<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Endocrinol.</journal-id>
<journal-title>Frontiers in Endocrinology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Endocrinol.</abbrev-journal-title>
<issn pub-type="epub">1664-2392</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fendo.2024.1400022</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Endocrinology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Activation of estrogen-related receptor &#x3b3; by calcium and cadmium</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Qiaochu</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2260435"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Huang</surname>
<given-names>Nanxi</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Psaltis</surname>
<given-names>John B.</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2785402"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Gahtani</surname>
<given-names>Reem M.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Yan</surname>
<given-names>Gai</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Lu</surname>
<given-names>Dajun</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Cahalan</surname>
<given-names>Shannon R.</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1116345"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Shi</surname>
<given-names>Xu</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Copeland</surname>
<given-names>Robert L.</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Haddad</surname>
<given-names>Bassem R.</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2659013"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Martin</surname>
<given-names>Mary Beth</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2646049"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Department of Biochemistry and Molecular and Cellular Biology, Georgetown University</institution>, <addr-line>Washington, DC</addr-line>, <country>United States</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Oncology, Georgetown University</institution>, <addr-line>Washington DC</addr-line>, <country>United States</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Department of Pharmacology, College of Medicine, Howard University</institution>, <addr-line>Washington, DC</addr-line>, <country>United States</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Guillermo Romero, University of Pittsburgh, United States</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Tao Nie, Hubei University of Arts and Science, China</p>
<p>Brian D. Cohen, Union College, United States</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Mary Beth Martin, <email xlink:href="mailto:martinmb@georgetown.edu">martinmb@georgetown.edu</email>
</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>23</day>
<month>10</month>
<year>2024</year>
</pub-date>
<pub-date pub-type="collection">
<year>2024</year>
</pub-date>
<volume>15</volume>
<elocation-id>1400022</elocation-id>
<history>
<date date-type="received">
<day>12</day>
<month>03</month>
<year>2024</year>
</date>
<date date-type="accepted">
<day>16</day>
<month>09</month>
<year>2024</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2024 Wang, Huang, Psaltis, Gahtani, Yan, Lu, Cahalan, Shi, Copeland, Haddad and Martin</copyright-statement>
<copyright-year>2024</copyright-year>
<copyright-holder>Wang, Huang, Psaltis, Gahtani, Yan, Lu, Cahalan, Shi, Copeland, Haddad and Martin</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<sec>
<title>Objective</title>
<p>Estrogen-related receptor &#x3b3; (ERR&#x3b3;) is a metabolic regulator with no identified physiological ligands. This study investigates whether calcium is an ERR&#x3b3; ligand that mediates the effects of glucagon and whether cadmium, which mimics the effects of calcium, disrupts metabolism through ERR&#x3b3;.</p>
</sec>
<sec>
<title>Method</title>
<p>HepG2, MCF-7, and HEK293T transfected with ERR&#x3b3; were treated with glucagon, calcium, cadmium, ERR&#x3b3; agonist, or ERR&#x3b3; inhibitor. Cells were then collected for <italic>in vitro</italic> assays including real-time qPCR, Western blot, ChIP, immunofluorescence, mutational analysis, or gene set enrichment analysis. Molecular dynamics simulations were performed to study mutation sites.</p>
</sec>
<sec>
<title>Results</title>
<p>In HepG2 cells, treatment with glucagon, calcium, or cadmium re-localized ERR&#x3b3; to the cell nucleus, recruited ERR&#x3b3; to estrogen-related response elements, induced the expression of ERR&#x3b3;-regulated genes, and increased extracellular glucose that was blocked by an ERR&#x3b3; antagonist. In MCF-7 cells and HEK293T cells transfected with ERR&#x3b3;, similar treatments induced the expression of metabolic genes. Mutational analysis identified S303, T429, and E452 in the ligand-binding domain as potential interaction sites. Molecular dynamics simulations showed that calcium induced changes in ERR&#x3b3; similar to ERR&#x3b3; agonist.</p>
</sec>
<sec>
<title>Conclusion</title>
<p>The results suggest that calcium is a potential ligand of ERR&#x3b3; that mediates the effects of glucagon and cadmium disrupts metabolism through ERR&#x3b3;.</p>
</sec>
</abstract>
<kwd-group>
<kwd>estrogen-related receptor &#x3b3;</kwd>
<kwd>gluconeogenesis</kwd>
<kwd>metals</kwd>
<kwd>calcium</kwd>
<kwd>cadmium</kwd>
</kwd-group>
<contract-num rid="cn001">T32-CA009686, U01-ES026132, 2UL1TR001409, P30-CA51008</contract-num>
<contract-sponsor id="cn001">National Institutes of Health<named-content content-type="fundref-id">10.13039/100000002</named-content>
</contract-sponsor>
<counts>
<fig-count count="7"/>
<table-count count="1"/>
<equation-count count="0"/>
<ref-count count="74"/>
<page-count count="19"/>
<word-count count="9972"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Cellular Endocrinology</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<title>Introduction</title>
<p>Disruption of metabolism is associated with many diseases, including obesity, type 2 diabetes, nonalcoholic fatty liver disease, and several cancers including breast, liver, and prostate cancers as well as many other medical conditions (<xref ref-type="bibr" rid="B1">1</xref>&#x2013;<xref ref-type="bibr" rid="B4">4</xref>). The soaring rates of these associated diseases pose a big threat to society (<xref ref-type="bibr" rid="B5">5</xref>). For example, there are at least 400 million obese adults worldwide according to the World Health Organization, the number of which will only increase in the next decades (<xref ref-type="bibr" rid="B6">6</xref>). It is also predicted that worldwide, the number of patients with diabetes will rise from 171 million in 2011 to approximately 366 million in 2030 (<xref ref-type="bibr" rid="B7">7</xref>, <xref ref-type="bibr" rid="B8">8</xref>). Genetics, lifestyle, and exposure to environmental toxins have been identified as risk factors for developing metabolic diseases; however, the mechanisms underlying the risk are not fully understood. There is increasing evidence linking exposure to environmental contaminants, such as bisphenol A (BPA), pesticides, and cadmium, to the disruption of metabolism in humans (<xref ref-type="bibr" rid="B3">3</xref>, <xref ref-type="bibr" rid="B4">4</xref>). Several studies have linked cadmium with obesity and type 2 diabetes (<xref ref-type="bibr" rid="B9">9</xref>, <xref ref-type="bibr" rid="B10">10</xref>). Cadmium is a heavy metal. Exposure to the metal occurs through industrial applications and agricultural products, such as food and tobacco, as a result of cadmium-contaminated soil and water. Our published results in rodents show that dietary exposure to environmentally relevant amounts of the metal cadmium or the metalloid arsenite increased body weight in a rodent model (<xref ref-type="bibr" rid="B11">11</xref>). In addition to cadmium, several studies demonstrate that the metal calcium is essential in metabolism, suggesting that alteration in calcium homeostasis or frequent exposure to some metals and metalloids disrupts cellular signaling and strongly influences metabolism (<xref ref-type="bibr" rid="B7">7</xref>, <xref ref-type="bibr" rid="B9">9</xref>, <xref ref-type="bibr" rid="B11">11</xref>&#x2013;<xref ref-type="bibr" rid="B16">16</xref>).</p>
<p>The estrogen-related receptors (ERRs) are members of the superfamily of nuclear receptors that share similar structures and sequences to other nuclear receptors. There are three isoforms of ERRs: ERR&#x3b1;, ERR&#x3b2;, and ERR&#x3b3;. Although ERRs share high homology with estrogen receptor &#x3b1; (ER&#x3b1;), ERRs do not bind estrogens or participate in estrogen-regulated pathways (<xref ref-type="bibr" rid="B17">17</xref>). Instead, ERR&#x3b1; and ERR&#x3b3; are involved in the regulation of metabolism and ERR&#x3b2; is involved in stemness (<xref ref-type="bibr" rid="B18">18</xref>&#x2013;<xref ref-type="bibr" rid="B20">20</xref>). Because of the important role of ERR&#x3b3; in regulating metabolism, there has been an intensive research effort to identify natural ligands for ERRs. However, no natural ligands for the receptors have been identified so far but recent studies have identified a few synthetic ligands (<xref ref-type="bibr" rid="B19">19</xref>, <xref ref-type="bibr" rid="B21">21</xref>). In glucose metabolism, ERR&#x3b3; regulates the expression of the rate-limiting enzymes in the gluconeogenesis pathway including glucose-6-phosphatase (G6PC) and phosphoenolpyruvate carboxykinase (PEPCK) (<xref ref-type="bibr" rid="B22">22</xref>, <xref ref-type="bibr" rid="B23">23</xref>). It also regulates pyruvate dehydrogenase kinase 4 (PDK4) that inhibits the pyruvate dehydrogenase complex (<xref ref-type="bibr" rid="B22">22</xref>, <xref ref-type="bibr" rid="B23">23</xref>). One study suggests that ERR&#x3b3; can be modified by glucagon through post-translational modification (<xref ref-type="bibr" rid="B24">24</xref>). However, the mechanism requires further investigation. In lipid metabolism, ERR&#x3b3; regulates lipogenesis through sterol regulatory element-binding protein-1c in the liver (<xref ref-type="bibr" rid="B25">25</xref>). ERR&#x3b3; also increases uncoupling protein 1 during brown adipogenesis and fatty acid oxidation in brown adipocytes (<xref ref-type="bibr" rid="B26">26</xref>). Moreover, ERR&#x3b3; regulates the mitochondrial genetic network that coordinates the postnatal metabolic transition in the heart, which suggests that ERR&#x3b3; plays a vital role in regulating the metabolic switch (<xref ref-type="bibr" rid="B27">27</xref>). Recent studies also reveal that ERR&#x3b3; is involved in many metabolic diseases. For example, ERR&#x3b3; was identified as a new obesity-susceptibility gene in an epigenomic study (<xref ref-type="bibr" rid="B28">28</xref>). The expression of ERR&#x3b3; is elevated in patients with type 2 diabetes (<xref ref-type="bibr" rid="B29">29</xref>). Inhibition of ERR&#x3b3; ameliorates diabetes and alcoholic fatty liver and rescues impaired insulin signaling, suggesting a role for ERR&#x3b3; in metabolism under both physiological and pathological conditions (<xref ref-type="bibr" rid="B25">25</xref>, <xref ref-type="bibr" rid="B30">30</xref>, <xref ref-type="bibr" rid="B31">31</xref>).</p>
<p>Similar to other nuclear receptors, ERR&#x3b3; is divided into several domains. ERR&#x3b3; has an N-terminus transactivation function-1 (AF-1) domain that is involved in transcriptional activities, a DNA binding domain (DBD) that binds to estrogen-related response elements (ERRE), a hinge region that helps it fold into a three-dimensional structure, and a ligand-binding domain (LBD) that has the transactivation function-2 (AF-2) domain that interacts with coregulators (<xref ref-type="bibr" rid="B22">22</xref>). ERR&#x3b3; has multiple splice variants, and these splice variants are tissue specific. For example, ERR&#x3b3; splice variant 1 (ERR&#x3b3;1) is regarded as the canonical isoform and accounts for 98.9% of ERR&#x3b3; in placenta while ERR&#x3b3; splice variant 2 (ERR&#x3b3;2), which is missing the first 23 amino acids, is richer in tissue such as pancreas, prostate, and kidney (<xref ref-type="bibr" rid="B32">32</xref>). Although ERR&#x3b3; regulates transcriptional activity as a monomer or homodimer, homodimerization enhances its transcriptional activity (<xref ref-type="bibr" rid="B33">33</xref>). Some studies suggest that ERR&#x3b3; also forms a heterodimer with ERR&#x3b1; (<xref ref-type="bibr" rid="B33">33</xref>&#x2013;<xref ref-type="bibr" rid="B35">35</xref>). Identifying natural and environmental ligands of ERR&#x3b3; will help further our understanding of the role of ERR&#x3b3; in metabolism and metabolic functions.</p>
<p>Our previous studies identified a new class of environmental estrogens, referred to as &#x201c;metalloestrogens,&#x201d; that activate ER&#x3b1; through a high-affinity interaction with its LBD (<xref ref-type="bibr" rid="B11">11</xref>, <xref ref-type="bibr" rid="B36">36</xref>&#x2013;<xref ref-type="bibr" rid="B40">40</xref>). Metalloestrogens include bivalent cations such as calcium, cadmium, and cobalt and anions such as arsenite, nitrite, and selenite (<xref ref-type="bibr" rid="B36">36</xref>). These studies show that calcium mediates the cross-talk between epidermal growth factor and ER&#x3b1; to induce ER&#x3b1; downstream regulated genes such as pS2 and progesterone receptor (<xref ref-type="bibr" rid="B37">37</xref>). The studies also show that an environmentally relevant dose of cadmium, which has similar properties to calcium, acts as an estrogen-like compound and activates ER&#x3b1; (<xref ref-type="bibr" rid="B11">11</xref>, <xref ref-type="bibr" rid="B38">38</xref>, <xref ref-type="bibr" rid="B39">39</xref>). The high degree of structural and amino acid homology between the LBDs of ERRs and ER&#x3b1; suggests that metals such as calcium and cadmium may function as ligands of ERRs and exposure to metals may influence metabolism.</p>
<p>This study asks whether calcium is a ligand of ERR&#x3b3; that mediates the effect of glucagon on gluconeogenesis and whether environmental exposure to metals that mimic calcium, such as cadmium, disrupts glucose metabolism through ERR&#x3b3;. The results show that calcium and cadmium increase the expression of genes involved in gluconeogenesis through an interaction with the LBD of ERR&#x3b3;. In addition, potential interaction sites of calcium and cadmium with the LBD of ERR&#x3b3; were identified, suggesting a potential role of calcium and cadmium as ligands of ERR&#x3b3;.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<title>Materials and methods</title>
<sec id="s2_1">
<title>Reagents</title>
<p>Calcium chloride, cadmium chloride, and glucagon were purchased from Sigma-Aldrich. 4-Hydroxyn tamoxifen, ICI-182,780, 2-APB, DY131, and GSK4716 were purchased from Tocris.</p>
</sec>
<sec id="s2_2">
<title>Cell culture</title>
<p>HEK293T cells (RRID: CVCL_0063) were a gift from Dr. Anna Riegel, Georgetown University. HepG2 cells (RRID: CVCL_0027) and MCF-7 cells (RRID: CVCL_0031) were acquired from Tissue Culture and Biobanking Shared Resource (Georgetown University). For cell passaging, HEK293T cells were maintained in improved minimal essential medium (IMEM; Corning) containing 10% fetal bovine serum (FBS; Sigma-Aldrich). HepG2 and MCF-7 cells were maintained in Dulbecco&#x2019;s Modified Eagle&#x2019;s Medium (DMEM; Corning) containing 10% FBS. For the assays, 5 &#xd7; 10<sup>5</sup>) cells were plated in a six-well plate with 3 mL of lipoic acid-free IMEM (Crystalgen or VitaScientific) containing 5% charcoal-stripped calf serum (CCS; Sigma-Aldrich) for 48 h. The serum was diluted to 1% CCS. To increase the concentration of intracellular calcium, cells were treated with 1&#x2013;10 mM calcium to activate calcium-sensing receptors. To obtain an intracellular concentration of cadmium similar to calcium, cells were treated with 5&#x2013;10 &#xb5;M cadmium. Cells were also treated with 100 nM glucagon, 1 &#xb5;M DY131, or 1 &#xb5;M GSK4716. All treatments were done in the absence or presence of 5 &#xb5;M 4-hydroxy tamoxifen, 50 &#xb5;M 2-APB, or 1 &#xb5;M ICI-182,780 for 3 to 48 h.</p>
</sec>
<sec id="s2_3">
<title>Real-time quantitative polymerase chain reaction</title>
<p>Following treatment, RNA was isolated using Trizol (Life Technologies). The reverse transcription reaction was performed using Maxima&#x2122; H Minus cDNA Synthesis Master Mix with dsDNase (ThermoFisher Scientific). qPCR assays were performed using Taqman probes (ThermoFisher Scientific), SsoAdvanced Universal Probes supermix (Bio-Rad), or PowerUp&#x2122; SYBR&#x2122; Green Master Mix (ThermoFisher Scientific). qPCR results were presented as fold change compared to control by using the 2<sup>&#x2212;&#x394;&#x394;Ct</sup> method and normalizing to the ribosomal protein P0 (RPLP0) mRNA (Taqman assays) or &#x3b2;-galactosidase mRNA (SyBr Green assay) (<xref ref-type="table" rid="T1">
<bold>Table 1</bold>
</xref>).</p>
</sec>
<sec id="s2_4">
<title>Intracellular calcium measurement</title>
<p>HepG2 or HEK293T cells were plated in T75 flasks in IMEM with 5% CCS for 2 days and then cells were treated with 100 nM glucagon or 1&#x2013;10 mM calcium in the absence or presence of 50 &#xb5;M 2-APB for 3 to 24 h in IMEM with 1% CCS. After treatment, cells were trypsinized and washed with Hanks&#x2019; balanced salt solution (HBSS; Gibco) twice. Fluo-4 AM (15 &#xb5;L; Invitrogen) was dissolved in 3 mL of HBSS and mixed with cells at 37&#xb0;C for 30 min. Then, cells were washed with HBSS twice. Cells (5 &#xd7; 10<sup>5</sup>) were used for fluorescence measurement by using the fluorimeter (Photon Technology International). The excitation wavelength was 494 nm and the emission wavelength was 516 nm. The first reading was labeled as F. Cells were then treated with 20 &#xb5;L of Triton X-100 (Boston Bioscience) and the reading was labeled as <italic>F</italic>
<sub>max</sub>. Cells were then treated with 40 &#xb5;L of EGTA (Promega) and the reading was labeled as <italic>F</italic>
<sub>min</sub>. The calcium concentration was calculated as follows: <inline-formula>
<mml:math display="inline" id="im1">
<mml:mrow>
<mml:mi>C</mml:mi>
<mml:mi>a</mml:mi>
<mml:mo>=</mml:mo>
<mml:msub>
<mml:mi>K</mml:mi>
<mml:mi>d</mml:mi>
</mml:msub>
<mml:mo>&#xa0;</mml:mo>
<mml:mo>&#xd7;</mml:mo>
<mml:mo>&#xa0;</mml:mo>
<mml:mrow>
<mml:mo stretchy="false">(</mml:mo>
<mml:mrow>
<mml:mi>F</mml:mi>
<mml:mo>&#x2212;</mml:mo>
<mml:msub>
<mml:mi>F</mml:mi>
<mml:mrow>
<mml:mtext>min</mml:mtext>
</mml:mrow>
</mml:msub>
</mml:mrow>
<mml:mo stretchy="false">)</mml:mo>
</mml:mrow>
<mml:mo>&#xf7;</mml:mo>
<mml:mrow>
<mml:mo stretchy="false">(</mml:mo>
<mml:mrow>
<mml:msub>
<mml:mi>F</mml:mi>
<mml:mrow>
<mml:mtext>max</mml:mtext>
</mml:mrow>
</mml:msub>
<mml:mo>&#x2212;</mml:mo>
<mml:mi>F</mml:mi>
</mml:mrow>
<mml:mo stretchy="false">)</mml:mo>
</mml:mrow>
</mml:mrow>
</mml:math>
</inline-formula>, where <italic>K</italic>
<sub>d</sub> is the affinity of the dye for calcium and its value is 335.</p>
</sec>
<sec id="s2_5">
<title>Western blot</title>
<p>HepG2 cells were cultured in 100-mm dishes in IMEM with 5% CCS for 2 days and then treated with 100 nM glucagon, 10 mM calcium, or 5 &#xb5;M cadmium for 3 h in IMEM with 1% CCS. Cells were then washed with phosphate-buffered saline (PBS) and lysed by radioimmunoprecipitation assay (RIPA) buffer. After removing cell debris by centrifuge, the protein concentration was determined by the Bio-Rad Protein Assay Dye Reagent (Bio-Rad Laboratories). Cell lysates were denatured by boiling and ran on 10% SDS-PAGE gel under reducing conditions, transferred to a 0.45-&#xb5;m nitrocellulose membrane, blocked by 5% non-fat dry milk in PBS-Tween, and incubated with anti-PEPCK1 antibody (A2036, ABclonal, RRID: AB_2764060, 1:500), anti-G6PC antibody (ab93857, Abcam, RRID: AB_10903775, 1:200), anti-solute carrier family 2 member 2 (SLC2A2) antibody (ab192599, Abcam, 1:1,000), or anti-actin antibody (MAB1501, Millipore Sigma, RRID: AB_2223041, 1:2,000) at 4&#xb0;C overnight and followed by anti-rabbit IgG (SA00001-2, Proteintech, RRID: AB_2722564, 1:5,000) or anti-mouse IgG (5220-0341, SeraCare, RRID: AB_2891080, 1:10,000) for 1 h at room temperature. The target protein signals were visualized using the Western Lightening<sup>&#xae;</sup> Chemiluminescence Reagent Plus (Perkin-Elmer). The protein amount was measured by ImageJ and presented as fold change (&#xb1; SEM) compared to control and normalized to the level of actin.</p>
</sec>
<sec id="s2_6">
<title>Chromatin immunoprecipitation assay</title>
<p>HEK293T cells (3 &#xd7; 10<sup>6</sup>) cells were plated in 150-mm culture dishes in IMEM with 5% CCS for 3 days. The HEK293T cells were then transfected with 25 &#xb5;g of pSG5-HA-ERR&#x3b3; or pCMX-hERR&#x3b3; for 24 h. Cells were treated with 10 mM calcium or 10 &#xb5;M cadmium in IMEM with 1% CCS for 1 h. HepG2 cells were grown in the same condition for 2 days, then treated with 100 nM glucagon, 10 mM calcium, or 10 &#xb5;M cadmium in IMEM with 1% CCS for 1 h. Cells were fixed with 1% formaldehyde (ThermoFisher Scientific) for 5 min at room temperature, quenched by 125 mM glycine (Sigma-Aldrich) for 5 min, and washed with ice-cold PBS twice. Cells were collected by scraping and centrifugation, and then treated with nuclei isolation buffer (50 mM Tris-Cl, 60 mM KCl, 0.5% NP40, and 10 mM DTT) for 15 min on ice followed by centrifugation at 430 rcf for 10 min to pellet the nuclei. Isolated nuclei were then lysed with nuclei lysis buffer (EMD Millipore) on ice for 10 min, followed by flash-freezing in liquid nitrogen and thawing at room temperature to facilitate lysis. Chromatin was then sheared with the Bioruptor<sup>&#xae;</sup> Plus sonicator (Diagenode) until the size was reduced to 300&#x2013;500 bp. The soluble chromatin was then subjected to immunoprecipitation using anti-HA tag antibody (ab1424, Abcam, RRID: AB_301017) for PSG5-HA-ERR&#x3b3;, and anti-ERR&#x3b3; antibodies (pp-h6812, R&amp;D, RRID: AB_604965) for pCMX-hERR&#x3b3; or IgG (ab18413, Abcam, RRID: AB_2631983). Antibody/chromatin complexes were captured by Protein A/G magnetic beads (Thermofisher) on a magnetic rack, washed sequentially with low-salt buffer (EMD Millipore), high-salt buffer (EMD Millipore), LiCl buffer (EMD Millipore), and Tris-EDTA (Sigma-Aldrich), and eluted in chromatin immunoprecipitation assay (ChIP) elution buffer (1% SDS, 100 mM NaHCO<sub>3</sub>). Cross-link was reversed in 0.54 M NaCl overnight at 65&#xb0;C. The samples were then treated with RNase (Fisher Scientific) and purified by the PCR purification kit (QIAGEN). DNA regions of interest were amplified by RT-PCR. To determine the potential ERRE sites of target genes, the UCSC Genome Browser was used. TNAAGGTCA as ERREs sequence template was used to find the potential ERRE of PEPCK1, G6PC, PDK4, and SLC2A2. The PDK4 ChIP primer sequence was previously published, and its ERRE location sequence was also verified in the UCSC Genome Browser (<xref ref-type="bibr" rid="B41">41</xref>).</p>
</sec>
<sec id="s2_7">
<title>Immunofluorescence</title>
<p>HepG2 cells or MCF-7 cells were cultured on 18-mm circular cover slides in a 12-well plate in IMEM with 5% CCS for 2 days. For HepG2 cells, the serum was diluted to 1% on day 3 and cells were treated with 100 nM glucagon or 10 mM calcium for 3 h. For MCF-7, cells were grown in IMEM with 1% CCS for 24 h. Cells were then washed with PBS, fixed in 10% buffered formalin (Fisher Scientific) for 20 min and permeabilized using 0.5% Triton X-100 in PBS buffer for 5 min. Cells were then incubated in PBS containing 3% bovine serum albumin at room temperature for 40 min. Cells were treated with 1 &#xb5;g/mL anti-ERR&#x3b3; antibodies at 4&#xb0;C overnight and then with anti-mouse polyclonal antibody (Alexa Fluor 594, Invitrogen, RRID: AB_2313921, 1:500) at room temperature for 60 min. F-actin was stained with Phalloidin-iFluor 488 Conjugate (AAT Bioquest, 1:500) for 60 min at room temperature. The nuclei were stained by 1 &#x3bc;g/mL 4,6-diamidino-2-phenylindole (DAPI, Boehringer Mannheim) for 5 min. The images were captured by Leica SP8.</p>
</sec>
<sec id="s2_8">
<title>Glucose measurement</title>
<p>HepG2 cells were cultured in IMEM with 5% CCS for 2 days and then treated with 7.5 mM calcium, 10 mM calcium, 5 &#xb5;M cadmium, or 10 &#xb5;M cadmium in IMEM with 1% CCS for 24 h. Glucose concentration in the medium was measured by Glucose Assay Kit-WST (G264-05, dojindo).</p>
</sec>
<sec id="s2_9">
<title>Chloramphenicol acetyltransferase reporter assay, mutagenesis assay, and transfection assay</title>
<p>PSG5-HA-ERR&#x3b3; (ERR&#x3b3; splice variant 1) was a gift from Dr. Rebecca Riggins, Georgetown University (<xref ref-type="bibr" rid="B42">42</xref>). pCMX-hERR&#x3b3; (ERR&#x3b3; splice variant 3) was a gift from Dr. Hongwu Chen, University of California, Davis (<xref ref-type="bibr" rid="B43">43</xref>). pCMV-GAL4 plasmid containing GAL4, pEQ176 plasmid containing &#x3b2;-galactosidase, and pG6 (5&#x2019;Pro) plasmid containing chloramphenicol acetyltransferase (GAL-4-CAT) were purchased from Addgene. The amino acid sequences of the LBDs of ERR&#x3b3;-1, -2, and -3 are identical. Because the sequences of the LBDs are the same, the LBD was subcloned from the ERR&#x3b3;-1 construct. To create the GAL-4-ERR&#x3b3;-LBD construct, the hinge region and LBD (L187-V458) of ERR&#x3b3; from pSG5-HA-ERR&#x3b3; was fused with the GAL-4 DNA binding domain from pCMV-GAL4 to form GAL-4-ERR&#x3b3;-LBD. Restriction enzyme cut sites SacI were created in the 5&#x2032; terminus and XbaI was created in the 3&#x2032; terminus. Then, corresponding enzymes were used to fuse GAL-4-ERR&#x3b3;-LBD with the empty pCMV vector. To create GAL-4-ERR&#x3b3;-LBD mutants, mutation primers were designed using the QuikChange Primer Design of Agilent and synthesized by Integrated DNA Technologies. The GAL-4-ERR&#x3b3;-LBD plasmid was mutated using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent), and results were verified by sequencing. For the transfection assay, cells were transfected with 2.5 &#x3bc;g of pSG5-HA-ERR&#x3b3; or pCMX-hERR&#x3b3; using Trans-IT LT-1 (MirusBio) or SuperFect (QIAGEN) for 24 h. For the CAT reporter assay, cells were transfected with 2 &#x3bc;g of wild-type GAL-4-ERR&#x3b3;-LBD or GAL-4-ERR&#x3b3;-LBD mutant, 2 &#x3bc;g of pG6 (5&#x2019;Pro), and 1 &#x3bc;g of pEQ176 using Trans-IT LT-1 for 24 h.</p>
</sec>
<sec id="s2_10">
<title>Gene set enrichment analysis</title>
<p>Raw microarray data (accession no. GSE136595) were downloaded from Gene Expression Omnibus. Analysis of microarray data was performed by gene set enrichment analysis (GSEA) v4.1.0 for Windows. The hallmark gene sets and ontology gene sets from the Molecular Signatures Database were used in our analysis.</p>
</sec>
<sec id="s2_11">
<title>Molecular dynamics simulations</title>
<p>The structure of ERR&#x3b3; was obtained from Protein Data Bank (ID: 2GP7). The A chain of 2GP7 was then submitted to the Metal Ion-Binding Site Prediction and Docking Server (MIB; <ext-link ext-link-type="uri" xlink:href="http://bioinfo.cmu.edu.tw/MIB/">http://bioinfo.cmu.edu.tw/MIB/</ext-link>) or Autodock Vina to predict the corresponding calcium docking site (<xref ref-type="bibr" rid="B44">44</xref>, <xref ref-type="bibr" rid="B45">45</xref>). All molecular dynamics simulations were performed by using QwikMD in VMD and the CHARMM36 force field. During the molecular dynamics simulations, the temperature of 37&#xb0;C was set over a period of 1 ns. Resolution was set as Max, then solvent was set as Explicit, and other parameters were set based on the instruction of QwikMD. All analyses were performed by using the VMD plug-in (<xref ref-type="bibr" rid="B46">46</xref>). Graphs were created by PyMOL.</p>
</sec>
<sec id="s2_12">
<title>Statistical analysis</title>
<p>All statistical analyses were performed in Prism. Data are presented as the mean &#xb1; standard error of the mean (SEM). Statistical differences were evaluated by one-way analysis of variance (ANOVA) followed by Fisher&#x2019;s LSD test or <italic>t</italic>-test. Statistical significance is defined as a <italic>p</italic>-value of &#x2264;0.05. *<italic>p &#x2264;</italic> 0.05; **<italic>p &#x2264;</italic> 0.01; ***<italic>p &#x2264;</italic> 0.001; ****<italic>p &#x2264;</italic> 0.0001.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<title>Results</title>
<sec id="s3_1">
<title>Effects of glucagon, calcium, and cadmium on the expression of ERR&#x3b3;-regulated genes in HepG2 cells</title>
<p>To determine whether calcium can mediate the cross-talk between glucagon and ERR&#x3b3;, HepG2 cells were treated with glucagon (100 nM) or calcium (7.5 or 10 mM) in the absence or presence of the ERR&#x3b3; inhibitor 4-hydroxy tamoxifen (5 &#x3bc;M). Treatment with glucagon for 3 h resulted in an approximately 2.1-, 2.4-, and 1.7-fold increase in the expression of PEPCK1, G6PC, and SLC2A2, respectively, which was significant and blocked by the ERR&#x3b3; antagonist 4-hydroxy tamoxifen (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1A&#x2013;C</bold>
</xref>). There was no significant effect on the expression of PDK4, which is not part of the gluconeogenesis pathway (data not shown). Similar to treatment with glucagon, treatment with calcium for 3 h significantly increased expression of PEPCK1, G6PC, and SLC2A2 by 2.6-, 2.3-, and 1.9-fold, respectively, which was blocked by 4-hydroxy tamoxifen. Treatment with calcium for 24 h resulted in a significant increase in the expression of PEPCK1, G6PC, and PDK4 by approximately 1.8-, 4.1-, and 5.6-fold, respectively (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1E&#x2013;H</bold>
</xref>). 4-Hydroxy tamoxifen blocked the effects of calcium on PEPCK1 and PDK4 but failed to block the effects of calcium on G6PC and increased its expression. There is some evidence suggesting that 4-hydroxy tamoxifen can influence metabolism, which may be due to its effect on the expression of G6PC (<xref ref-type="bibr" rid="B47">47</xref>, <xref ref-type="bibr" rid="B48">48</xref>).</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Effects of glucagon, calcium, and cadmium on ERR&#x3b3;-regulated genes in HepG2 cells. HepG2 cells were treated with glucagon (GCG; 100 nM) for 3 h, calcium (Ca; 7.5 or 10 mM), or cadmium (Cd; 5 &#x3bc;M) for 3 and 24 h in the absence or presence of 4-hydroxy tamoxifen (Tam; 5 &#x3bc;M) or 2-APB (50 &#x3bc;M). The expression of PEPCK1, G6PC, SLC2A2, and PDK4 and the concentration of intracellular calcium were measured. For mRNA measurement, RNA was isolated and the amount of PEPCK1, G6PC, SLC2A2, and PDK4 mRNA was measured using a quantitative real-time-qPCR assay, normalized to the expression of ribosomal large protein P0 (RPLP0) mRNA, and presented as fold change. To quantify the concentration of intracellular calcium, the cells were trypsinized and incubated for 30 min with 5 &#x3bc;M Fluo-4 AM. The emission at 516 nm was determined using an excitation wavelength of 494 nm, and the concentration of intracellular calcium was calculated using the equation: [Ca<sub>in</sub> <sup>2+</sup>] = <italic>K</italic>
<sub>d</sub> &#xd7; (<italic>F</italic> &#x2013; <italic>F</italic>
<sub>min</sub>)/(<italic>F</italic>
<sub>max</sub> &#x2013; <italic>F</italic>), where <italic>K</italic>
<sub>d</sub> is the affinity of the dye for calcium. For protein measurement, PEPCK1, G6PC, and SLC2A2 were measured using Western blot, normalized to actin, and presented as fold change. Glucose in the medium was measured using a glucose assay kit. <bold>(A&#x2013;C)</bold> Effects of glucagon on the induction of PEPCK1, G6PC, and SLC2A2 mRNA. <bold>(D)</bold> Effects of glucagon and extracellular calcium on the concentration of intracellular calcium. <bold>(E&#x2013;H)</bold> Effects of calcium on the induction of PEPCK1, G6PC, SLC2A2, and PDK4 mRNA. <bold>(I&#x2013;L)</bold> Effects of cadmium on the induction of PEPCK1, G6PC, SLC2A2, and PDK4 mRNA. <bold>(M&#x2013;P)</bold> Effects of glucagon, calcium, and cadmium on the expression of PEPCK1, G6PC, and SLC2A2; representative images and quantitative analysis of Western blots. <bold>(Q)</bold> Effects of calcium and cadmium on glucose. Data are expressed as fold change (mean &#xb1; SEM); <italic>n</italic> &#x2265; 3. Statistical significance is defined as a <italic>p</italic>-value of &#x2264;0.05. *<italic>p &#x2264;</italic> 0.05; **<italic>p &#x2264;</italic> 0.01; ***<italic>p &#x2264;</italic> 0.001; ****<italic>p &#x2264;</italic> 0.0001.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-15-1400022-g001.tif"/>
</fig>
<p>Glucagon increases intracellular calcium through the inositol 1,4,5 trisphosphate receptor (IP3R)-mediated release of calcium from the endoplasmic reticulum, whereas high levels of extracellular calcium can increase intracellular calcium through the activation of calcium receptors and channels (<xref ref-type="bibr" rid="B49">49</xref>, <xref ref-type="bibr" rid="B50">50</xref>). To determine whether intracellular calcium mediates the effects of glucagon and extracellular calcium on the activity of ERR&#x3b3;, the concentration of intracellular calcium was measured following treatment with glucagon (100 nM) in the absence or presence of the IP3R inhibitor 2-APB (50 &#x3bc;M). The concentration of intracellular calcium was also measured following treatment with extracellular calcium (7.5 or 10 mM) (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1D</bold>
</xref>). As expected, treatment of HepG2 cells with glucagon for 3 h increased the concentration of intracellular calcium from approximately 300 (&#xb1; 18) nM to 456 (&#xb1; 51) nM that was blocked by 2-APB (196 &#xb1; 24 nM). Treatment with increasing concentrations of calcium for 3 h also increased the concentration of intracellular calcium to approximately 481 (&#xb1; 50) to 602 (&#xb1; 99) nM and treatment with increasing concentrations of calcium for 24 h further increased intracellular calcium concentration from 315 (&#xb1; 53) nM to approximately 642 (&#xb1; 85) to 797 (&#xb1; 78) nM.</p>
<p>To determine whether cadmium mimics the effects of calcium on the activation of ERR&#x3b3; and disrupts the glucagon signaling pathway, HepG2 cells were treated with cadmium (5 &#x3bc;M) for 24 h. Treatment with cadmium resulted in a significant increase of approximately 3.0-, 3.5-, 1.9-, and 8.1-fold in the expression of PEPCK1, G6PC, SLC2A2, and PDK4, respectively (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1I&#x2013;L</bold>
</xref>). Similar to glucagon and calcium, 4-hydroxy tamoxifen blocked the effects of cadmium on PEPCK1, SLC2A2, and PDK4 but not the effect on G6PC.</p>
<p>To determine whether treatment with glucagon, calcium, or cadmium increased protein expression, the amount of PEPCK1, G6PC, and SLC2A2 was measured by Western blot analysis. Similar to the increase in mRNA, treatment with glucagon resulted in a significant 2.5- and 2.1-fold increase in PEPCK1 and SLC2A2, respectively. Treatment with calcium resulted in a 2.8-, 2.3-, and 3.0-fold increase in PEPCK1, G6PC, and SLC2A2, respectively, and treatment with cadmium resulted in a 3.5- and 3.6-fold increase in G6PC and SLC2A2, respectively, which were significant (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1M&#x2013;P</bold>
</xref>).</p>
<p>To determine whether treatment with calcium and cadmium increased the concentration of glucose, the amount of glucose in the medium was measured. Treatment of HepG2 with calcium or cadmium for 24 h also significantly increased the concentration of glucose in the medium from 18 (&#xb1; 1) mM to approximately 22 (&#xb1; 2) to 25 (&#xb1; 3) mM (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1Q</bold>
</xref>). Taken together, the results suggest that glucagon increases the expression of genes involved in gluconeogenesis through an increase in intracellular calcium and the subsequent activation of ERR&#x3b3; and metals that mimic calcium increase the activity of ERR&#x3b3;.</p>
</sec>
<sec id="s3_2">
<title>Effects of glucagon, calcium, and cadmium on the recruitment of ERR&#x3b3; to the enhancers of ERR&#x3b3; target genes</title>
<p>To further show that the change in gene expression is due to the activation of ERR&#x3b3; by glucagon (100 nM), calcium (7.5 or 10 mM), and cadmium (5 or 10 &#x3bc;M), the recruitment of ERR&#x3b3; to the enhancer regions of PEPCK1, G6PC, SLC2A2, and PDK4 was measured by a ChIP-qPCR assay. ERR&#x3b3; is recruited to the ERR response element (TNAAGGTCA) in the enhancer regions of target genes and regulates gene expression. Through database searches, potential ERREs were identified in the enhancer region of the target genes (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2A&#x2013;D</bold>
</xref>). Treatment with glucagon resulted in a significant enrichment of approximately 4.8-, 7.3-, and 6.0-fold of ERR&#x3b3; on the enhancer regions of PEPCK1, G6PC, and SLC2A2, respectively. Treatment with calcium resulted in an approximately 3.7-, 3.7-, 4.7-, and 3.2-fold enrichment to the enhancer regions of PEPCK1, G6PC, SLC2A2, and PDK4, respectively, and treatment with cadmium resulted in an approximately 3.7-, 6.5-, and 2.6-fold enrichment to the enhancer regions of G6PC, SLC2A2, and PDK4, respectively, which were significant.</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Effects of glucagon, calcium, and cadmium on the recruitment of ERR&#x3b3; to the enhancers of ERR&#x3b3;-regulated genes in HepG2 cells. HepG2 cells were treated with glucagon (GCG; 100 nM), calcium (Ca; 7.5 or 10 mM), or cadmium (Cd; 5 or 10 &#x3bc;M) for 1&#x2013;24 h in the absence or presence of 4-hydroxy tamoxifen (Tam; 5 &#x3bc;M) or 2-APB (50 &#x3bc;M). To quantify the occupancy of ERR&#x3b3; on the ERREs of target genes, HepG2 cells were treated for 1 h. The recruitment of ERR&#x3b3; to the enhancers of target genes was measured using a quantitative ChIP-qPCR assay, and presented both as fold change over control of the % input values (main graphs) and as % input (insert graphs). To visualize the location of ERR&#x3b3;, HepG2 cells were treated for 3 h and ERR&#x3b3; localization was captured by immunofluorescence. To study the interaction between glucagon, calcium, or cadmium and ERR&#x3b3;, HepG2 cells were transfected with the chimeric receptor GAL-4-ERR&#x3b3;-LBD and a CAT reporter construct, treated for 3 to 24 h, and RNA was isolated. The amount of CAT mRNA was measured using a quantitative real-time qPCR assay, normalized to the expression of &#x3b2;-galactosidase mRNA, and presented as fold change. <bold>(A&#x2013;D)</bold> Effects of glucagon, calcium, and cadmium on recruitment of ERR&#x3b3; to the enhancer of PEPCK1, G6PC, SLC2A2, and PDK4. Figures illustrate the location of ERRE in enhancer regions. <bold>(E)</bold> Effects of glucagon and calcium on intracellular ERR&#x3b3; localization. <bold>(F&#x2013;H)</bold> Effects of glucagon, calcium, and cadmium induction of GAL4-coupled ERR&#x3b3; LBD on expression of CAT reporter. Data are expressed as fold change (mean &#xb1; SEM); <italic>n</italic> &#x2265; 3. Statistical significance is defined as a <italic>p</italic>-value of &#x2264;0.05. *<italic>p &#x2264;</italic> 0.05; **<italic>p &#x2264;</italic> 0.01; ***<italic>p &#x2264;</italic> 0.001; ****<italic>p &#x2264;</italic> 0.0001.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-15-1400022-g002.tif"/>
</fig>
<p>To determine the effects on the localization of ERR&#x3b3;, HepG2 cells were treated with glucagon or calcium and the effects on ERR&#x3b3; were measured by immunofluorescence. In control cells, ERR&#x3b3; was localized to the periphery of the cell nucleus. Following treatment with glucagon or calcium, ERR&#x3b3; re-localized in the nucleus (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2E</bold>
</xref>). Taken together, the results suggest that glucagon, calcium, and cadmium activate and recruit ERR&#x3b3; to the ERRE in the enhancer regions of genes involved in gluconeogenesis.</p>
</sec>
<sec id="s3_3">
<title>Identify the calcium and cadmium interaction domain on ERR&#x3b3;</title>
<p>Mutational analysis and molecular modeling show that calcium interacts with the LBD of ER&#x3b1; to activate the receptor (<xref ref-type="bibr" rid="B37">37</xref>). The high homology between the LBDs of ER&#x3b1; and ERR&#x3b3; suggests that the LBD of ERR&#x3b3; contains potential calcium and cadmium interaction sites. ERR&#x3b3;-1 is the canonical isoform of the receptor and shares the same LBD with other ERR&#x3b3; splice variants. The LBDs of the splice variants ERR&#x3b3;-1, -2, and -3 are identical. Calmodulin binds to ERR&#x3b3; through two binding motifs (<xref ref-type="bibr" rid="B51">51</xref>). One calmodulin binding motif is located at the boundary between the N-terminus and DNA binding domain, and the other binding motif is located at the boundary of the hinge region and the N-terminus of the LBD. Both motifs are needed for calmodulin binding to ERR&#x3b3;. To address the mechanism by which calcium and cadmium activate ERR&#x3b3;, HepG2 cells were transfected with a chimeric receptor that contains the DNA binding domain of GAL4 and the LBD of ERR&#x3b3; (GAL-4-ERR&#x3b3;-LBD) and a CAT reporter construct. Following transfection, the cells were treated with glucagon (100 nM), calcium (7.5 or 10 mM), or cadmium (5 &#x3bc;M) in the absence or presence of the IP3 receptor inhibitor 2-APB (50 &#x3bc;M) or 4-hydroxy tamoxifen (5 &#x3bc;M) (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2F&#x2013;H</bold>
</xref>). Treatment with glucagon for 3 h resulted in a significant increase of approximately 9.7-fold in the expression of CAT that was blocked by 2-APB and 4-hydroxy tamoxifen. Treatment with calcium for 3 and 24 h resulted in a significant increase of approximately 1.9- to 5.7-fold in the expression of CAT that was also blocked by 4-hydroxy tamoxifen. Similar to calcium, treatment with cadmium for 24 h resulted in a significant 4.5-fold increase of CAT that was blocked by 4-hydroxy tamoxifen. Taken together, the results suggest that calcium mediates the effects of glucagon through the LBD of ERR&#x3b3; and that cadmium also mimics the effects of calcium through the LBD of ERR&#x3b3;.</p>
</sec>
<sec id="s3_4">
<title>Effects of calcium and cadmium on ERR&#x3b3;-regulated metabolic genes in transfected HEK293T cells</title>
<p>To further demonstrate that calcium and cadmium activate ERR&#x3b3;, HEK293T cells, which do not express detectable amounts of ERR&#x3b3; or calcium sensing receptor and channels, were transfected with splice variants of ERR&#x3b3;.  The transfected cells were treated for 12, 24, or 48 hours with calcium (7.5 mM or 10 mM) or cadmium (5 &#x3bc;M or 10 &#x3bc;M) in the absence or presence of 4-hydroxy tamoxifen (5 &#x3bc;M).  Transfection was verified by qPCR (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;1</bold>
</xref>).  Similar to HepG2 cells, calcium or cadmium consistently increased the expression of PEPCK1, G6PC, and PDK4 in HEK293T cells transfected with ERR&#x3b3;1 or ERR&#x3b3;3. Treatment with calcium resulted in a maximal 3.2-, 4.4-, and 2.3-fold increase in PEPCK1, G6PC, and PDK4, respectively, in cells transfected with ERR&#x3b3;1 (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3A&#x2013;C</bold>
</xref>) and a maximal 2.5-, 3.8-, and 2.2-fold increase in PEPCK1, G6PC, and PDK4, respectively, in cells transfected with ERR&#x3b3;3 (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3G&#x2013;I</bold>
</xref>).  Treatment with cadmium also resulted in a maximal 2.9-, 5.6-, and 3.2-fold increase in PEPCK1, G6PC, and PDK4, respectively, in cells transfected with ERR&#x3b3;1 (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3D&#x2013;F</bold>
</xref>) and a maximal 2.2-, 7.7-, and 2.6-fold increase in PEPCK1, G6PC, and PDK4, respectively, in cells transfected with ERR&#x3b3;3 (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3J&#x2013;L</bold>
</xref>).  Treatment with calcium or cadmium resulted in 2.0-fold increase or 4.8-fold increase in SLC2A2 in cells transfected with ERR&#x3b3;1 but had no effects on cells transfected with ERR&#x3b3;3 (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4C, F</bold>
</xref>). The effects of calcium and cadmium were blocked by 4-hydroxy tamoxifen. ERR&#x3b3;1 is the canonical isoform of the receptor. Compared to ERR&#x3b3;1, ERR&#x3b3; splice variant 3 (ERR&#x3b3;3) is missing the first 23 amino acids and Y234 is replaced with LLWSDPAD. A diagram of the ERR&#x3b3; splice variants 1 and 3 is shown in (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4L</bold>
</xref>). To determine whether intracellular calcium alters the activity of the ERR&#x3b3; splice variants, the concentration of intracellular calcium was measured following treatment with calcium (1, 3, 5, and 10 mM) (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4I</bold>
</xref>). As expected, treatment with increasing concentrations of calcium increased the intracellular calcium concentration from 191 (&#xb1;17) nM to 286 (&#xb1;10) &#x2013; 630 (&#xb1;17) nM. Taken together, the results suggest that calcium and cadmium activate different ERR&#x3b3; splice variants.</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Effects of calcium and cadmium on ERR&#x3b3;-regulated metabolic genes in HEK293T cells transfected with ERR&#x3b3;1 or ERR&#x3b3;3. HEK293T cells were transfected with ERR&#x3b3;1 or ERR&#x3b3;3, and treated with calcium (Ca; 7.5 or 10 mM) for 24 to 48 h or cadmium (Cd; 5 or 10 &#xb5;M) for 12 to 24 h in the absence or presence of 4-hydroxy tamoxifen (Tam; 5 &#xb5;M). The expression of PEPCK1, G6PC, and PDK4 was measured using a quantitative real-time qPCR assay as described in <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>. <bold>(A&#x2013;F)</bold> Effects of calcium and cadmium on the induction of PEPCK1, G6PC, and PDK4 mRNA in HEK293T cells transfected with ERR&#x3b3;1. <bold>(G&#x2013;L)</bold> Effects of calcium and cadmium on the induction of PEPCK1, G6PC, and PDK4 mRNA in HEK293T cells transfected with ERR&#x3b3;3. Data are expressed as fold change (mean &#xb1; SEM); <italic>n</italic> &#x2265; 3. Statistical significance is defined as a <italic>p</italic>-value of &#x2264;0.05. *<italic>p &#x2264;</italic> 0.05; **<italic>p &#x2264;</italic> 0.01; ***<italic>p &#x2264;</italic> 0.001; ****<italic>p &#x2264;</italic> 0.0001.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-15-1400022-g003.tif"/>
</fig>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Effects of calcium and cadmium on ERR&#x3b3;-regulated metabolic genes in HEK293T cells transfected with ERR&#x3b3;1 or ERR&#x3b3;3. Cells were treated as described in <xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3</bold>
</xref> and the expression of H6PD, HK2, and SLC2A2 was measured using a quantitative real-time qPCR assay as described in <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>. Cells were treated with calcium (1, 3, 5, and 10 mM) and intracellular calcium was measured as described in <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>. <bold>(A&#x2013;F)</bold> Effects of calcium and cadmium on the induction of H6PD, HK2, and SLC2A2 mRNA in HEK293T cells transfected with ERR&#x3b3;1. <bold>(G, H, J, K)</bold> Effects of calcium and cadmium on the induction of H6PD and HK2 mRNA in HEK293T cells transfected with ERR&#x3b3;3. <bold>(I)</bold> Effects of extracellular calcium on the concentration of intracellular calcium. <bold>(L)</bold> Illustration of ERR&#x3b3;1 and ERR&#x3b3;3 structure. Data are expressed as fold change (mean &#xb1; SEM); <italic>n</italic> &#x2265; 3. Statistical significance is defined as a <italic>p</italic>-value of &#x2264;0.05. *<italic>p &#x2264;</italic> 0.05; **<italic>p &#x2264;</italic> 0.01; ***<italic>p &#x2264;</italic> 0.001; ****<italic>p &#x2264;</italic> 0.0001.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-15-1400022-g004.tif"/>
</fig>
</sec>
<sec id="s3_5">
<title>Effects of calcium and cadmium on ERR&#x3b3;-regulated metabolic genes in transfected HEK293T cells</title>
<p>To determine whether calcium and cadmium regulate the expression of genes in other metabolic pathways, genes in the glycolysis and pentose phosphate pathways were also measured in HEK293T cells transfected with ERR&#x3b3;. Depending on the ERR&#x3b3; splice variant, treatment with either calcium or cadmium had inconsistent effects on other metabolic genes (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref> and <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;2</bold>
</xref>). For example, treatment with calcium decreased hexokinase 2 (HK2) in the glycolysis pathway by approximately 66% or 48% in cells transfected with ERR&#x3b3;1 or ERR&#x3b3;3 (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4A, G</bold>
</xref>), whereas treatment with cadmium decreased HK2 by approximately 59% in cells transfected with ERR&#x3b3;1 but had no effect in cells transfected with ERR&#x3b3;3 (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4D, J</bold>
</xref>). The effects of calcium and cadmium were partially blocked by 4-hydroxy tamoxifen. Treatment with calcium also decreased hexose-6-phosphate dehydrogenase (H6PD) by approximately 47% in cells transfected with ERR&#x3b3;1 and 53% in cells transfected with ERR&#x3b3;3 (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4B, H</bold>
</xref>). Treatment with cadmium also decreased H6PD by an approximately 53% in cells transfected with ERR&#x3b3;1 and 67% in cells transfected with ERR&#x3b3;3 (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4E, K</bold>
</xref>). However, the effects of calcium and cadmium were not blocked by 4-hydroxy tamoxifen.</p>
<p>To determine whether the effects of calcium and cadmium are specific to ERR&#x3b3;, non-transfected HEK293T cells were also treated with calcium or cadmium. Treatment with calcium did not change the expression of PEPCK1 or PDK4. Treatment of cadmium did not change the expression of PEPCK1 but increased PDK4 (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;3</bold>
</xref>). PDK4 is known to be regulated by both ERR&#x3b1; and ERR&#x3b3;, which may contribute to the increase of PDK4 (<xref ref-type="bibr" rid="B52">52</xref>). Non-transfected HEK293T cells have undetectable levels of G6PC and SLC2A2 (data not shown). Taken together, the results suggest that calcium and cadmium can activate different ERR&#x3b3; splice variants and regulate ERR&#x3b3;-responsive genes.</p>
</sec>
<sec id="s3_6">
<title>Effects of calcium and cadmium on the recruitment of ERR&#x3b3; to the enhancers of ERR&#x3b3; target genes</title>
<p>To further verify that the change of gene expression was due to the activation of ERR&#x3b3; by calcium or cadmium, the recruitment of ERR&#x3b3; to the enhancer regions of PEPCK1, G6PC, PDK4, and SLC2A2 was measured by a ChIP-qPCR assay in HEK293T cells transfected with ERR&#x3b3;1 or ERR&#x3b3;3 (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5A&#x2013;D</bold>
</xref>). For HEK293T cells transfected with ERR&#x3b3;1, treatment with calcium (10 mM) resulted in an approximately 3.4-, 4.3-, 5.3-, and 3.3-fold enrichment and treatment with cadmium (10 &#xb5;M) resulted in a 2.8-, 2.3-, 2.5-, and 2.5-fold enrichment to the enhancer regions of PEPCK1, G6PC, PDK4, and SLC2A2, respectively. For HEK293T cells transfected with ERR&#x3b3;3, treatment with calcium resulted in an approximately 4.3-, 3.5-, and 4.4-fold enrichment and treatment with cadmium resulted in a 7.9-, 7.0-, and 8.3-fold enrichment to the enhancer regions of PEPCK1, G6PC, and PDK4, respectively, and the increase was not significant. In non-transfected cells, treatment with calcium or cadmium had no effect on enrichment. The results suggest that calcium and cadmium recruit ERR&#x3b3; to ERREs in the enhancer regions of target genes and induce gene expression in HEK293T cells.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Effects of calcium and cadmium on the recruitment of ERR&#x3b3; to enhancers of ERR&#x3b3;-regulated genes in HEK293T cells. HEK293T cells were transfected with ERR&#x3b3;1, ERR&#x3b3;3, or GAL-4-ERR&#x3b3;-LBD and a CAT reporter construct, and treated with calcium (Ca; 7.5 or 10 mM), cadmium (Cd; 5 or 10 &#xb5;M), DY131 (1 &#xb5;M), or GSK4716 (1 &#xb5;M) for 1 to 48 h in the absence or presence of 4-hydroxy tamoxifen (Tam; 5 &#xb5;M). The occupancy of ERR&#x3b3; on the enhancer was measured using a quantitative ChIP-qPCR and CAT reporter was measured using a quantitative real-time qPCR assay as described in <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>. <bold>(A&#x2013;D)</bold> Effects of calcium and cadmium on recruitment of ERR&#x3b3;1 or ERR&#x3b3;3 to the enhancer of PEPCK1, G6PC, SLC2A2, and PDK4. Data are expressed as fold change (mean &#xb1; SEM); <italic>n</italic> &#x2265; 3 except nontransfection ChIP (<italic>n</italic> = 2). Statistical significance is defined as a <italic>p</italic>-value of &#x2264;0.05. *<italic>p &#x2264;</italic> 0.05; **<italic>p &#x2264;</italic> 0.01; ***<italic>p &#x2264;</italic> 0.001.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-15-1400022-g005.tif"/>
</fig>
<p>To further address the mechanism by which calcium and cadmium activate ERR&#x3b3;, HEK293T cells were co-transfected with GAL-4-ERR&#x3b3;-LBD and a CAT reporter construct and treated with ERR&#x3b3; agonists (DY131 and GSK4716), calcium, or cadmium in the absence or presence of the 4-hydroxy tamoxifen. Treatment with DY131 (1 &#xb5;M) or GSK4716 (1 &#xb5;M) resulted in an approximately 1.8- and 2.0-fold increase in CAT expression, respectively. Treatment with calcium (7.5 or 10 mM) for 48 h or cadmium (10 &#xb5;M) for 24 h resulted in a significant increase of approximately 1.9- to 2.0- and 2.4-fold in CAT expression, respectively. Treatment with 4-hydroxy tamoxifen blocked the effects of calcium and cadmium (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6A, B</bold>
</xref>), suggesting that calcium and cadmium modulate ERR&#x3b3; activity though its LBD.</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Identification of potential calcium or cadmium interaction sites on the LBD of ERR&#x3b3;. HEK293T cells were transfected with GAL-4-ERR&#x3b3;-LBD mutants and a CAT reporter construct and treated with DY131 (1 &#xb5;M), GSK4716 (1 &#xb5;M), calcium (Ca; 7.5 or 10 mM), or cadmium (Cd; 5 or 10 &#xb5;M) for 24 or 48 h in the absence or presence of 4-hydroxy tamoxifen (Tam; 5 &#xb5;M). The amount of CAT mRNA was measured using a quantitative real-time qPCR assay as described in <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>. <bold>(A, B)</bold> Effects of calcium and cadmium induction of GAL4-coupled ERR&#x3b3; LBD on expression of CAT reporter. <bold>(C&#x2013;H)</bold> Effects of calcium and cadmium on GAL-4-ERR&#x3b3;-LBD mutants. Data are expressed as fold change (mean &#xb1; SEM); <italic>n</italic> &#x2265; 3. Statistical significance is defined as a <italic>p</italic>-value of &#x2264;0.05. *<italic>p &#x2264;</italic> 0.05; **<italic>p &#x2264;</italic> 0.01; ***<italic>p &#x2264;</italic> 0.001; ****<italic>p &#x2264;</italic> 0.0001. <bold>(I)</bold> Molecular dynamics of calcium interaction with ERR&#x3b3; LBD. The RMSF of the backbone atom positions was measured for the apo- and calcium-bound ERR&#x3b3; LBD; <italic>n</italic> = 3. <bold>(J&#x2013;L)</bold> Representative image of the interaction between ERR&#x3b3; and calcium on S303, T429, and E452. Calcium and corresponding amino acid side chains are presented as ball and stick models.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-15-1400022-g006.tif"/>
</fig>
</sec>
<sec id="s3_7">
<title>Potential interaction sites of calcium and cadmium with ERR&#x3b3;</title>
<p>Our previous study identified four potential calcium interaction sites on the aqueous surface of the LBD of ER&#x3b1; (<xref ref-type="bibr" rid="B37">37</xref>). The first site is formed by H377, E380, and C381 on helix H4. The second site is formed by H516, N519, and E523 at the interface between helices H10 and H11. The third site is formed by K529, N532, and V534 on helix H11 and in the loop connecting helices H11 and H12 and the fourth site is formed by D538, E542, and D545 on helix H12. The high homology between the LBDs of ER&#x3b1; and ERR&#x3b3; suggests that the corresponding sites on ERR&#x3b3; are potential calcium and cadmium interaction sites. Sequence alignment identified four sites in the LBD of ERR&#x3b3; (<xref ref-type="bibr" rid="B53">53</xref>). The first site is formed by S299, Q302, and S303 on helix H4. The second site is formed by Q426, T429, and Q433 at the interface between helices H10 and H11. The third site is formed by K439, K443, and V444 on helix H11 and in the loop connecting helices H11 and H12 and the fourth site is formed by K448, E452, and E455 on helix H12. The amino acids S303 and T429 of ERR&#x3b3; have side chain groups similar to the corresponding amino acids C381 and N519 of ER&#x3b1;. The amino acid S303 is also conserved among the ERR family and E452 is conserved between the ERR family and ER&#x3b1; (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figures&#xa0;5A&#x2013;C</bold>
</xref>). To determine whether these sites are potential interaction sites of calcium and cadmium with the ERR&#x3b3;, S303 on helix H4, T429 on helix H10, and E452 on helix H12 were individually mutated to alanine in the GAL-4-ERR&#x3b3;-LBD, transiently transfected into HEK293T cells, and treated with calcium, cadmium, DY131, or GSK4716. Similar to wild-type GAL-4-ERR&#x3b3;-LBD, treatment of GAL-4-ERR&#x3b3;-LBD mutants S303A, T429A, or E452A with DY131 or GSK4716 resulted in a 1.6- to 1.7-fold or 1.6- to 1.9-fold increase of CAT, respectively, indicating that mutation of these amino acids did not alter the activity of the LBD. However, treatment of the mutants with calcium or cadmium did not significantly increase CAT expression, suggesting that S303, T429, and E452 are potential calcium and cadmium interaction sites on the ERR&#x3b3; LBD (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6C&#x2013;H</bold>
</xref>). The ability of DY131 and GSK4716 to activate S303A, T429A, and E452A may be due to their mechanism of activation. DY131 and GSK4716 bind in the pocket of the LBD, whereas S303, T429, and E452 are located on the aqueous surface of the LBD. For example, GSK4716 interacts with Asp328 and rearranges Arg316 and Glu275 in the pocket (<xref ref-type="bibr" rid="B54">54</xref>).</p>
<p>To further explore the interaction between calcium and the ERR&#x3b3; LBD, molecular dynamics simulations were performed. To predict calcium docking sites, the crystal structure of ERR&#x3b3; LBD (ID: 2GP7) was selected and its A chain representing ERR&#x3b3; LBD was submitted to both metal ion-binding site for prediction: modeling server (MIB) and Autodock Vina. In agreement with the mutational analysis, MIB predicted that calcium binds to E452 and Autodock Vina predicted that calcium binds to S303 and T429. Apo ERR&#x3b3; and calcium-docked ERR&#x3b3; were then analyzed by molecular dynamics simulations (videos 1&#x2013;3). Root mean square fluctuation (RMSF) analysis suggested that calcium binding stabilizes the LBD structure (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6J</bold>
</xref>). This effect is especially significant in the loop connecting helix H9 and helix H10 and in the N-terminus of helix H10 (amino acids 405&#x2013;420) as calcium-bound ERR&#x3b3; LBD has lower RMSF compared with apo ERR&#x3b3; LBD. Previously published molecular dynamics simulations show that the ERR&#x3b3; agonist BPA also lowers the RMSF in the same region of the LBD, suggesting that calcium mimics another ERR&#x3b3; agonist to stabilize and activate ERR&#x3b3; (<xref ref-type="bibr" rid="B19">19</xref>). The calcium-bound ERR&#x3b3; molecular models are shown in <xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6J&#x2013;L</bold>
</xref>.</p>
</sec>
<sec id="s3_8">
<title>Effects of calcium and cadmium on metabolism in MCF-7 cells</title>
<p>To better understand the role of calcium and cadmium in influencing metabolic genes, we re-analyzed our previously published microarray results using GSEA. In that study, MCF-7 cells were treated with cadmium and microarrays were used to measure gene expression (<xref ref-type="bibr" rid="B11">11</xref>). As expected, GSEA showed a significant increase of hallmark estrogen response early and late pathways (data not shown), which is consistent with our previously published studies showing that cadmium binds to and activates ER&#x3b1;. GSEA also identified an increase in several biosynthetic pathways, including an increase in the carbohydrate biosynthetic pathway (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7A</bold>
</xref>), suggesting that cadmium influences metabolism in MCF-7 cells. To verify the microarray results, MCF-7 cells were treated with calcium (1, 3, 5, and 10 mM) or cadmium (5 or 10 &#xb5;M) in the absence or presence of 4-hydroxy tamoxifen (5 &#x3bc;M) or the ER&#x3b1; antagonist ICI-182,780 (fluvestrant, 1 &#x3bc;M). Similar to HepG2 cells and ERR&#x3b3;-transfected HEK293T cells, treatment with calcium resulted in a maximal 2.8-, 2.2-, and 3.2-fold increase in PEPCK1, G6PC, and SLC2A2, respectively (<xref ref-type="fig" rid="f7">
<bold>Figures&#xa0;7B&#x2013;D</bold>
</xref>) and treatment with cadmium resulted in a maximal 3.8-, 4.0-, and 9.0-fold increase in PEPCK1, G6PC, and SLC2A2, respectively (<xref ref-type="fig" rid="f7">
<bold>Figures&#xa0;7E&#x2013;G</bold>
</xref>). The effects of both calcium and cadmium were blocked by 4-hydroxy tamoxifen. To verify that the effects of calcium and cadmium were not due to the activation of ER&#x3b1;, MCF-7 cells were also treated with ICI-182,780. The antiestrogen did not significantly block the effects of calcium or cadmium, suggesting that metal activation of ER&#x3b1; was not responsible for the increase in PEPCK1, G6PC, and SLC2A2. Lastly, immunofluorescence verified the expression of ERR&#x3b3; in MCF-7 cells (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;4</bold>
</xref>). Taken together, the results suggest that calcium and cadmium increase the expression of genes involved in gluconeogenesis through the activation of ERR&#x3b3;.</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>Effects of calcium and cadmium in MCF-7 cells. MCF-7 cells were treated with calcium (Ca; 1, 5, 7.5, or 10 mM) or cadmium (Cd; 5 or 10 &#x3bc;M) for 24 h in the absence or presence of 4-hydroxy tamoxifen (Tam; 5 &#x3bc;M) or ICI-182,780 (ICI; 1 &#x3bc;M). The expression of PEPCK1, G6PC, and SLC2A2 was measured using a quantitative real-time qPCR assay as described in <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>. Microarray results of MCF-7 treated with 1 &#xb5;M cadmium were analyzed by GSEA. <bold>(A)</bold> &#x201c;GSEA of gene expression changes in cadmium-treated MCF-7 cells. <bold>(B&#x2013;G)</bold> Effects of calcium and cadmium on the induction of PEPCK1, G6PC, and SLC2A2 mRNA in MCF-7 cells. Data are expressed as fold change (mean &#xb1; SEM); <italic>n</italic> &#x2265; 3. Statistical significance is defined as a <italic>p</italic>-value of &#x2264;0.05. *<italic>p &#x2264;</italic> 0.05; **<italic>p &#x2264;</italic> 0.01; ***<italic>p &#x2264;</italic> 0.001; ****<italic>p &#x2264;</italic> 0.0001. <bold>(H)</bold> Model by which calcium and cadmium mediated effects of glucagon. Glucagon activates ERR&#x3b3; through IP3R-induced increase in intracellular calcium. Calcium, in turn, activates ERR&#x3b3; through its LBD. Extracellular calcium through calcium channels also activates ERR&#x3b3;. Cadmium mimics calcium to activate ERR&#x3b3; through its LBD.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-15-1400022-g007.tif"/>
</fig>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<title>Discussion</title>
<p>Although disruption of metabolism is linked to many diseases such as obesity, type 2 diabetes, nonalcoholic fatty acid liver disease, and several cancers, the underlying mechanisms responsible for metabolic disruption are largely unknown (<xref ref-type="bibr" rid="B1">1</xref>&#x2013;<xref ref-type="bibr" rid="B4">4</xref>). ERR&#x3b3; is a key regulator of genes involved in gluconeogenesis. It is a member of the superfamily of nuclear receptors but, unlike many members of the superfamily, ERR&#x3b3; has no known physiological ligand (<xref ref-type="bibr" rid="B19">19</xref>, <xref ref-type="bibr" rid="B21">21</xref>). The present study suggests that calcium is a potential ligand of ERR&#x3b3;. More specifically, the results show that calcium mediates the effect of glucagon on gluconeogenesis and that cadmium, which mimics calcium, disrupts metabolism through ERR&#x3b3;. The results also show that calcium and cadmium activate ERR&#x3b3; through the LBD of the receptor and identifies S303, T429, and E452 as potential interaction sites <xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7H</bold>
</xref>.</p>
<p>Similar to other nuclear receptors, members of the ERR family have an N-terminus transactivation domain, a DNA binding domain, a hinge region, and a C-terminus LBD (<xref ref-type="bibr" rid="B22">22</xref>). The ERRs share high structural and sequence homology (<xref ref-type="bibr" rid="B34">34</xref>). However, key residues in the LBD discriminate between binding of a specific ligand. For example, BPA is a synthetic ligand of ERR&#x3b3; but has weak affinity for ERR&#x3b2; and no affinity for ERR&#x3b1;. Although the binding pockets of ERR&#x3b3; and ERR&#x3b2; accommodate BPA, the amino acid N346, which is unique to the LBD of ERR&#x3b3;, strengthens the binding of BPA, resulting in a higher affinity of ERR&#x3b3; for BPA (<xref ref-type="bibr" rid="B55">55</xref>). In contrast to ERR&#x3b3; and ERR&#x3b2;, the bulky amino acids F232 and F286 in the LBD of ERR&#x3b1; prevent the binding of BPA. The LBD of ERR&#x3b3; has the typical three-layered &#x3b1;-helix sandwich structure composed of 11 &#x3b1;-helices (H1 and H3&#x2013;H12) (<xref ref-type="bibr" rid="B53">53</xref>). One well-studied nuclear receptor is retinoid X receptor (RXR). Based on the crystal structure of the apo and holo LBD of RXR&#x3b1;, binding of ligand results in several major structural changes. Helix H11 rotates around its axis by approximately 180&#xb0; to generate a contiguous helix with helix H10 to form the dimerization domain. Helix H3 rotates around its axis by approximately 90&#xb0; and helix H12 is repositioned to seal the ligand-binding pocket of LBD of RXR&#x3b1; to form the coactivator binding site (<xref ref-type="bibr" rid="B56">56</xref>). Similar to RXR, the binding of synthetic compounds alters the structure of ERR&#x3b3;. For example, the agonist GSK4716 relocates helices H1&#x2013;H3 to enlarge the cavity of the LBD, allowing it to fit in the pocket. The antagonist 4-hydroxy tamoxifen dislocates helices H11 and H12 to block the binding of coactivator, thus inhibiting ERR&#x3b3; transcriptional activity (<xref ref-type="bibr" rid="B53">53</xref>, <xref ref-type="bibr" rid="B57">57</xref>). In contrast to compounds that alter the structure of ERR&#x3b3; by binding in the pocket, coregulators and some synthetic compounds such as BPA have a minor influence on the structure of ERR&#x3b3; and, instead, stabilize the structure of ERR&#x3b3; to increase its activity (<xref ref-type="bibr" rid="B57">57</xref>). For example, peroxisome proliferator-activated receptor-gamma coactivator 1 alpha (PGC1-&#x3b1;), which functions as an ERR&#x3b3; coactivator, stabilizes the ERR&#x3b3; structure by reducing the kinetics of helices H6, H7, H10/H11, and H12 (<xref ref-type="bibr" rid="B58">58</xref>). The molecular dynamics simulation of BPA-bound ERR&#x3b3; shows that regions such as the loop connecting helix H3 and helix H4 and the loop connecting helix H9 and helix H10 have a lower RMSF, suggesting that these regions are rigidified in BPA-bound ERR&#x3b3;, which stabilizes the LBD (<xref ref-type="bibr" rid="B19">19</xref>). The present study identified S303 on helix H4, T429 on helix H10, and E452 on helix H12 as potential calcium and cadmium interaction sites with ERR&#x3b3;. Similar to the molecular dynamics simulations with BPA, the binding of calcium to ERR&#x3b3; lowered the RMSF of the loop connecting helix H9 and helix H10 and the N-terminus of helix H10, suggesting that calcium binding to these sites stabilizes the ERR&#x3b3; structure in a manner similar to BPA. In the simulation, calcium docked to S303 but escaped from the water cage and when calcium docked to T429, it migrated and docked to S303. Interestingly, the location of the calcium and cadmium interaction sites are also located close to functional regions in ERR&#x3b3;. A recent study shows that the ERR&#x3b3; homodimer is formed by an interaction between helices H10. The amino acid pairs P422&#x2013;P422, R425&#x2013;Q426, and Q426&#x2013;R425 are essential to form intermolecular interactions at the homodimer interface (<xref ref-type="bibr" rid="B59">59</xref>). A calcium and cadmium interaction site at T429 on helix H10 is close to this region, suggesting that T429 may be involved in the formation of the dimerization domain of ERR&#x3b3;. In the case of the calcium and cadmium interaction site at E452 on helix H12, calcium binding to E452 of ERR&#x3b3; in our molecular dynamics simulations and PGC-1&#x3b1; binding to the ERR&#x3b3; in a previously published paper show that these interactions stabilize the structure of ERR&#x3b3;, suggesting that calcium interaction with E452 may have effects similar to PGC-1&#x3b1; (<xref ref-type="bibr" rid="B58">58</xref>). In addition to molecular dynamics simulations, sequence alignment of the LBD of ERR&#x3b3; and ER&#x3b1; shows that the amino acids of the calcium and cadmium interaction sites share similar side chain properties to the calcium interactions sites in ER&#x3b1;. For example, the amino acid S303 of ERR&#x3b3; and the corresponding amino acids C381 of ER&#x3b1; are nucleophilic. S303 is also conserved among the ERR family. The amino acid T429 of ERR&#x3b3; has a polar side chain group similar to the corresponding amino acid N519 of ER&#x3b1;. E452 is conserved between the ERR family and ER&#x3b1;. Taken together, these data suggest that the potential interaction sites of calcium in ERR&#x3b3; are important and require further investigation. Although the data suggest a model whereby metals interact with sites on the surface of the LBD, we cannot rule out an indirect effect of the metals. This proposed model remains to be validated.</p>
<p>The DNA and LBDs of ERR&#x3b1; and ERR&#x3b3; are highly conserved while their N-terminal activation domains are less conserved. Because of the high homology of their DNA binding domains, ERR&#x3b1; and ERR&#x3b3; target the same ERRE and have overlapping regulatory effects on metabolic genes (<xref ref-type="bibr" rid="B18">18</xref>&#x2013;<xref ref-type="bibr" rid="B20">20</xref>). Moreover, some studies show that ERR&#x3b1; and ERR&#x3b3; can form heterodimers (<xref ref-type="bibr" rid="B33">33</xref>&#x2013;<xref ref-type="bibr" rid="B35">35</xref>). For example, ERR&#x3b1; and ERR&#x3b3; enhance aerobic glycolysis by binding to ERREs in the promoter region of glycolytic genes (<xref ref-type="bibr" rid="B34">34</xref>, <xref ref-type="bibr" rid="B60">60</xref>). However, ERR&#x3b3; increases the expression of PEPCK while ERR&#x3b1; inhibits the expression of PEPCK, suggesting that ERR&#x3b3; and ERR&#x3b1; have opposing regulatory effects on the gluconeogenesis pathway (<xref ref-type="bibr" rid="B34">34</xref>, <xref ref-type="bibr" rid="B35">35</xref>, <xref ref-type="bibr" rid="B61">61</xref>). HK2 and H6PD are also regulated by ERR&#x3b1; and ERR&#x3b3; (<xref ref-type="bibr" rid="B20">20</xref>, <xref ref-type="bibr" rid="B60">60</xref>). In this study, treatment of HEK293T cells transfected with ERR&#x3b3; with calcium and cadmium resulted in a decrease in the expression of HK2 and H6PD that was not blocked by 4-hydroxy tamoxifen. It is possible that heterodimerization of ERR&#x3b3; with ERR&#x3b1; influences the effects of 4-hydroxy tamoxifen. Whether ERR&#x3b3; and ERR&#x3b1; function as a heterodimer and whether heterodimers are agonistic or antagonistic are largely unknown. The interaction between ERR&#x3b1; and ERR&#x3b3; and their influence on global metabolic regulation still require more investigation.</p>
<p>Although there are only a few studies, the expression of ERR&#x3b3; splice variants appears to be tissue specific (<xref ref-type="bibr" rid="B32">32</xref>). The functions of different ERR&#x3b3; splice variants are largely unknown. In this study, two ERR&#x3b3; isoforms were studied. Compared to ERR&#x3b3;1, ERR&#x3b3;3 is missing the first 23 amino acids and Y234 in the N-terminus of the LBD is replaced with LLWSDPAD. Interestingly, many ERR&#x3b3; splice variants are missing the first 23 amino acids. One study shows that the AF-1 of ERR&#x3b3;1 recruits coactivators while the AF-1 of ERR&#x3b3;2, which is missing the first 23 amino acids, does not recruit coactivators, suggesting that the first 23 amino acids is an additional N-terminal AF-1 (<xref ref-type="bibr" rid="B62">62</xref>). Similar results are observed for other nuclear receptors. Hepatocyte nuclear factor 4&#x3b1;7 and hepatocyte nuclear factor 4&#x3b1;1 also differ in the N-terminus. Hepatocyte nuclear factor 4&#x3b1;7 is missing the first 13 amino acids and has no measurable AF-1 activity (<xref ref-type="bibr" rid="B63">63</xref>). Compared to progesterone receptor B, progesterone receptor A is missing the first 164 amino acids. Progesterone receptor B has a transcription activation domain 3 (AF-3) in the N terminus (amino acids 54&#x2013;154) that synergizes with AF-1 and AF-2 (<xref ref-type="bibr" rid="B64">64</xref>, <xref ref-type="bibr" rid="B65">65</xref>). Although the effects of the insertion between the hinge region and the LBD of ERR&#x3b3; are not known, previous studies suggest that insertions in the LBD of nuclear receptors have different regulatory effects. For example, the human constitutive androstane receptor splice variant 2 has an additional nine amino acids in the LBD that is associated with loss of transcriptional activity (<xref ref-type="bibr" rid="B66">66</xref>). Estrogen receptor &#x3b2; isoform 2 in rat has an additional 18 amino acids between helix H5 and H6 in the LBD. Estrogen receptor &#x3b2; isoform 2 is not active and inhibits the transcriptional activity of ER&#x3b1; and estrogen receptor &#x3b2; isoform 1 (<xref ref-type="bibr" rid="B67">67</xref>). In this study, treatment of HEK293T cells transfected with ERR&#x3b3;1 or ERR&#x3b3;3 with calcium and cadmium increased the expression of PEPCK1 and G6PC, suggesting that genes in gluconeogenesis are regulated by ERR&#x3b3; splice variants 1 and 3. In contrast to PEPCK1 and G6PC, SLC2A2 was upregulated by ERR&#x3b3;1 but not by ERR&#x3b3;3, suggesting that sequences of ERR&#x3b3; splice variants influence the effects of ERR&#x3b3;. Moreover, treatment with calcium and cadmium increased the expression of PDK4 in HepG2 cells and HEK293T cells transfected with ERR&#x3b3; but not in MCF-7 cells (data not shown), suggesting that the regulatory effects of ERR&#x3b3; in different tissues may be due to different splice variants and/or coregulators. These results suggest that ERR&#x3b3; splice variants have different regulatory effects.</p>
<p>In the body, calcium has important physiological functions including signaling in cell proliferation and stemness, muscle contraction, and hormone secretion (<xref ref-type="bibr" rid="B13">13</xref>). In addition, calcium facilitates protein processing and activates other proteins such as calcineurin (<xref ref-type="bibr" rid="B13">13</xref>, <xref ref-type="bibr" rid="B49">49</xref>). Therefore, calcium homeostasis is essential and alternation of calcium homeostasis results in several pathological conditions especially metabolic disease (<xref ref-type="bibr" rid="B12">12</xref>&#x2013;<xref ref-type="bibr" rid="B15">15</xref>). On the other hand, cadmium is a heavy metal with no physiological function that accumulates in the body (<xref ref-type="bibr" rid="B68">68</xref>). Cadmium mimics calcium due to its similar charge and ionic radius, but has a higher affinity for some proteins than calcium. Because cadmium has a higher affinity for some proteins, it disrupts normal protein function and signaling pathways. Several studies have linked cadmium with obesity and type 2 diabetes (<xref ref-type="bibr" rid="B9">9</xref>, <xref ref-type="bibr" rid="B10">10</xref>). Furthermore, several studies have identified cadmium as a human pancreatic carcinogen (<xref ref-type="bibr" rid="B69">69</xref>&#x2013;<xref ref-type="bibr" rid="B71">71</xref>). Although several epidemiologic studies have explored the relationship between metabolic diseases, such as obesity and diabetes, and calcium and cadmium (<xref ref-type="bibr" rid="B9">9</xref>, <xref ref-type="bibr" rid="B10">10</xref>, <xref ref-type="bibr" rid="B72">72</xref>&#x2013;<xref ref-type="bibr" rid="B74">74</xref>), the mechanisms that are responsible for the effects of calcium and cadmium in metabolic diseases are not well understood (<xref ref-type="bibr" rid="B9">9</xref>, <xref ref-type="bibr" rid="B10">10</xref>, <xref ref-type="bibr" rid="B72">72</xref>&#x2013;<xref ref-type="bibr" rid="B74">74</xref>). This study shows that calcium is a potential ligand of the metabolic regulator ERR&#x3b3; that mediates the effects of glucagon on genes in the gluconeogenesis pathway and that cadmium, which mimics calcium, disrupts metabolism through ERR&#x3b3;, providing a possible mechanism for the effects of calcium and cadmium in metabolic diseases.</p>
<sec id="s4_1">
<title>Limitations of the study</title>
<p>This study has revealed that calcium is a potential ligand of ERR&#x3b3; that mediates the effects of glucagon and that cadmium, which mimics the effects of calcium, disrupts metabolism through ERR&#x3b3;. While this study identified three potential interaction sites (S303, T429, and E452), other interaction sites and mechanisms of activation remain undetermined. Moreover, this study raised new questions about the role of calcium and cadmium in metabolism. In pursuit of answering these questions, future research should involve <italic>in vivo</italic> studies and structural crystallography studies.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Primer sequence and taqman probe catalog number.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" colspan="3" align="left">Primer sequence</th>
</tr>
</thead>
<tbody>
<tr>
<th valign="top" align="left">Experiment</th>
<th valign="top" align="left">Gene</th>
<th valign="top" align="left">Primer sequence</th>
</tr>
<tr>
<td valign="top" align="left">Chip</td>
<td valign="top" align="left">PEPCK1</td>
<td valign="top" align="left">Forward: TTGAGACCTAGCCCC GTTCT</td>
</tr>
<tr>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left">Reserve: AGTTTAGGGAGTGGAGGGGG</td>
</tr>
<tr>
<td valign="top" align="left"/>
<td valign="top" align="left">G6PC</td>
<td valign="top" align="left">Forward: ACACCAAGGGCTGTAACTTT</td>
</tr>
<tr>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left">Reverse: TGGTTTGGGAGATCAACCCC</td>
</tr>
<tr>
<td valign="top" align="left"/>
<td valign="top" align="left">PDK4</td>
<td valign="top" align="left">Forward: TAGACGAAGAGGGCAAAGGA</td>
</tr>
<tr>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left">Reverse: TGGTGAAGATGGGGTTTCTC</td>
</tr>
<tr>
<td valign="top" align="left"/>
<td valign="top" align="left">SLC2A2</td>
<td valign="top" align="left">Forward: GCAAAAGGTCATAGCATGGTCA</td>
</tr>
<tr>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left">Reverse: ACCTGGTCACTGAGTATGGTGA</td>
</tr>
<tr>
<td valign="top" align="left">Mutagenesis</td>
<td valign="top" align="left">S303A</td>
<td valign="top" align="left">Forward: GAATCTCCATCCATGCAGCC<break/>TGGAGGAGGCTCATCT</td>
</tr>
<tr>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left">Reverse: AGATGAGCCTCCTCCAGGCTG<break/>CATGGATGGAGATTC</td>
</tr>
<tr>
<td valign="top" align="left"/>
<td valign="top" align="left">T429A</td>
<td valign="top" align="left">Forward: TGGACTGCCTTGGCGGAGGTC<break/>TGCCTC</td>
</tr>
<tr>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left">Reverse: GAGGCAGACCTCCGCCAAGGCA<break/>GTCCA</td>
</tr>
<tr>
<td valign="top" align="left"/>
<td valign="top" align="left">E452A</td>
<td valign="top" align="left">Forward: CTTGGCCTCCAGCATTGCCAA<break/>AAAAAGTTTGTGCATGGG</td>
</tr>
<tr>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left">Reverse: CCCATGCACAAACTTTTTTTG<break/>GCAATGCTGGAGGCCAAG</td>
</tr>
<tr>
<td valign="top" align="left">CAT reporter</td>
<td valign="top" align="left">CAT</td>
<td valign="top" align="left">Forward: TTCTTGCCCGCCTGATGAAT</td>
</tr>
<tr>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left">Reverse: ACCGTAACACGCCACATCTT</td>
</tr>
<tr>
<td valign="top" align="left"/>
<td valign="top" align="left">&#x3b2;-galactosidase</td>
<td valign="top" align="left">Forward: ATGGGTAACAGTCTTGGCGG</td>
</tr>
<tr>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left">Reverse: GGCGTATCGCCAAAATCACC</td>
</tr>
<tr>
<td valign="top" colspan="3" align="left">Taqman probe catalog</td>
</tr>
<tr>
<th valign="top" align="left">Gene</th>
<th valign="top" colspan="2" align="left">Catalog</th>
</tr>
<tr>
<td valign="top" align="left">ERR&#x3b3;</td>
<td valign="top" colspan="2" align="left">Hs00976243_m1</td>
</tr>
<tr>
<td valign="top" align="left">PEPCK1</td>
<td valign="top" colspan="2" align="left">Hs01572978_g1</td>
</tr>
<tr>
<td valign="top" align="left">G6PC</td>
<td valign="top" colspan="2" align="left">Hs00609178_m1</td>
</tr>
<tr>
<td valign="top" align="left">PDK4</td>
<td valign="top" colspan="2" align="left">Hs01037712_m1</td>
</tr>
<tr>
<td valign="top" align="left">SLC2A2</td>
<td valign="top" colspan="2" align="left">Hs01096908_m1</td>
</tr>
<tr>
<td valign="top" align="left">HK2</td>
<td valign="top" colspan="2" align="left">Hs00606086_m1</td>
</tr>
<tr>
<td valign="top" align="left">H6PD</td>
<td valign="top" colspan="2" align="left">Hs00188728_m1</td>
</tr>
<tr>
<td valign="top" align="left">MDH2</td>
<td valign="top" colspan="2" align="left">Hs00606086_m1</td>
</tr>
<tr>
<td valign="top" align="left">LDHA</td>
<td valign="top" colspan="2" align="left">Hs01378790_g1</td>
</tr>
<tr>
<td valign="top" align="left">SLC2A1</td>
<td valign="top" colspan="2" align="left">Hs00892681_m1</td>
</tr>
<tr>
<td valign="top" align="left">PFKL</td>
<td valign="top" colspan="2" align="left">Hs01036347_m1</td>
</tr>
<tr>
<td valign="top" align="left">PK</td>
<td valign="top" colspan="2" align="left">Hs00987255_m1</td>
</tr>
<tr>
<td valign="top" align="left">RPLP0</td>
<td valign="top" colspan="2" align="left">Hs00420895_gH</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
</sec>
</body>
<back>
<sec id="s5" sec-type="data-availability">
<title>Data availability statement</title>
<p>The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.</p>
</sec>
<sec id="s6" sec-type="ethics-statement">
<title>Ethics statement</title>
<p>Ethical approval was not required for the studies on humans in accordance with the local legislation and institutional requirements because only commercially available established cell lines were used.</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author contributions</title>
<p>QW: Formal analysis, Writing &#x2013; original draft, Writing &#x2013; review &amp; editing. NH: Writing &#x2013; review &amp; editing, Investigation. JP: Investigation, Writing &#x2013; review &amp; editing. RG: Investigation, Writing &#x2013; review &amp; editing. GY: Investigation, Writing &#x2013; review &amp; editing. DL: Writing &#x2013; review &amp; editing, Investigation. SC: Investigation, Writing &#x2013; review &amp; editing. XS: Writing &#x2013; review &amp; editing, Investigation. RC: Conceptualization, Funding acquisition, Writing &#x2013; review &amp; editing: BH: Conceptualization, Funding acquisition, Writing &#x2013; review &amp; editing. MM: Conceptualization, Funding acquisition, Supervision, Writing &#x2013; original draft, Writing &#x2013; review &amp; editing.</p>
</sec>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>The author(s) declare financial support was received for the research, authorship, and/or publication of this article. This work was supported, in part, by grants from the National Institutes of Health (T32-CA009686 to JP and U01-ES026132 to MM and BH) and P20-CA242611 to MM and RC; the Gewirz Foundation (to MM); the King Khalid University (to RG); the Georgetown University Undergraduate Research Opportunities Program (to SC); 2UL1TR001409&#x2014;06 (previously UL1TR001409&#x2014;05) from the National Center for Advancing Translational Sciences (to MM and RC), and Genomics and Epigenomics and Biacore Molecular Interaction Shared Resources and Tissue Culture and Biobanking Shared Resource (P30-CA51008).</p>
</sec>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s10" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s11" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fendo.2024.1400022/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fendo.2024.1400022/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="DataSheet1.pdf" id="SM1" mimetype="application/pdf"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Picon-Ruiz</surname> <given-names>M</given-names>
</name>
<name>
<surname>Morata-Tarifa</surname> <given-names>C</given-names>
</name>
<name>
<surname>Valle-Goffin</surname> <given-names>JJ</given-names>
</name>
<name>
<surname>Friedman</surname> <given-names>ER</given-names>
</name>
<name>
<surname>Slingerland</surname> <given-names>JM</given-names>
</name>
</person-group>. <article-title>Obesity and adverse breast cancer risk and outcome: Mechanistic insights and strategies for intervention</article-title>. <source>CA Cancer J Clin</source>. (<year>2017</year>) <volume>67</volume>:<page-range>378&#x2013;97</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.3322/CAAC.21405</pub-id>
</citation>
</ref>
<ref id="B2">
<label>2</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lustig</surname> <given-names>RH</given-names>
</name>
<name>
<surname>Collier</surname> <given-names>D</given-names>
</name>
<name>
<surname>Kassotis</surname> <given-names>C</given-names>
</name>
<name>
<surname>Roepke</surname> <given-names>TA</given-names>
</name>
<name>
<surname>Ji Kim</surname> <given-names>M</given-names>
</name>
<name>
<surname>Blanc</surname> <given-names>E</given-names>
</name>
<etal/>
</person-group>. <article-title>Obesity I: Overview and molecular and biochemical mechanisms</article-title>. <source>Biochem Pharmacol</source>. (<year>2022</year>) <volume>199</volume>:<elocation-id>115012</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/J.BCP.2022.115012</pub-id>
</citation>
</ref>
<ref id="B3">
<label>3</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Heindel</surname> <given-names>JJ</given-names>
</name>
<name>
<surname>Howard</surname> <given-names>S</given-names>
</name>
<name>
<surname>Agay-Shay</surname> <given-names>K</given-names>
</name>
<name>
<surname>Arrebola</surname> <given-names>JP</given-names>
</name>
<name>
<surname>Audouze</surname> <given-names>K</given-names>
</name>
<name>
<surname>Babin</surname> <given-names>PJ</given-names>
</name>
<etal/>
</person-group>. <article-title>Obesity II: Establishing causal links between chemical exposures and obesity</article-title>. <source>Biochem Pharmacol</source>. (<year>2022</year>) <volume>199</volume>:<elocation-id>115015</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/J.BCP.2022.115015</pub-id>
</citation>
</ref>
<ref id="B4">
<label>4</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kassotis</surname> <given-names>CD</given-names>
</name>
<name>
<surname>vom Saal</surname> <given-names>FS</given-names>
</name>
<name>
<surname>Babin</surname> <given-names>PJ</given-names>
</name>
<name>
<surname>Lagadic-Gossmann</surname> <given-names>D</given-names>
</name>
<name>
<surname>le Mentec</surname> <given-names>H</given-names>
</name>
<name>
<surname>Blumberg</surname> <given-names>B</given-names>
</name>
<etal/>
</person-group>. <article-title>Obesity III: Obesogen assays: Limitations, strengths, and new directions</article-title>. <source>Biochem Pharmacol</source>. (<year>2022</year>) <volume>199</volume>:<elocation-id>115014</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/J.BCP.2022.115014</pub-id>
</citation>
</ref>
<ref id="B5">
<label>5</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cao</surname> <given-names>H</given-names>
</name>
</person-group>. <article-title>Adipocytokines in obesity and metabolic disease</article-title>. <source>J Endocrinol</source>. (<year>2014</year>) <volume>220</volume>:<page-range>T47&#x2013;59</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1530/JOE-13-0339</pub-id>
</citation>
</ref>
<ref id="B6">
<label>6</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Low</surname> <given-names>S</given-names>
</name>
<name>
<surname>Chin</surname> <given-names>MC</given-names>
</name>
<name>
<surname>Deurenberg-Yap</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Review on epidemic of obesity</article-title>. <source>Ann Acad Med</source>. (<year>2009</year>) <volume>38</volume>(<issue>1</issue>):<fpage>57</fpage>&#x2013;<lpage>9</lpage>.</citation>
</ref>
<ref id="B7">
<label>7</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Olokoba</surname> <given-names>AB</given-names>
</name>
<name>
<surname>Obateru</surname> <given-names>OA</given-names>
</name>
<name>
<surname>Olokoba</surname> <given-names>LB</given-names>
</name>
</person-group>. <article-title>Type 2 diabetes mellitus: A review of current trends</article-title>. <source>Oman Med J</source>. (<year>2012</year>) <volume>27</volume>:<fpage>269</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.5001/OMJ.2012.68</pub-id>
</citation>
</ref>
<ref id="B8">
<label>8</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Martyn</surname> <given-names>JAJ</given-names>
</name>
<name>
<surname>Kaneki</surname> <given-names>M</given-names>
</name>
<name>
<surname>Yasuhara</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>Obesity-induced insulin resistance and hyperglycemiaEtiologic factors and molecular mechanisms</article-title>. <source>Anesthesiology</source>. (<year>2008</year>) <volume>109</volume>:<page-range>137&#x2013;48</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1097/ALN.0B013E3181799D45</pub-id>
</citation>
</ref>
<ref id="B9">
<label>9</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Edwards</surname> <given-names>JR</given-names>
</name>
<name>
<surname>Prozialeck</surname> <given-names>WC</given-names>
</name>
</person-group>. <article-title>Cadmium, diabetes and chronic kidney disease</article-title>. <source>Toxicol Appl Pharmacol</source>. (<year>2009</year>) <volume>238</volume>:<page-range>289&#x2013;93</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/J.TAAP.2009.03.007</pub-id>
</citation>
</ref>
<ref id="B10">
<label>10</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tinkov</surname> <given-names>AA</given-names>
</name>
<name>
<surname>Filippini</surname> <given-names>T</given-names>
</name>
<name>
<surname>Ajsuvakova</surname> <given-names>OP</given-names>
</name>
<name>
<surname>Aaseth</surname> <given-names>J</given-names>
</name>
<name>
<surname>Gluhcheva</surname> <given-names>YG</given-names>
</name>
<name>
<surname>Ivanova</surname> <given-names>JM</given-names>
</name>
<etal/>
</person-group>. <article-title>The role of cadmium in obesity and diabetes</article-title>. <source>Sci Total Environ</source>. (<year>2017</year>) <volume>601&#x2013;602</volume>:<page-range>741&#x2013;55</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/J.SCITOTENV.2017.05.224</pub-id>
</citation>
</ref>
<ref id="B11">
<label>11</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Divekar</surname> <given-names>SD</given-names>
</name>
<name>
<surname>Li</surname> <given-names>HH</given-names>
</name>
<name>
<surname>Parodi</surname> <given-names>DA</given-names>
</name>
<name>
<surname>Ghafouri</surname> <given-names>TB</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>R</given-names>
</name>
<name>
<surname>Cyrus</surname> <given-names>K</given-names>
</name>
<etal/>
</person-group>. <article-title>Arsenite and cadmium promote the development of mammary tumors</article-title>. <source>Carcinogenesis</source>. (<year>2020</year>) <volume>41</volume>:<page-range>1005&#x2013;14</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/CARCIN/BGZ176</pub-id>
</citation>
</ref>
<ref id="B12">
<label>12</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Li</surname> <given-names>G</given-names>
</name>
<name>
<surname>Goode</surname> <given-names>J</given-names>
</name>
<name>
<surname>Paz</surname> <given-names>JC</given-names>
</name>
<name>
<surname>Ouyang</surname> <given-names>K</given-names>
</name>
<name>
<surname>Screaton</surname> <given-names>R</given-names>
</name>
<etal/>
</person-group>. <article-title>Inositol-1,4,5-trisphosphate receptor regulates hepatic gluconeogenesis in fasting and diabetes</article-title>. <source>Nature</source>. (<year>2012</year>) <volume>485</volume>:<page-range>128&#x2013;32</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nature10988</pub-id>
</citation>
</ref>
<ref id="B13">
<label>13</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Arruda</surname> <given-names>AP</given-names>
</name>
<name>
<surname>Hotamisligil</surname> <given-names>GS</given-names>
</name>
</person-group>. <article-title>Calcium homeostasis and organelle function in the pathogenesis of obesity and diabetes</article-title>. <source>Cell Metab</source>. (<year>2015</year>) <volume>22</volume>:<page-range>381&#x2013;97</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/J.CMET.2015.06.010</pub-id>
</citation>
</ref>
<ref id="B14">
<label>14</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Levy</surname> <given-names>J</given-names>
</name>
<name>
<surname>Gavin</surname> <given-names>JR</given-names>
</name>
<name>
<surname>Sowers</surname> <given-names>JR</given-names>
</name>
</person-group>. <article-title>Diabetes mellitus: A disease of abnormal cellular calcium metabolism</article-title>? <source>Am J Med</source>. (<year>1994</year>) <volume>96</volume>:<page-range>260&#x2013;73</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/0002-9343(94)90152-X</pub-id>
</citation>
</ref>
<ref id="B15">
<label>15</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yin</surname> <given-names>T</given-names>
</name>
<name>
<surname>Kuo</surname> <given-names>SC</given-names>
</name>
<name>
<surname>Chang</surname> <given-names>YY</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>YT</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>KWK</given-names>
</name>
</person-group>. <article-title>Verapamil use is associated with reduction of newly diagnosed diabetes mellitus</article-title>. <source>J Clin Endocrinol Metab</source>. (<year>2017</year>) <volume>102</volume>:<page-range>2604&#x2013;10</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1210/JC.2016-3778</pub-id>
</citation>
</ref>
<ref id="B16">
<label>16</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname> <given-names>W</given-names>
</name>
<name>
<surname>Yan</surname> <given-names>H</given-names>
</name>
<name>
<surname>Pan</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Shen</surname> <given-names>JZ</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>F</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>C</given-names>
</name>
<etal/>
</person-group>. <article-title>Glucagon regulates hepatic mitochondrial function and biogenesis through FOXO1</article-title>. <source>J Endocrinol</source>. (<year>2019</year>) <volume>241</volume>:<page-range>265&#x2013;78</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1530/JOE-19-0081</pub-id>
</citation>
</ref>
<ref id="B17">
<label>17</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tohm&#xe9;</surname> <given-names>M</given-names>
</name>
<name>
<surname>Prud&#x2019;Homme</surname> <given-names>SM</given-names>
</name>
<name>
<surname>Boulahtouf</surname> <given-names>A</given-names>
</name>
<name>
<surname>Samarut</surname> <given-names>E</given-names>
</name>
<name>
<surname>Brunet</surname> <given-names>F</given-names>
</name>
<name>
<surname>Bernard</surname> <given-names>L</given-names>
</name>
<etal/>
</person-group>. <article-title>Estrogen-related receptor &#x3b3; is an <italic>in vivo</italic> receptor of bisphenol A</article-title>. <source>FASEB J</source>. (<year>2014</year>) <volume>28</volume>:<page-range>3124&#x2013;33</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1096/FJ.13-240465</pub-id>
</citation>
</ref>
<ref id="B18">
<label>18</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mohideen-Abdul</surname> <given-names>K</given-names>
</name>
<name>
<surname>Tazibt</surname> <given-names>K</given-names>
</name>
<name>
<surname>Bourguet</surname> <given-names>M</given-names>
</name>
<name>
<surname>Hazemann</surname> <given-names>I</given-names>
</name>
<name>
<surname>Lebars</surname> <given-names>I</given-names>
</name>
<name>
<surname>Takacs</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Importance of the sequence-directed DNA shape for specific binding site recognition by the estrogen-related receptor</article-title>. <source>Front Endocrinol (Lausanne)</source>. (<year>2017</year>) <volume>8</volume>:<elocation-id>140/BIBTEX</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/FENDO.2017.00140/BIBTEX</pub-id>
</citation>
</ref>
<ref id="B19">
<label>19</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Thouennon</surname> <given-names>E</given-names>
</name>
<name>
<surname>Delfosse</surname> <given-names>V</given-names>
</name>
<name>
<surname>Bailly</surname> <given-names>R</given-names>
</name>
<name>
<surname>Blanc</surname> <given-names>P</given-names>
</name>
<name>
<surname>Boulahtouf</surname> <given-names>A</given-names>
</name>
<name>
<surname>Grimaldi</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Insights into the activation mechanism of human estrogen-related receptor &#x3b3; by environmental endocrine disruptors</article-title>. <source>Cell Mol Life Sci</source>. (<year>2019</year>) <volume>76</volume>:<page-range>4769&#x2013;81</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/S00018-019-03129-X/FIGURES/4</pub-id>
</citation>
</ref>
<ref id="B20">
<label>20</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dufour</surname> <given-names>CR</given-names>
</name>
<name>
<surname>Wilson</surname> <given-names>BJ</given-names>
</name>
<name>
<surname>Huss</surname> <given-names>JM</given-names>
</name>
<name>
<surname>Kelly</surname> <given-names>DP</given-names>
</name>
<name>
<surname>Alaynick</surname> <given-names>WA</given-names>
</name>
<name>
<surname>Downes</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Genome-wide orchestration of cardiac functions by the orphan nuclear receptors ERR&#x3b1; and &#x3b3;</article-title>. <source>Cell Metab</source>. (<year>2007</year>) <volume>5</volume>:<page-range>345&#x2013;56</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/J.CMET.2007.03.007</pub-id>
</citation>
</ref>
<ref id="B21">
<label>21</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Takayanagi</surname> <given-names>S</given-names>
</name>
<name>
<surname>Tokunaga</surname> <given-names>T</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>X</given-names>
</name>
<name>
<surname>Okada</surname> <given-names>H</given-names>
</name>
<name>
<surname>Matsushima</surname> <given-names>A</given-names>
</name>
<name>
<surname>Shimohigashi</surname> <given-names>Y</given-names>
</name>
</person-group>. <article-title>Endocrine disruptor bisphenol A strongly binds to human estrogen-related receptor &#x3b3; (ERR&#x3b3;) with high constitutive activity</article-title>. <source>Toxicol Lett</source>. (<year>2006</year>) <volume>167</volume>:<fpage>95</fpage>&#x2013;<lpage>105</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/J.TOXLET.2006.08.012</pub-id>
</citation>
</ref>
<ref id="B22">
<label>22</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Misra</surname> <given-names>J</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>DK</given-names>
</name>
<name>
<surname>Choi</surname> <given-names>HS</given-names>
</name>
</person-group>. <article-title>ERR&#x3b3;: a junior orphan with a senior role in metabolism</article-title>. <source>Trends Endocrinol Metab</source>. (<year>2017</year>) <volume>28</volume>:<page-range>261&#x2013;72</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/J.TEM.2016.12.005</pub-id>
</citation>
</ref>
<ref id="B23">
<label>23</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kim</surname> <given-names>DK</given-names>
</name>
<name>
<surname>Ryu</surname> <given-names>D</given-names>
</name>
<name>
<surname>Koh</surname> <given-names>M</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>MW</given-names>
</name>
<name>
<surname>Lim</surname> <given-names>D</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>MJ</given-names>
</name>
<etal/>
</person-group>. <article-title>Orphan nuclear receptor estrogen-related receptor &#x3b3;(ERR&#x3b3;) is key regulator of hepatic gluconeogenesis</article-title>. <source>J Biol Chem</source>. (<year>2012</year>) <volume>287</volume>:<page-range>21628&#x2013;39</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1074/JBC.M111.315168/ATTACHMENT/C4F4E45A-0370-4EBD-B69B-9ADC333C6E97/MMC1.PDF</pub-id>
</citation>
</ref>
<ref id="B24">
<label>24</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Misra</surname> <given-names>J</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>D-K</given-names>
</name>
<name>
<surname>Jung</surname> <given-names>YS</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>HB</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>Y-H</given-names>
</name>
<name>
<surname>Yoo</surname> <given-names>E-K</given-names>
</name>
<etal/>
</person-group>. <article-title>O-glcNAcylation of orphan nuclear receptor estrogen-related receptor &#x3b3; Promotes hepatic gluconeogenesis</article-title>. <source>Diabetes</source>. (<year>2016</year>) <volume>65</volume>:<page-range>2835&#x2013;48</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.2337/db15-1523</pub-id>
</citation>
</ref>
<ref id="B25">
<label>25</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kim</surname> <given-names>DK</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>YH</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>JH</given-names>
</name>
<name>
<surname>Jung</surname> <given-names>YS</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>J</given-names>
</name>
<name>
<surname>Feng</surname> <given-names>R</given-names>
</name>
<etal/>
</person-group>. <article-title>Estrogen-related receptor &#x3b3; controls sterol regulatory element-binding protein-1c expression and alcoholic fatty liver</article-title>. <source>Biochim Biophys Acta (BBA) - Mol Cell Biol Lipids</source>. (<year>2019</year>) <volume>1864</volume>:<elocation-id>158521</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/J.BBALIP.2019.158521</pub-id>
</citation>
</ref>
<ref id="B26">
<label>26</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dixen</surname> <given-names>K</given-names>
</name>
<name>
<surname>Basse</surname> <given-names>AL</given-names>
</name>
<name>
<surname>Murholm</surname> <given-names>M</given-names>
</name>
<name>
<surname>Isidor</surname> <given-names>MS</given-names>
</name>
<name>
<surname>Hansen</surname> <given-names>LHL</given-names>
</name>
<name>
<surname>Petersen</surname> <given-names>MCH</given-names>
</name>
<etal/>
</person-group>. <article-title>ERR&#x3b3; enhances UCP1 expression and fatty acid oxidation in brown adipocytes</article-title>. <source>Obesity</source>. (<year>2013</year>) <volume>21</volume>:<page-range>516&#x2013;24</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/OBY.20067</pub-id>
</citation>
</ref>
<ref id="B27">
<label>27</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Alaynick</surname> <given-names>WA</given-names>
</name>
<name>
<surname>Kondo</surname> <given-names>RP</given-names>
</name>
<name>
<surname>Xie</surname> <given-names>W</given-names>
</name>
<name>
<surname>He</surname> <given-names>W</given-names>
</name>
<name>
<surname>Dufour</surname> <given-names>CR</given-names>
</name>
<name>
<surname>Downes</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>ERR&#x3b3; Directs and maintains the transition to oxidative metabolism in the postnatal heart</article-title>. <source>Cell Metab</source>. (<year>2007</year>) <volume>6</volume>:<fpage>13</fpage>&#x2013;<lpage>24</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/J.CMET.2007.06.007</pub-id>
</citation>
</ref>
<ref id="B28">
<label>28</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dong</surname> <given-names>SS</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>DL</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>XF</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>XM</given-names>
</name>
<name>
<surname>Shen</surname> <given-names>H</given-names>
</name>
<etal/>
</person-group>. <article-title>Epigenomic elements analyses for promoters identify ESRRG as a new susceptibility gene for obesity-related traits</article-title>. <source>Int J Obes</source>. (<year>2016</year>) <volume>40</volume>:<page-range>1170&#x2013;6</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/ijo.2016.44</pub-id>
</citation>
</ref>
<ref id="B29">
<label>29</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Soundararajan</surname> <given-names>A</given-names>
</name>
<name>
<surname>Prabu</surname> <given-names>P</given-names>
</name>
<name>
<surname>Mohan</surname> <given-names>V</given-names>
</name>
<name>
<surname>Gibert</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Balasubramanyam</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Novel insights of elevated systemic levels of bisphenol-A (BPA) linked to poor glycemic control, accelerated cellular senescence and insulin resistance in patients with type 2 diabetes</article-title>. <source>Mol Cell Biochem</source>. (<year>2019</year>) <volume>458</volume>:<page-range>171&#x2013;83</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/S11010-019-03540-9/TABLES/4</pub-id>
</citation>
</ref>
<ref id="B30">
<label>30</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kim</surname> <given-names>DK</given-names>
</name>
<name>
<surname>Gang</surname> <given-names>GT</given-names>
</name>
<name>
<surname>Ryu</surname> <given-names>D</given-names>
</name>
<name>
<surname>Koh</surname> <given-names>M</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>YN</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>SS</given-names>
</name>
<etal/>
</person-group>. <article-title>Inverse agonist of nuclear receptor ERR&#x3b3; Mediates antidiabetic effect through inhibition of hepatic gluconeogenesis</article-title>. <source>Diabetes</source>. (<year>2013</year>) <volume>62</volume>:<page-range>3093&#x2013;102</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.2337/DB12-0946</pub-id>
</citation>
</ref>
<ref id="B31">
<label>31</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kim</surname> <given-names>DK</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>JR</given-names>
</name>
<name>
<surname>Koh</surname> <given-names>M</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>YD</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>JM</given-names>
</name>
<name>
<surname>Chanda</surname> <given-names>D</given-names>
</name>
<etal/>
</person-group>. <article-title>Estrogen-related receptor &#x3b3; (ERR&#x3b3;) is a novel transcriptional regulator of phosphatidic acid phosphatase, LIPIN1, and inhibits hepatic insulin signaling *</article-title>. <source>J Biol Chem</source>. (<year>2011</year>) <volume>286</volume>:<page-range>38035&#x2013;42</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1074/JBC.M111.250613</pub-id>
</citation>
</ref>
<ref id="B32">
<label>32</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Takeda</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>X</given-names>
</name>
<name>
<surname>Sumiyoshi</surname> <given-names>M</given-names>
</name>
<name>
<surname>Matsushima</surname> <given-names>A</given-names>
</name>
<name>
<surname>Shimohigashi</surname> <given-names>M</given-names>
</name>
<name>
<surname>Shimohigashi</surname> <given-names>Y</given-names>
</name>
</person-group>. <article-title>Placenta expressing the greatest quantity of bisphenol A receptor ERR&#x3b3; among the human reproductive tissues: predominant expression of type-1 ERR&#x3b3; Isoform</article-title>. <source>J Biochem</source>. (<year>2009</year>) <volume>146</volume>:<page-range>113&#x2013;22</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/JB/MVP049</pub-id>
</citation>
</ref>
<ref id="B33">
<label>33</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huppunen</surname> <given-names>J</given-names>
</name>
<name>
<surname>Aarnisalo</surname> <given-names>P</given-names>
</name>
</person-group>. <article-title>Dimerization modulates the activity of the orphan nuclear receptor ERR&#x3b3;</article-title>. <source>Biochem Biophys Res Commun</source>. (<year>2004</year>) <volume>314</volume>:<page-range>964&#x2013;70</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/J.BBRC.2003.12.194</pub-id>
</citation>
</ref>
<ref id="B34">
<label>34</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huss</surname> <given-names>JM</given-names>
</name>
<name>
<surname>Garbacz</surname> <given-names>WG</given-names>
</name>
<name>
<surname>Xie</surname> <given-names>W</given-names>
</name>
</person-group>. <article-title>Constitutive activities of estrogen-related receptors: Transcriptional regulation of metabolism by the ERR pathways in health and disease</article-title>. <source>Biochim Biophys Acta (BBA) - Mol Basis Dis</source>. (<year>2015</year>) <volume>1852</volume>:<page-range>1912&#x2013;27</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/J.BBADIS.2015.06.016</pub-id>
</citation>
</ref>
<ref id="B35">
<label>35</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Audet-Walsh</surname> <given-names>&#xc9;</given-names>
</name>
<name>
<surname>Gigu&#xe9;re</surname> <given-names>V</given-names>
</name>
</person-group>. <article-title>(2014). The multiple universes of estrogen-related receptor &#x3b1; and &#x3b3; in metabolic control and related diseases</article-title>. <source>Acta Pharmacol Sin</source>. (<year>2015</year>) <volume>36</volume>:<fpage>51</fpage>&#x2013;<lpage>61</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/aps.2014.121</pub-id>
</citation>
</ref>
<ref id="B36">
<label>36</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Byrne</surname> <given-names>C</given-names>
</name>
<name>
<surname>Divekar</surname> <given-names>SD</given-names>
</name>
<name>
<surname>Storchan</surname> <given-names>GB</given-names>
</name>
<name>
<surname>Parodi</surname> <given-names>DA</given-names>
</name>
<name>
<surname>Martin</surname> <given-names>MB</given-names>
</name>
</person-group>. <article-title>Metals and breast cancer</article-title>. <source>J Mammary Gland Biol Neoplasia</source>. (<year>2013</year>) <volume>18</volume>:<fpage>63</fpage>&#x2013;<lpage>73</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/S10911-013-9273-9/FIGURES/3</pub-id>
</citation>
</ref>
<ref id="B37">
<label>37</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Divekar</surname> <given-names>SD</given-names>
</name>
<name>
<surname>Storchan</surname> <given-names>GB</given-names>
</name>
<name>
<surname>Sperle</surname> <given-names>K</given-names>
</name>
<name>
<surname>Veselik</surname> <given-names>DJ</given-names>
</name>
<name>
<surname>Johnson</surname> <given-names>E</given-names>
</name>
<name>
<surname>Dakshanamurthy</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>The role of calcium in the activation of estrogen receptor-alpha</article-title>. <source>Cancer Res</source>. (<year>2011</year>) <volume>71</volume>:<page-range>1658&#x2013;68</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1158/0008-5472.CAN-10-1899/649463/AM/THE-ROLE-OF-CALCIUM-IN-THE-ACTIVATION-OF-ESTROGEN</pub-id>
</citation>
</ref>
<ref id="B38">
<label>38</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Martin</surname> <given-names>MB</given-names>
</name>
<name>
<surname>Reiter</surname> <given-names>R</given-names>
</name>
<name>
<surname>Pham</surname> <given-names>T</given-names>
</name>
<name>
<surname>Avellanet</surname> <given-names>YR</given-names>
</name>
<name>
<surname>Camara</surname> <given-names>J</given-names>
</name>
<name>
<surname>Lahm</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Estrogen-like activity of metals in mcf-7 breast cancer cells</article-title>. <source>Endocrinology</source>. (<year>2003</year>) <volume>144</volume>:<page-range>2425&#x2013;36</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1210/EN.2002-221054</pub-id>
</citation>
</ref>
<ref id="B39">
<label>39</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Johnson</surname> <given-names>MD</given-names>
</name>
<name>
<surname>Kenney</surname> <given-names>N</given-names>
</name>
<name>
<surname>Stoica</surname> <given-names>A</given-names>
</name>
<name>
<surname>Hilakivi-Clarke</surname> <given-names>L</given-names>
</name>
<name>
<surname>Singh</surname> <given-names>B</given-names>
</name>
<name>
<surname>Chepko</surname> <given-names>G</given-names>
</name>
<etal/>
</person-group>. <article-title>Cadmium mimics the <italic>in vivo</italic> effects of estrogen in the uterus and mammary gland</article-title>. <source>Nat Med</source>. (<year>2003</year>) <volume>9</volume>:<page-range>1081&#x2013;4</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nm902</pub-id>
</citation>
</ref>
<ref id="B40">
<label>40</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cyrus</surname> <given-names>K</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Sharawi</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Noguchi</surname> <given-names>G</given-names>
</name>
<name>
<surname>Kaushal</surname> <given-names>M</given-names>
</name>
<name>
<surname>Chang</surname> <given-names>T</given-names>
</name>
<etal/>
</person-group>. <article-title>Role of calcium in hormone-independent and -resistant breast cancer</article-title>. <source>Int J Cancer</source>. (<year>2021</year>) <volume>149</volume>:<page-range>1817&#x2013;27</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/IJC.33745</pub-id>
</citation>
</ref>
<ref id="B41">
<label>41</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xie</surname> <given-names>Yb</given-names>
</name>
<name>
<surname>Park</surname> <given-names>JH</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>DK</given-names>
</name>
<name>
<surname>Hwang</surname> <given-names>JH</given-names>
</name>
<name>
<surname>Oh</surname> <given-names>S</given-names>
</name>
<name>
<surname>Park</surname> <given-names>SB</given-names>
</name>
<etal/>
</person-group>. <article-title>Transcriptional corepressor SMILE recruits SIRT1 to inhibit nuclear receptor estrogen receptor-related receptor &#x3b3; Transactivation</article-title>. <source>J Biol Chem</source>. (<year>2009</year>) <volume>284</volume>:<page-range>28762&#x2013;74</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1074/JBC.M109.034165</pub-id>
</citation>
</ref>
<ref id="B42">
<label>42</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Riggins</surname> <given-names>RB</given-names>
</name>
<name>
<surname>Lan</surname> <given-names>JP-J</given-names>
</name>
<name>
<surname>Klimach</surname> <given-names>U</given-names>
</name>
<name>
<surname>Zwart</surname> <given-names>A</given-names>
</name>
<name>
<surname>Cavalli</surname> <given-names>LR</given-names>
</name>
<name>
<surname>Haddad</surname> <given-names>BR</given-names>
</name>
<etal/>
</person-group>. <article-title>ERR&#x3b3; Mediates tamoxifen resistance in novel models of invasive lobular breast cancer</article-title>. <source>Cancer Res</source>. (<year>2008</year>) <volume>68</volume>:<page-range>8908&#x2013;17</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1158/0008-5472.CAN-08-2669</pub-id>
</citation>
</ref>
<ref id="B43">
<label>43</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Fang</surname> <given-names>F</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Wong</surname> <given-names>C</given-names>
</name>
</person-group>. <article-title>Kaempferol is an estrogen-related receptor &#x3b1; and &#x3b3; inverse agonist</article-title>. <source>FEBS Lett</source>. (<year>2009</year>) <volume>583</volume>:<page-range>643&#x2013;7</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.febslet.2009.01.030</pub-id>
</citation>
</ref>
<ref id="B44">
<label>44</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Trott</surname> <given-names>O</given-names>
</name>
<name>
<surname>Olson</surname> <given-names>AJ</given-names>
</name>
</person-group>. <article-title>AutoDock Vina: improving the speed and accuracy of docking with a new scoring function, efficient optimization and multithreading</article-title>. <source>J Comput Chem</source>. (<year>2010</year>) <volume>31</volume>:<fpage>455</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/JCC.21334</pub-id>
</citation>
</ref>
<ref id="B45">
<label>45</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lin</surname> <given-names>YF</given-names>
</name>
<name>
<surname>Cheng</surname> <given-names>CW</given-names>
</name>
<name>
<surname>Shih</surname> <given-names>CS</given-names>
</name>
<name>
<surname>Hwang</surname> <given-names>JK</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>CS</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>CH</given-names>
</name>
</person-group>. <article-title>MIB: metal ion-binding site prediction and docking server</article-title>. <source>J Chem Inf Model</source>. (<year>2016</year>) <volume>56</volume>:<page-range>2287&#x2013;91</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1021/ACS.JCIM.6B00407</pub-id>
</citation>
</ref>
<ref id="B46">
<label>46</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Humphrey</surname> <given-names>W</given-names>
</name>
<name>
<surname>Dalke</surname> <given-names>A</given-names>
</name>
<name>
<surname>Schulten</surname> <given-names>K</given-names>
</name>
</person-group>. <article-title>VMD: Visual molecular dynamics</article-title>. <source>J Mol Graph</source>. (<year>1996</year>) <volume>14</volume>:<page-range>33&#x2013;8</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/0263-7855(96)00018-5</pub-id>
</citation>
</ref>
<ref id="B47">
<label>47</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>W</given-names>
</name>
<name>
<surname>Couldwell</surname> <given-names>WT</given-names>
</name>
<name>
<surname>Song</surname> <given-names>H</given-names>
</name>
<name>
<surname>Takano</surname> <given-names>T</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>JH</given-names>
</name>
<name>
<surname>Nedergaard</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Tamoxifen-induced enhancement of calcium signaling in glioma and MCF-7 breast cancer cells</article-title>. <source>Cancer Res</source>. (<year>2000</year>) <volume>60</volume>:<page-range>5395&#x2013;400</page-range>.</citation>
</ref>
<ref id="B48">
<label>48</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Estrada-Meza</surname> <given-names>J</given-names>
</name>
<name>
<surname>Videlo</surname> <given-names>J</given-names>
</name>
<name>
<surname>Bron</surname> <given-names>C</given-names>
</name>
<name>
<surname>Saint-B&#xe9;at</surname> <given-names>C</given-names>
</name>
<name>
<surname>Silva</surname> <given-names>M</given-names>
</name>
<name>
<surname>Duboeuf</surname> <given-names>F</given-names>
</name>
<etal/>
</person-group>. <article-title>Tamoxifen treatment in the neonatal period affects glucose homeostasis in adult mice in a sex-dependent manner</article-title>. <source>Endocrinology</source>. (<year>2021</year>) <volume>162</volume>:<fpage>1</fpage>&#x2013;<lpage>10</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1210/ENDOCR/BQAB098</pub-id>
</citation>
</ref>
<ref id="B49">
<label>49</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Miller</surname> <given-names>RA</given-names>
</name>
<name>
<surname>Birnbaum</surname> <given-names>MJ</given-names>
</name>
</person-group>. <article-title>Glucagon: acute actions on hepatic metabolism</article-title>. <source>Diabetologia</source>. (<year>2016</year>) <volume>59</volume>:<page-range>1376&#x2013;81</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/S00125-016-3955-Y/FIGURES/1</pub-id>
</citation>
</ref>
<ref id="B50">
<label>50</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tong</surname> <given-names>J</given-names>
</name>
<name>
<surname>McCarthy</surname> <given-names>Tv</given-names>
</name>
<name>
<surname>MacLennan</surname> <given-names>DH</given-names>
</name>
</person-group>. <article-title>Measurement of resting cytosolic ca2+ Concentrations and ca2+ Store size in HEK-293 cells transfected with Malignant hyperthermia or central core disease mutant ca2+ Release channels *</article-title>. <source>J Biol Chem</source>. (<year>1999</year>) <volume>274</volume>:<fpage>693</fpage>&#x2013;<lpage>702</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1074/JBC.274.2.693</pub-id>
</citation>
</ref>
<ref id="B51">
<label>51</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hentschke</surname> <given-names>M</given-names>
</name>
<name>
<surname>Schulze</surname> <given-names>C</given-names>
</name>
<name>
<surname>S&#xfc;sens</surname> <given-names>U</given-names>
</name>
<name>
<surname>Borgmeyer</surname> <given-names>U</given-names>
</name>
</person-group>. <article-title>Characterization of calmodulin binding to the orphan nuclear receptor ERR&#x3b3;</article-title>. <source>Biol Chem</source>. (<year>2003</year>) <volume>384</volume>(<issue>3</issue>):<page-range>473&#x2013;82</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1515/BC.2003.053</pub-id>
</citation>
</ref>
<ref id="B52">
<label>52</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wende</surname> <given-names>AR</given-names>
</name>
<name>
<surname>Huss</surname> <given-names>JM</given-names>
</name>
<name>
<surname>Schaeffer</surname> <given-names>PJ</given-names>
</name>
<name>
<surname>Gigu&#xe8;re</surname> <given-names>V</given-names>
</name>
<name>
<surname>Kelly</surname> <given-names>DP</given-names>
</name>
</person-group>. <article-title>PGC-1&#x3b1; Coactivates PDK4 gene expression via the orphan nuclear receptor ERR&#x3b1;: a mechanism for transcriptional control of muscle glucose metabolism</article-title>. <source>Mol Cell Biol</source>. (<year>2005</year>) <volume>25</volume>:<page-range>10684&#x2013;94</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/MCB.25.24.10684-10694.2005/ASSET/0C626C6C-7075-4D8D-BCE3-B96AF479CA12/ASSETS/GRAPHIC/ZMB0240555760009.JPEG</pub-id>
</citation>
</ref>
<ref id="B53">
<label>53</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Greschik</surname> <given-names>H</given-names>
</name>
<name>
<surname>Wurtz</surname> <given-names>JM</given-names>
</name>
<name>
<surname>Sanglier</surname> <given-names>S</given-names>
</name>
<name>
<surname>Bourguet</surname> <given-names>W</given-names>
</name>
<name>
<surname>van Dorsselaer</surname> <given-names>A</given-names>
</name>
<name>
<surname>Moras</surname> <given-names>D</given-names>
</name>
<etal/>
</person-group>. <article-title>Structural and functional evidence for ligand-independent transcriptional activation by the estrogen-related receptor 3</article-title>. <source>Mol Cell</source>. (<year>2002</year>) <volume>9</volume>:<page-range>303&#x2013;13</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S1097-2765(02)00444-6</pub-id>
</citation>
</ref>
<ref id="B54">
<label>54</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kim</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Koh</surname> <given-names>M</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>D-K</given-names>
</name>
<name>
<surname>Choi</surname> <given-names>H-S</given-names>
</name>
<name>
<surname>Park</surname> <given-names>SB</given-names>
</name>
</person-group>. <article-title>Efficient discovery of selective small molecule agonists of estrogen-related receptor &#x3b3; using combinatorial approach</article-title>. <source>J Comb Chem</source>. (<year>2009</year>) <volume>11</volume>:<page-range>928&#x2013;37</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1021/cc900081j</pub-id>
</citation>
</ref>
<ref id="B55">
<label>55</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yao</surname> <given-names>B</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>S</given-names>
</name>
<name>
<surname>Wei</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Tian</surname> <given-names>S</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Jin</surname> <given-names>L</given-names>
</name>
<etal/>
</person-group>. <article-title>Structural insights into the specificity of ligand binding and coactivator assembly by estrogen-related receptor &#x3b2;</article-title>. <source>J Mol Biol</source>. (<year>2020</year>) <volume>432</volume>:<page-range>5460&#x2013;72</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jmb.2020.08.007</pub-id>
</citation>
</ref>
<ref id="B56">
<label>56</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Egea</surname> <given-names>PF</given-names>
</name>
</person-group>. <article-title>Crystal structure of the human RXRalpha ligand-binding domain bound to its natural ligand: 9-cis retinoic acid</article-title>. <source>EMBO J</source>. (<year>2000</year>) <volume>19</volume>:<page-range>2592&#x2013;601</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/emboj/19.11.2592</pub-id>
</citation>
</ref>
<ref id="B57">
<label>57</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>L</given-names>
</name>
<name>
<surname>Zuercher</surname> <given-names>WJ</given-names>
</name>
<name>
<surname>Consler</surname> <given-names>TG</given-names>
</name>
<name>
<surname>Lambert</surname> <given-names>MH</given-names>
</name>
<name>
<surname>Miller</surname> <given-names>AB</given-names>
</name>
<name>
<surname>Orband-Miller</surname> <given-names>LA</given-names>
</name>
<etal/>
</person-group>. <article-title>X-ray crystal structures of the estrogen-related receptor-&#x3b3; Ligand binding domain in three functional states reveal the molecular basis of small molecule regulation *</article-title>. <source>J Biol Chem</source>. (<year>2006</year>) <volume>281</volume>:<page-range>37773&#x2013;81</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1074/JBC.M608410200</pub-id>
</citation>
</ref>
<ref id="B58">
<label>58</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Devarakonda</surname> <given-names>S</given-names>
</name>
<name>
<surname>Gupta</surname> <given-names>K</given-names>
</name>
<name>
<surname>Chalmers</surname> <given-names>MJ</given-names>
</name>
<name>
<surname>Hunt</surname> <given-names>JF</given-names>
</name>
<name>
<surname>Griffin</surname> <given-names>PR</given-names>
</name>
<name>
<surname>van Duyne</surname> <given-names>GD</given-names>
</name>
<etal/>
</person-group>. <article-title>Disorder-to-order transition underlies the structural basis for the assembly of a transcriptionally active PGC-1&#x3b1;/ERR&#x3b3; complex</article-title>. <source>Proc Natl Acad Sci U.S.A</source>. (<year>2011</year>) <volume>108</volume>:<page-range>18678&#x2013;83</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1073/PNAS.1113813108</pub-id>
</citation>
</ref>
<ref id="B59">
<label>59</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Matsushima</surname> <given-names>A</given-names>
</name>
<name>
<surname>Kakuta</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Teramoto</surname> <given-names>T</given-names>
</name>
<name>
<surname>Koshiba</surname> <given-names>T</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>X</given-names>
</name>
<name>
<surname>Okada</surname> <given-names>H</given-names>
</name>
<etal/>
</person-group>. <article-title>Structural evidence for endocrine disruptor bisphenol A binding to human nuclear receptor ERR&#x3b3;</article-title>. <source>J Biochem</source>. (<year>2007</year>) <volume>142</volume>:<page-range>517&#x2013;24</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/JB/MVM158</pub-id>
</citation>
</ref>
<ref id="B60">
<label>60</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cai</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>T</given-names>
</name>
<name>
<surname>Kamarajugadda</surname> <given-names>S</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>Regulation of glycolysis and the Warburg effect by estrogen-related receptors</article-title>. <source>Oncogene</source>. (<year>2013</year>) <volume>32</volume>:<page-range>2079&#x2013;86</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/onc.2012.221</pub-id>
</citation>
</ref>
<ref id="B61">
<label>61</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Herzog</surname> <given-names>B</given-names>
</name>
<name>
<surname>Cardenas</surname> <given-names>J</given-names>
</name>
<name>
<surname>Hall</surname> <given-names>RK</given-names>
</name>
<name>
<surname>Villena</surname> <given-names>JA</given-names>
</name>
<name>
<surname>Budge</surname> <given-names>PJ</given-names>
</name>
<name>
<surname>Gigu&#xe8;re</surname> <given-names>V</given-names>
</name>
<etal/>
</person-group>. <article-title>Estrogen-related receptor &#x3b1; Is a repressor of phosphoenolpyruvate carboxykinase gene transcription *</article-title>. <source>J Biol Chem</source>. (<year>2006</year>) <volume>281</volume>:<fpage>99</fpage>&#x2013;<lpage>106</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1074/JBC.M509276200</pub-id>
</citation>
</ref>
<ref id="B62">
<label>62</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hentschke</surname> <given-names>M</given-names>
</name>
<name>
<surname>S&#xfc;sens</surname> <given-names>U</given-names>
</name>
<name>
<surname>Borgmeyer</surname> <given-names>U</given-names>
</name>
</person-group>. <article-title>PGC-1 and PERC, coactivators of the estrogen receptor-related receptor &#x3b3;</article-title>. <source>Biochem Biophys Res Commun</source>. (<year>2002</year>) <volume>299</volume>:<page-range>872&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S0006-291X(02)02753-5</pub-id>
</citation>
</ref>
<ref id="B63">
<label>63</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Torres-Padilla</surname> <given-names>ME</given-names>
</name>
<name>
<surname>Sladek</surname> <given-names>FM</given-names>
</name>
<name>
<surname>Weiss</surname> <given-names>MC</given-names>
</name>
</person-group>. <article-title>Developmentally regulated N-terminal variants of the nuclear receptor hepatocyte nuclear factor 4&#x3b1; Mediate multiple interactions through coactivator and corepressor-histone deacetylase complexes</article-title>. <source>J Biol Chem</source>. (<year>2002</year>) <volume>277</volume>:<page-range>44677&#x2013;87</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1074/jbc.M207545200</pub-id>
</citation>
</ref>
<ref id="B64">
<label>64</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Giangrande</surname> <given-names>PH</given-names>
</name>
<name>
<surname>Pollio</surname> <given-names>G</given-names>
</name>
<name>
<surname>McDonnell</surname> <given-names>DP</given-names>
</name>
</person-group>. <article-title>Mapping and characterization of the functional domains responsible for the differential activity of the A and B isoforms of the human progesterone receptor</article-title>. <source>J Biol Chem</source>. (<year>1997</year>) <volume>272</volume>:<page-range>32889&#x2013;900</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1074/jbc.272.52.32889</pub-id>
</citation>
</ref>
<ref id="B65">
<label>65</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hill</surname> <given-names>KK</given-names>
</name>
<name>
<surname>Roemer</surname> <given-names>SC</given-names>
</name>
<name>
<surname>Churchill</surname> <given-names>MEA</given-names>
</name>
<name>
<surname>Edwards</surname> <given-names>DP</given-names>
</name>
</person-group>. <article-title>Structural and functional analysis of domains of the progesterone receptor</article-title>. <source>Mol Cell Endocrinol</source>. (<year>2012</year>) <volume>348</volume>:<page-range>418&#x2013;29</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.mce.2011.07.017</pub-id>
</citation>
</ref>
<ref id="B66">
<label>66</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Savkur</surname> <given-names>RS</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Bramlett</surname> <given-names>KS</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>M</given-names>
</name>
<name>
<surname>Yao</surname> <given-names>S</given-names>
</name>
<name>
<surname>Perkins</surname> <given-names>D</given-names>
</name>
<etal/>
</person-group>. <article-title>Alternative splicing within the ligand binding domain of the human constitutive androstane receptor</article-title>. <source>Mol Genet Metab</source>. (<year>2003</year>) <volume>80</volume>:<page-range>216&#x2013;26</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/J.YMGME.2003.08.013</pub-id>
</citation>
</ref>
<ref id="B67">
<label>67</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Maruyama</surname> <given-names>K</given-names>
</name>
<name>
<surname>Endoh</surname> <given-names>H</given-names>
</name>
<name>
<surname>Sasaki-Iwaoka</surname> <given-names>H</given-names>
</name>
<name>
<surname>Kanou</surname> <given-names>H</given-names>
</name>
<name>
<surname>Shimaya</surname> <given-names>E</given-names>
</name>
<name>
<surname>Hashimoto</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>A novel isoform of rat estrogen receptor beta with 18 amino acid insertion in the ligand binding domain as a putative dominant negative regulator of estrogen action</article-title>. <source>Biochem Biophys Res Commun</source>. (<year>1998</year>) <volume>246</volume>:<page-range>142&#x2013;7</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1006/BBRC.1998.8590</pub-id>
</citation>
</ref>
<ref id="B68">
<label>68</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Godt</surname> <given-names>J</given-names>
</name>
<name>
<surname>Scheidig</surname> <given-names>F</given-names>
</name>
<name>
<surname>Grosse-Siestrup</surname> <given-names>C</given-names>
</name>
<name>
<surname>Esche</surname> <given-names>V</given-names>
</name>
<name>
<surname>Brandenburg</surname> <given-names>P</given-names>
</name>
<name>
<surname>Reich</surname> <given-names>A</given-names>
</name>
<etal/>
</person-group>. <article-title>The toxicity of cadmium and resulting hazards for human health</article-title>. <source>J Occup Med Toxicol</source>. (<year>2006</year>) <volume>1</volume>:<elocation-id>22</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/1745-6673-1-22</pub-id>
</citation>
</ref>
<ref id="B69">
<label>69</label>
<citation citation-type="web">
<article-title>Is Cadmium a Cause of Human Pancreatic Cancer?1 | Cancer Epidemiology, Biomarkers &amp; Prevention | American Association for Cancer Research</article-title>. (<year>2000</year>) <volume>19</volume>:<page-range>139-145</page-range>. Available online at: <uri xlink:href="https://aacrjournals.org/cebp/article/9/2/139/180349/Is-Cadmium-a-Cause-of-Human-Pancreatic-Cancer-1">https://aacrjournals.org/cebp/article/9/2/139/180349/Is-Cadmium-a-Cause-of-Human-Pancreatic-Cancer-1</uri>.</citation>
</ref>
<ref id="B70">
<label>70</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Luckett</surname> <given-names>BG</given-names>
</name>
<name>
<surname>Su</surname> <given-names>LJ</given-names>
</name>
<name>
<surname>Rood</surname> <given-names>JC</given-names>
</name>
<name>
<surname>Fontham</surname> <given-names>ETH</given-names>
</name>
</person-group>. <article-title>Cadmium exposure and pancreatic cancer in South Louisiana</article-title>. <source>J Environ Public Health</source>. (<year>2012</year>) <volume>2012</volume>:<page-range>180186</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1155/2012/180186</pub-id>
</citation>
</ref>
<ref id="B71">
<label>71</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Qu</surname> <given-names>W</given-names>
</name>
<name>
<surname>Tokar</surname> <given-names>EJ</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>AJ</given-names>
</name>
<name>
<surname>Bell</surname> <given-names>MW</given-names>
</name>
<name>
<surname>Waalkes</surname> <given-names>MP</given-names>
</name>
</person-group>. <article-title>Chronic cadmium exposure <italic>in vitro</italic> causes acquisition of multiple tumor cell characteristics in human pancreatic epithelial cells</article-title>. <source>Environ Health Perspect</source>. (<year>2012</year>) <volume>120</volume>:<page-range>1265&#x2013;71</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1289/EHP.1205082</pub-id>
</citation>
</ref>
<ref id="B72">
<label>72</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>da Cunha</surname> <given-names>KA</given-names>
</name>
<name>
<surname>Magalh&#xe3;es</surname> <given-names>EIDS</given-names>
</name>
<name>
<surname>Loureiro</surname> <given-names>LMR</given-names>
</name>
<name>
<surname>Sant&#x2019;Ana</surname> <given-names>LFDR</given-names>
</name>
<name>
<surname>Ribeiro</surname> <given-names>AQ</given-names>
</name>
<name>
<surname>De Novaes</surname> <given-names>JF</given-names>
</name>
</person-group>. <article-title>Calcium intake, serum vitamin D and obesity in children: is there an association</article-title>? <source>Rev Paulista Pediatria</source>. (<year>2015</year>) <volume>33</volume>:<page-range>222&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/J.RPPED.2015.03.001</pub-id>
</citation>
</ref>
<ref id="B73">
<label>73</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Xue</surname> <given-names>H</given-names>
</name>
<name>
<surname>Bao</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Luo</surname> <given-names>J</given-names>
</name>
<name>
<surname>Tian</surname> <given-names>G</given-names>
</name>
<etal/>
</person-group>. <article-title>Association between dietary calcium/dairy intakes and overweight/obesity</article-title>. <source>Wei Sheng Yan Jiu</source>. (<year>2016</year>) <volume>45</volume>:<page-range>402&#x2013;8</page-range>.</citation>
</ref>
<ref id="B74">
<label>74</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shahar</surname> <given-names>DR</given-names>
</name>
<name>
<surname>Schwarzfuchs</surname> <given-names>D</given-names>
</name>
<name>
<surname>Fraser</surname> <given-names>D</given-names>
</name>
<name>
<surname>Vardi</surname> <given-names>H</given-names>
</name>
<name>
<surname>Thiery</surname> <given-names>J</given-names>
</name>
<name>
<surname>Fiedler</surname> <given-names>GM</given-names>
</name>
<etal/>
</person-group>. <article-title>Dairy calcium intake, serum vitamin D, and successful weight loss</article-title>. <source>Am J Clin Nutr</source>. (<year>2010</year>) <volume>92</volume>:<page-range>1017&#x2013;22</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.3945/AJCN.2010.29355</pub-id>
</citation>
</ref>
</ref-list>
<glossary>
<title>Glossary</title>
<def-list>
<def-item>
<term>DAPI</term>
<def>
<p>4, 6-diamidino-2-phenylindole</p>
</def>
</def-item>
<def-item>
<term>PFKL</term>
<def>
<p>6-phosphofructokinase, liver type</p>
</def>
</def-item>
<def-item>
<term>BPA</term>
<def>
<p>bisphenol A</p>
</def>
</def-item>
<def-item>
<term>CCS</term>
<def>
<p>charcoal stripped calf serum</p>
</def>
</def-item>
<def-item>
<term>CAT</term>
<def>
<p>chloramphenicol acetyltransferase</p>
</def>
</def-item>
<def-item>
<term>ChIP</term>
<def>
<p>chromatin immunoprecipitation Assay</p>
</def>
</def-item>
<def-item>
<term>DBD</term>
<def>
<p>DNA binding domain</p>
</def>
</def-item>
<def-item>
<term>DMEM</term>
<def>
<p>Dulbecco's Modified Eagle's Medium</p>
</def>
</def-item>
<def-item>
<term>ERR&#x3b3;1</term>
<def>
<p>ERR&#x3b3; splice variant 1</p>
</def>
</def-item>
<def-item>
<term>ERR&#x3b3;2</term>
<def>
<p>ERR&#x3b3; splice variant 2</p>
</def>
</def-item>
<def-item>
<term>ERR&#x3b3;3</term>
<def>
<p>ERR&#x3b3; splice variant 3</p>
</def>
</def-item>
<def-item>
<term>ER&#x3b1;</term>
<def>
<p>estrogen receptor &#x3b1;</p>
</def>
</def-item>
<def-item>
<term>ERR&#x3b3;</term>
<def>
<p>estrogen-related receptor &#x3b3;</p>
</def>
</def-item>
<def-item>
<term>ERR</term>
<def>
<p>estrogen-related receptor</p>
</def>
</def-item>
<def-item>
<term>ERRE</term>
<def>
<p>estrogen-related response elements</p>
</def>
</def-item>
<def-item>
<term>FBS</term>
<def>
<p>fetal bovine serum</p>
</def>
</def-item>
<def-item>
<term>GSEA</term>
<def>
<p>gene set enrichment analysis</p>
</def>
</def-item>
<def-item>
<term>G6PC</term>
<def>
<p>glucose-6-phosphatase</p>
</def>
</def-item>
<def-item>
<term>HBSS</term>
<def>
<p>Hanks' balanced salt solution</p>
</def>
</def-item>
<def-item>
<term>HK2</term>
<def>
<p>hexokinase 2</p>
</def>
</def-item>
<def-item>
<term>H6PD</term>
<def>
<p>hexose-6-phosphate dehydrogenase</p>
</def>
</def-item>
<def-item>
<term>IMEM</term>
<def>
<p>improved minimal essential medium</p>
</def>
</def-item>
<def-item>
<term>IP3R</term>
<def>
<p>inositol 1,4,5 trisphosphate receptor</p>
</def>
</def-item>
<def-item>
<term>LDHA</term>
<def>
<p>lactate dehydrogenase A</p>
</def>
</def-item>
<def-item>
<term>LBD</term>
<def>
<p>ligand-binding domain</p>
</def>
</def-item>
<def-item>
<term>MDH2</term>
<def>
<p>malate dehydrogenase 2</p>
</def>
</def-item>
<def-item>
<term>PGC-1&#x3b1;</term>
<def>
<p>peroxisome proliferator-activated receptor-gamma coactivator 1&#x3b1;</p>
</def>
</def-item>
<def-item>
<term>PEPCK</term>
<def>
<p>phosphoenolpyruvate carboxykinase</p>
</def>
</def-item>
<def-item>
<term>PDK4</term>
<def>
<p>pyruvate dehydrogenase kinase 4</p>
</def>
</def-item>
<def-item>
<term>PK</term>
<def>
<p>pyruvate kinase</p>
</def>
</def-item>
<def-item>
<term>RIPA</term>
<def>
<p>radioimmunoprecipitation assay</p>
</def>
</def-item>
<def-item>
<term>real-time qPCR</term>
<def>
<p>real-time quantitative polymerase chain reaction</p>
</def>
</def-item>
<def-item>
<term>RPLP0</term>
<def>
<p>ribosomal protein P0</p>
</def>
</def-item>
<def-item>
<term>RMSF</term>
<def>
<p>root mean square fluctuation</p>
</def>
</def-item>
<def-item>
<term>SLC2A1</term>
<def>
<p>solute carrier family 2 member 1</p>
</def>
</def-item>
<def-item>
<term>SLC2A2</term>
<def>
<p>solute carrier family 2 member 2</p>
</def>
</def-item>
</def-list>
</glossary>
</back>
</article>