <source>Environ Toxicol</source>. (<year>2024</year>) <volume>39</volume>:<page-range>3400&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/tox.24186</pub-id>, PMID: <pub-id pub-id-type="pmid">38450882</pub-id></citation></ref>
<ref id="B5">
<label>5</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Argaw</surname> <given-names>AT</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Snyder</surname> <given-names>BJ</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>ML</given-names>
</name>
<name>
<surname>Kopp</surname> <given-names>N</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>SC</given-names>
</name>
<etal/>
</person-group>. <article-title>IL-1beta regulates blood-brain barrier permeability via reactivation of the hypoxia-angiogenesis program</article-title>. <source>J Immunol</source>. (<year>2006</year>) <volume>177</volume>:<page-range>5574&#x2013;84</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.4049/jimmunol.177.8.5574</pub-id>, PMID: <pub-id pub-id-type="pmid">17015745</pub-id></citation></ref>
<ref id="B6">
<label>6</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hong</surname> <given-names>X</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>R</given-names>
</name>
<name>
<surname>Hou</surname> <given-names>R</given-names>
</name>
<name>
<surname>Yuan</surname> <given-names>L</given-names>
</name>
<name>
<surname>Zha</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>Triphenyl phosphate (TPHP)-induced neurotoxicity in adult male chinese rare minnows (Gobiocypris rarus)</article-title>. <source>Environ Sci Technol</source>. (<year>2018</year>) <volume>52</volume>:<page-range>11895&#x2013;903</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1021/acs.est.8b04079</pub-id>, PMID: <pub-id pub-id-type="pmid">30251850</pub-id></citation></ref>
<ref id="B7">
<label>7</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>R</given-names>
</name>
<name>
<surname>Hong</surname> <given-names>X</given-names>
</name>
<name>
<surname>Yan</surname> <given-names>S</given-names>
</name>
<name>
<surname>Zha</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>Three organophosphate flame retardants (OPFRs) reduce sperm quality in Chinese rare minnows (Gobiocypris rarus)</article-title>. <source>Environ pollut</source>. (<year>2020</year>) <volume>263</volume>:<fpage>114525</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.envpol.2020.114525</pub-id>, PMID: <pub-id pub-id-type="pmid">32289612</pub-id></citation></ref>
<ref id="B8">
<label>8</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kwon</surname> <given-names>HY</given-names>
</name>
<name>
<surname>Park</surname> <given-names>SB</given-names>
</name>
<name>
<surname>Han</surname> <given-names>M</given-names>
</name>
<name>
<surname>Park</surname> <given-names>JW</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Han</surname> <given-names>SJ</given-names>
</name>
<etal/>
</person-group>. <article-title>Triphenyl phosphate activates estrogen receptor &#x3b1;/NF-&#x3ba;B/cyclin D1 signaling to stimulate cell cycle progression in human Ishikawa endometrial cancer cells</article-title>. <source>Obstet Gynecol Sci</source>. (<year>2022</year>) <volume>65</volume>:<page-range>531&#x2013;41</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.5468/ogs.22108</pub-id>, PMID: <pub-id pub-id-type="pmid">36254600</pub-id></citation></ref>
<ref id="B9">
<label>9</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shi</surname> <given-names>C</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>C</given-names>
</name>
<name>
<surname>Zeng</surname> <given-names>L</given-names>
</name>
<name>
<surname>Peng</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Hao</surname> <given-names>H</given-names>
</name>
<etal/>
</person-group>. <article-title>Triphenyl phosphate induced reproductive toxicity through the JNK signaling pathway in Caenorhabditis elegans</article-title>. <source>J Hazard Mater</source>. (<year>2023</year>) <volume>446</volume>:<fpage>130643</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jhazmat.2022.130643</pub-id>, PMID: <pub-id pub-id-type="pmid">36586333</pub-id></citation></ref>
<ref id="B10">
<label>10</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Morris</surname> <given-names>PJ</given-names>
</name>
<name>
<surname>Medina-Cleghorn</surname> <given-names>D</given-names>
</name>
<name>
<surname>Heslin</surname> <given-names>A</given-names>
</name>
<name>
<surname>King</surname> <given-names>SM</given-names>
</name>
<name>
<surname>Orr</surname> <given-names>J</given-names>
</name>
<name>
<surname>Mulvihill</surname> <given-names>MM</given-names>
</name>
<etal/>
</person-group>. <article-title>Organophosphorus flame retardants inhibit specific liver carboxylesterases and cause serum hypertriglyceridemia</article-title>. <source>ACS Chem Biol</source>. (<year>2014</year>) <volume>9</volume>:<page-range>1097&#x2013;103</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1021/cb500014r</pub-id>, PMID: <pub-id pub-id-type="pmid">24597639</pub-id></citation></ref>
<ref id="B11">
<label>11</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Du</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>G</given-names>
</name>
<name>
<surname>Peng</surname> <given-names>J</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Gao</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>TPhP exposure disturbs carbohydrate metabolism, lipid metabolism, and the DNA damage repair system in zebrafish liver</article-title>. <source>Sci Rep</source>. (<year>2016</year>) <volume>6</volume>:<fpage>21827</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/srep21827</pub-id>, PMID: <pub-id pub-id-type="pmid">26898711</pub-id></citation></ref>
<ref id="B12">
<label>12</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ramesh</surname> <given-names>M</given-names>
</name>
<name>
<surname>Angitha</surname> <given-names>S</given-names>
</name>
<name>
<surname>Haritha</surname> <given-names>S</given-names>
</name>
<name>
<surname>Poopal</surname> <given-names>RK</given-names>
</name>
<name>
<surname>Ren</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Umamaheswari</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>Organophosphorus flame retardant induced hepatotoxicity and brain AChE inhibition on zebrafish (Danio rerio)</article-title>. <source>Neurotoxicol Teratol</source>. (<year>2020</year>) <volume>82</volume>:<fpage>106919</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ntt.2020.106919</pub-id>, PMID: <pub-id pub-id-type="pmid">32853706</pub-id></citation></ref>
<ref id="B13">
<label>13</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Sha</surname> <given-names>W</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>C</given-names>
</name>
<name>
<surname>Li</surname> <given-names>J</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>C</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>C</given-names>
</name>
<etal/>
</person-group>. <article-title>Toxic effect of triphenyl phosphate (TPHP) on Cyprinus carpio and the intestinal microbial community response</article-title>. <source>Chemosphere</source>. (<year>2022</year>) <volume>299</volume>:<fpage>134463</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.chemosphere.2022.134463</pub-id>, PMID: <pub-id pub-id-type="pmid">35367484</pub-id></citation></ref>
<ref id="B14">
<label>14</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hogberg</surname> <given-names>HT</given-names>
</name>
<name>
<surname>de C&#xe1;ssia da Silveira</surname> <given-names>ESR</given-names>
</name>
<name>
<surname>Kleensang</surname> <given-names>A</given-names>
</name>
<name>
<surname>Bouhifd</surname> <given-names>M</given-names>
</name>
<name>
<surname>Cemiloglu Ulker</surname> <given-names>O</given-names>
</name>
<name>
<surname>Smirnova</surname> <given-names>L</given-names>
</name>
<etal/>
</person-group>. <article-title>Organophosphorus flame retardants are developmental neurotoxicants in a rat primary brainsphere <italic>in vitro</italic> model</article-title>. <source>Arch Toxicol</source>. (<year>2021</year>) <volume>95</volume>:<page-range>207&#x2013;28</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00204-020-02903-2</pub-id>, PMID: <pub-id pub-id-type="pmid">33078273</pub-id></citation></ref>
<ref id="B15">
<label>15</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>M</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>J</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Li</surname> <given-names>G</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Z</given-names>
</name>
</person-group>. <article-title>Sub-chronic ecotoxicity of triphenyl phosphate to earthworms (Eisenia fetida) in artificial soil: Oxidative stress and DNA damage</article-title>. <source>Ecotoxicol Environ Saf</source>. (<year>2022</year>) <volume>241</volume>:<fpage>113796</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ecoenv.2022.113796</pub-id>, PMID: <pub-id pub-id-type="pmid">35751932</pub-id></citation></ref>
<ref id="B16">
<label>16</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rachner</surname> <given-names>TD</given-names>
</name>
<name>
<surname>Khosla</surname> <given-names>S</given-names>
</name>
<name>
<surname>Hofbauer</surname> <given-names>LC</given-names>
</name>
</person-group>. <article-title>Osteoporosis: now and the future</article-title>. <source>Lancet</source>. (<year>2011</year>) <volume>377</volume>:<page-range>1276&#x2013;87</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S0140-6736(10)62349-5</pub-id>, PMID: <pub-id pub-id-type="pmid">21450337</pub-id></citation></ref>
<ref id="B17">
<label>17</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Snega Priya</surname> <given-names>P</given-names>
</name>
<name>
<surname>Pratiksha Nandhini</surname> <given-names>P</given-names>
</name>
<name>
<surname>Arockiaraj</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>A comprehensive review on environmental pollutants and osteoporosis: Insights into molecular pathways</article-title>. <source>Environ Res</source>. (<year>2023</year>) <volume>237</volume>:<fpage>117103</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.envres.2023.117103</pub-id>, PMID: <pub-id pub-id-type="pmid">37689340</pub-id></citation></ref>
<ref id="B18">
<label>18</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mousavibaygei</surname> <given-names>SR</given-names>
</name>
<name>
<surname>Bisadi</surname> <given-names>A</given-names>
</name>
<name>
<surname>ZareSakhvidi</surname> <given-names>F</given-names>
</name>
</person-group>. <article-title>Outdoor air pollution exposure, bone mineral density, osteoporosis, and osteoporotic fractures: A systematic review and meta-analysis</article-title>. <source>Sci Total Environ</source>. (<year>2023</year>) <volume>865</volume>:<fpage>161117</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.scitotenv.2022.161117</pub-id>, PMID: <pub-id pub-id-type="pmid">36586679</pub-id></citation></ref>
<ref id="B19">
<label>19</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lin</surname> <given-names>LY</given-names>
</name>
<name>
<surname>Wen</surname> <given-names>LL</given-names>
</name>
<name>
<surname>Su</surname> <given-names>TC</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>PC</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>CY</given-names>
</name>
</person-group>.     <article-title>Negative association between serum perfluorooctane sulfate concentration and bone mineral density in US premenopausal women: NHANENHANES 2005-2008</article-title>. <source>J Clin Endocrinol Metab</source>. (<year>2014</year>) <volume>99</volume>:<page-range>2173&#x2013;80</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1210/jc.2013-3409</pub-id>, PMID: <pub-id pub-id-type="pmid">24606077</pub-id></citation></ref>
<ref id="B20">
<label>20</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>H</given-names>
</name>
<name>
<surname>Tang</surname> <given-names>M</given-names>
</name>
<name>
<surname>Pei</surname> <given-names>E</given-names>
</name>
<name>
<surname>Shen</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>A</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Blocking the E2F transcription factor 1/high-mobility group box 2 pathway enhances the intervention effects of &#x3b1;-santalol on the Malignant behaviors of liver cancer cells</article-title>. <source>Int J Biochem Cell Biol</source>. (<year>2024</year>) <volume>168</volume>:<fpage>106516</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.biocel.2024.106516</pub-id>, PMID: <pub-id pub-id-type="pmid">38219975</pub-id></citation></ref>
<ref id="B21">
<label>21</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Preston</surname> <given-names>EV</given-names>
</name>
<name>
<surname>McClean</surname> <given-names>MD</given-names>
</name>
<name>
<surname>Claus Henn</surname> <given-names>B</given-names>
</name>
<name>
<surname>Stapleton</surname> <given-names>HM</given-names>
</name>
<name>
<surname>Braverman</surname> <given-names>LE</given-names>
</name>
<name>
<surname>Pearce</surname> <given-names>EN</given-names>
</name>
<etal/>
</person-group>. <article-title>Associations between urinary diphenyl phosphate and thyroid function</article-title>. <source>Environ Int</source>. (<year>2017</year>) <volume>101</volume>:<page-range>158&#x2013;64</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.envint.2017.01.020</pub-id>, PMID: <pub-id pub-id-type="pmid">28162782</pub-id></citation></ref>
<ref id="B22">
<label>22</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yue</surname> <given-names>J</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>X</given-names>
</name>
<name>
<surname>Duan</surname> <given-names>X</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>C</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>H</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>H</given-names>
</name>
<etal/>
</person-group>. <article-title>Triphenyl phosphate proved more potent than its metabolite diphenyl phosphate in inducing hepatic insulin resistance through endoplasmic reticulum stress</article-title>. <source>Environ Int</source>. (<year>2023</year>) <volume>172</volume>:<fpage>107749</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.envint.2023.107749</pub-id>, PMID: <pub-id pub-id-type="pmid">36680801</pub-id></citation></ref>
<ref id="B23">
<label>23</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nakayama</surname> <given-names>A</given-names>
</name>
<name>
<surname>Hattori</surname> <given-names>T</given-names>
</name>
<name>
<surname>Isobe</surname> <given-names>A</given-names>
</name>
<name>
<surname>Kobayashi</surname> <given-names>S</given-names>
</name>
<name>
<surname>Suzuki</surname> <given-names>G</given-names>
</name>
<name>
<surname>Takigami</surname> <given-names>H</given-names>
</name>
<etal/>
</person-group>. <article-title>The effects of 28-day early-life exposure to triphenyl phosphate (TPhP) on odor preference and sexual behavior in female rats</article-title>. <source>J Appl Toxicol</source>. (<year>2020</year>) <volume>40</volume>:<page-range>1614&#x2013;21</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/jat.v40.12</pub-id>, PMID: <pub-id pub-id-type="pmid">32567707</pub-id></citation></ref>
<ref id="B24">
<label>24</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>R</given-names>
</name>
<name>
<surname>He</surname> <given-names>J</given-names>
</name>
<name>
<surname>Ma</surname> <given-names>H</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>F</given-names>
</name>
<name>
<surname>Tao</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>Triphenyl Phosphate at Environmental Levels Retarded Ovary Development and Reduced Egg Production in Japanese Medaka (Oryzias latipes)</article-title>. <source>Environ Sci Technol</source>. (<year>2019</year>) <volume>53</volume>:<page-range>14709&#x2013;15</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1021/acs.est.9b05669</pub-id>, PMID: <pub-id pub-id-type="pmid">31751126</pub-id></citation></ref>
<ref id="B25">
<label>25</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Martin-Millan</surname> <given-names>M</given-names>
</name>
<name>
<surname>Almeida</surname> <given-names>M</given-names>
</name>
<name>
<surname>Ambrogini</surname> <given-names>E</given-names>
</name>
<name>
<surname>Han</surname> <given-names>L</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>H</given-names>
</name>
<name>
<surname>Weinstein</surname> <given-names>RS</given-names>
</name>
<etal/>
</person-group>. <article-title>The estrogen receptor-alpha in osteoclasts mediates the protective effects of estrogens on cancellous but not cortical bone</article-title>. <source>Mol Endocrinol</source>. (<year>2010</year>) <volume>24</volume>:<page-range>323&#x2013;34</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1210/me.2009-0354</pub-id>, PMID: <pub-id pub-id-type="pmid">20053716</pub-id></citation></ref>
<ref id="B26">
<label>26</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bord</surname> <given-names>S</given-names>
</name>
<name>
<surname>Ireland</surname> <given-names>DC</given-names>
</name>
<name>
<surname>Beavan</surname> <given-names>SR</given-names>
</name>
<name>
<surname>Compston</surname> <given-names>JE</given-names>
</name>
</person-group>. <article-title>The effects of estrogen on osteoprotegerin, RANKL, and estrogen receptor expression in human osteoblasts</article-title>. <source>Bone</source>. (<year>2003</year>) <volume>32</volume>:<page-range>136&#x2013;41</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S8756-3282(02)00953-5</pub-id>, PMID: <pub-id pub-id-type="pmid">12633785</pub-id></citation></ref>
<ref id="B27">
<label>27</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ahmadieh</surname> <given-names>H</given-names>
</name>
<name>
<surname>Basho</surname> <given-names>A</given-names>
</name>
<name>
<surname>Chehade</surname> <given-names>A</given-names>
</name>
<name>
<surname>Al Mallah</surname> <given-names>A</given-names>
</name>
<name>
<surname>Dakour</surname> <given-names>A</given-names>
</name>
</person-group>. <article-title>Perception of peri-menopausal and postmenopausal Lebanese women on osteoporosis: A cross-sectional study</article-title>. <source>J Clin Transl Endocrinol</source>. (<year>2018</year>) <volume>14</volume>:<fpage>19</fpage>&#x2013;<lpage>24</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jcte.2018.10.001</pub-id>, PMID: <pub-id pub-id-type="pmid">30310769</pub-id></citation></ref>
<ref id="B28">
<label>28</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Luo</surname> <given-names>X</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>L</given-names>
</name>
</person-group>. <article-title>Association of changes in relevant indicators with cardiovascular disease and osteoporosis in perimenopausal and postmenopausal women</article-title>. <source>Food Sci Nutr</source>. (<year>2024</year>) <volume>12</volume>:<page-range>10296&#x2013;305</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/fsn3.v12.12</pub-id>, PMID: <pub-id pub-id-type="pmid">39723090</pub-id></citation></ref>
<ref id="B29">
<label>29</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>D&#x2019;Amelio</surname> <given-names>P</given-names>
</name>
<name>
<surname>Grimaldi</surname> <given-names>A</given-names>
</name>
<name>
<surname>Di Bella</surname> <given-names>S</given-names>
</name>
<name>
<surname>Brianza</surname> <given-names>SZM</given-names>
</name>
<name>
<surname>Cristofaro</surname> <given-names>MA</given-names>
</name>
<name>
<surname>Tamone</surname> <given-names>C</given-names>
</name>
<etal/>
</person-group>. <article-title>Estrogen deficiency increases osteoclastogenesis up-regulating T cells activity: a key mechanism in osteoporosis</article-title>. <source>Bone</source>. (<year>2008</year>) <volume>43</volume>:<fpage>92</fpage>&#x2013;<lpage>100</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.bone.2008.02.017</pub-id>, PMID: <pub-id pub-id-type="pmid">18407820</pub-id></citation></ref>
<ref id="B30">
<label>30</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Qiao</surname> <given-names>X</given-names>
</name>
<name>
<surname>Nie</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Ma</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Cheng</surname> <given-names>R</given-names>
</name>
<name>
<surname>Yin</surname> <given-names>W</given-names>
</name>
<etal/>
</person-group>. <article-title>Corrigendum: Irisin promotes osteoblast proliferation and differentiation via activating the MAP kinase signaling pathways</article-title>. <source>Sci Rep</source>. (<year>2016</year>) <volume>6</volume>:<fpage>21053</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/srep21053</pub-id>, PMID: <pub-id pub-id-type="pmid">26876774</pub-id></citation></ref>
<ref id="B31">
<label>31</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhao</surname> <given-names>P</given-names>
</name>
<name>
<surname>Xiao</surname> <given-names>L</given-names>
</name>
<name>
<surname>Peng</surname> <given-names>J</given-names>
</name>
<name>
<surname>Qian</surname> <given-names>YQ</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>CC</given-names>
</name>
</person-group>. <article-title>Exosomes derived from bone marrow mesenchymal stem cells improve osteoporosis through promoting osteoblast proliferation via MAPK pathway</article-title>. <source>Eur Rev Med Pharmacol Sci</source>. (<year>2018</year>) <volume>22</volume>:<page-range>3962&#x2013;70</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.26355/eurrev_201806_15280</pub-id>, PMID: <pub-id pub-id-type="pmid">29949171</pub-id></citation></ref>
<ref id="B32">
<label>32</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ch&#xe1;vez-Canales</surname> <given-names>M</given-names>
</name>
<name>
<surname>Garc&#xed;a</surname> <given-names>JA</given-names>
</name>
<name>
<surname>Gamba</surname> <given-names>G</given-names>
</name>
</person-group>. <article-title>Regulation of the WNK4-SPAK-NCC pathway by the calcium-sensing receptor</article-title>. <source>Curr Opin Nephrol Hypertens</source>. (<year>2023</year>) <volume>32</volume>:<page-range>451&#x2013;7</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1097/MNH.0000000000000915</pub-id>, PMID: <pub-id pub-id-type="pmid">37530086</pub-id></citation></ref>
<ref id="B33">
<label>33</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sophocleous</surname> <given-names>A</given-names>
</name>
<name>
<surname>Marino</surname> <given-names>S</given-names>
</name>
<name>
<surname>Kabir</surname> <given-names>D</given-names>
</name>
<name>
<surname>Ralston</surname> <given-names>SH</given-names>
</name>
<name>
<surname>Idris</surname> <given-names>AI</given-names>
</name>
</person-group>. <article-title>Combined deficiency of the Cnr1 and Cnr2 receptors protects against age-related bone loss by osteoclast inhibition</article-title>. <source>Aging Cell</source>. (<year>2017</year>) <volume>16</volume>:<page-range>1051&#x2013;61</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/acel.2017.16.issue-5</pub-id>, PMID: <pub-id pub-id-type="pmid">28752643</pub-id></citation></ref>
<ref id="B34">
<label>34</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hao</surname> <given-names>R</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>B</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>H</given-names>
</name>
<name>
<surname>Huo</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>Y</given-names>
</name>
</person-group>. <article-title>lncRNA TUG1 promotes proliferation and differentiation of osteoblasts by regulating the miR-545-3p/CNR2 axis</article-title>. <source>Braz J Med Biol Res</source>. (<year>2020</year>) <volume>53</volume>:<fpage>e9798</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1590/1414-431x20209798</pub-id>, PMID: <pub-id pub-id-type="pmid">33053117</pub-id></citation></ref>
</ref-list>
</back>
</article>