<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Endocrinol.</journal-id>
<journal-title>Frontiers in Endocrinology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Endocrinol.</abbrev-journal-title>
<issn pub-type="epub">1664-2392</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fendo.2023.1226808</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Endocrinology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>AN1284 attenuates steatosis, lipogenesis, and fibrosis in mice with pre-existing non-alcoholic steatohepatitis and directly affects aryl hydrocarbon receptor in a hepatic cell line</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Yehezkel</surname>
<given-names>Adi S.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Abudi</surname>
<given-names>Nathalie</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Nevo</surname>
<given-names>Yuval</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Benyamini</surname>
<given-names>Hadar</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Elgavish</surname>
<given-names>Sharona</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Weinstock</surname>
<given-names>Marta</given-names>
</name>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Abramovitch</surname>
<given-names>Rinat</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2320150"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>The Goldyne Savad Institute of Gene Therapy, Hadassah Medical Center, Faculty of Medicine, Hebrew University of Jerusalem</institution>, <addr-line>Jerusalem</addr-line>, <country>Israel</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>The Wohl Institute for Translational Medicine, Hadassah  Medical Center</institution>, <addr-line>Jerusalem</addr-line>, <country>Israel</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Info-CORE, Bioinformatics Unit of the I-CORE at the Hebrew University of Jerusalem</institution>, <addr-line>Jerusalem</addr-line>, <country>Israel</country>
</aff>
<aff id="aff4">
<sup>4</sup>
<institution>Faculty of Medicine, School of Pharmacy, Institute for Drug Research, Hebrew University</institution>, <addr-line>Jerusalem</addr-line>, <country>Israel</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Amanda Brandon, The University of Sydney, Australia</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Shunxing Rong, University of Texas Southwestern Medical Center, United States; Loranne Agius, Newcastle University, United Kingdom</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Rinat Abramovitch, <email xlink:href="mailto:rinat@hadassah.org.il">rinat@hadassah.org.il</email>; Marta Weinstock, <email xlink:href="mailto:martar@ekmd.huji.ac.il">martar@ekmd.huji.ac.il</email>
</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>16</day>
<month>08</month>
<year>2023</year>
</pub-date>
<pub-date pub-type="collection">
<year>2023</year>
</pub-date>
<volume>14</volume>
<elocation-id>1226808</elocation-id>
<history>
<date date-type="received">
<day>22</day>
<month>05</month>
<year>2023</year>
</date>
<date date-type="accepted">
<day>19</day>
<month>07</month>
<year>2023</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2023 Yehezkel, Abudi, Nevo, Benyamini, Elgavish, Weinstock and Abramovitch</copyright-statement>
<copyright-year>2023</copyright-year>
<copyright-holder>Yehezkel, Abudi, Nevo, Benyamini, Elgavish, Weinstock and Abramovitch</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>Non-alcoholic steatohepatitis (NASH) is an aggressive form of fatty liver disease with hepatic inflammation and fibrosis for which there is currently no drug treatment. This study determined whether an indoline derivative, AN1284, which significantly reduced damage in a model of acute liver disease, can reverse steatosis and fibrosis in mice with pre-existing NASH and explore its mechanism of action. The mouse model of dietary-induced NASH reproduces most of the liver pathology seen in human subjects. This was confirmed by RNA-sequencing analysis. The Western diet, given for 4 months, caused steatosis, inflammation, and liver fibrosis. AN1284 (1 mg or 5 mg/kg/day) was administered for the last 2 months of the diet by micro-osmotic-pumps (mps). Both doses significantly decreased hepatic damage, liver weight, hepatic fat content, triglyceride, serum alanine transaminase, and fibrosis. AN1284 (1 mg/kg/day) given by mps or in the drinking fluid significantly reduced fibrosis produced by carbon tetrachloride injections. In human HUH7 hepatoma cells incubated with palmitic acid, AN1284 (2.1 and 6.3 ng/ml), concentrations compatible with those in the liver of mice treated with AN1284, decreased lipid formation by causing nuclear translocation of the aryl hydrocarbon receptor (AhR). AN1284 downregulated fatty acid synthase (FASN) and sterol regulatory element-binding protein 1c (SREBP-1c) and upregulated Acyl-CoA Oxidase 1 and Cytochrome P450-a1, genes involved in lipid metabolism. In conclusion, chronic treatment with AN1284 (1mg/kg/day) reduced pre-existing steatosis and fibrosis through AhR, which affects several contributors to the development of fatty liver disease. Additional pathways are also influenced by AN1284 treatment.</p>
</abstract>
<kwd-group>
<kwd>aryl hydrocarbon receptor</kwd>
<kwd>nuclear receptors</kwd>
<kwd>oxidative stress</kwd>
<kwd>retinoid X receptor</kwd>
<kwd>RNA-sequencing analysis</kwd>
<kwd>fatty acid synthase</kwd>
</kwd-group>
<counts>
<fig-count count="7"/>
<table-count count="2"/>
<equation-count count="0"/>
<ref-count count="46"/>
<page-count count="14"/>
<word-count count="5936"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Obesity</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>Non-alcoholic steatohepatitis (NASH) is an aggressive form of non-alcoholic fatty liver disease (NAFLD) with an excess of fatty acids and triglycerides, lobular inflammation, hepatocyte injury, and fibrosis (<xref ref-type="bibr" rid="B1">1</xref>), accompanied by insulin resistance and oxidative stress (<xref ref-type="bibr" rid="B2">2</xref>). Insulin resistance promotes lipogenesis through an influx from adipose tissue of free fatty acids (FFAs) into the liver. Oxidative stress impairs fatty acid oxidation, compromising the liver&#x2019;s ability to use, store, and export FFAs as triglycerides (<xref ref-type="bibr" rid="B3">3</xref>). This causes apoptosis to hepatocytes through activation of signal-regulating kinase, which upregulates MAP kinases JNK and p38 (<xref ref-type="bibr" rid="B4">4</xref>). Cell damage stimulates hepatic stellate cells to produce TGF-&#x3b2; that induces fibrosis by activating myofibroblasts (<xref ref-type="bibr" rid="B5">5</xref>). Other cytokines are produced by FFAs (<xref ref-type="bibr" rid="B6">6</xref>) through stimulation of Toll-4-like receptors on Kupffer cells and circulating leukocytes (<xref ref-type="bibr" rid="B7">7</xref>) and by the bacterial antigen, lipopolysaccharide (LPS). The concentrations of LPS in the circulation and liver of subjects with NASH are higher than those in controls (<xref ref-type="bibr" rid="B8">8</xref>).</p>
<p>Most compounds tested in rodent models of NAFLD or NASH (<xref ref-type="bibr" rid="B9">9</xref>&#x2013;<xref ref-type="bibr" rid="B13">13</xref>) (among others) were given with the initiation of the high-fat Western diet (WD), and thus, any effect they had is mainly preventive. A few compounds, each with a different mode of action, were able to ameliorate steatosis when given to mice several weeks after commencement of the diet: Firsocostat, an acetyl-CoA carboxylase (ACC) inhibitor, Tropifexor, an agonist of Farnesoid X receptor (FXR), and cinnabarinic acid, an endogenous agonist of the aryl hydrocarbon receptor (AhR) (<xref ref-type="bibr" rid="B14">14</xref>, <xref ref-type="bibr" rid="B15">15</xref>). Firsocostat and Tropifexor arrested the development of fibrosis (<xref ref-type="bibr" rid="B15">15</xref>). Although all these drugs reduced steatosis in human subjects with NASH, they had no effect on fibrosis (<xref ref-type="bibr" rid="B16">16</xref>). Neither did the novel dual proliferator-activated receptor (PPAR) agonist Saroglitazar (<xref ref-type="bibr" rid="B17">17</xref>), although it had fewer adverse effects than other PPAR agonists in humans (<xref ref-type="bibr" rid="B18">18</xref>). Thus, there is still a need for safe, clinically effective drugs for treating NASH that can also halt development of fibrosis. The pathophysiology of NASH is complex and probably requires activation of multiple targets for more successful treatment against fibrosis (<xref ref-type="bibr" rid="B19">19</xref>).</p>
<p>AN1284 [3-(indolin-1-yl)-N-isopropylpropan-1-amine 2HCl] is a novel drug with multiple actions. It inhibited cytotoxicity resulting from oxidative stress and reduced the release of pro-inflammatory cytokines in LPS-activated macrophages (<xref ref-type="bibr" rid="B20">20</xref>) by inhibiting phosphorylation of p38 MAPK and nuclear translocation of Activator protein-1 (<xref ref-type="bibr" rid="B21">21</xref>). In mice with acute liver injury caused by LPS/D-galactosamine injection, s.c. injection of AN1284 (0.25&#x2013;0.75 mg/kg) prevented the elevation of TNF-&#x3b1; and plasma alanine transaminase (ALT) and reduced hepatic damage and mortality (<xref ref-type="bibr" rid="B21">21</xref>). Chronic treatment of BSK-db/db mice with type 2 diabetes by AN1284 (2.5 and 5 mg/kg/day) by s.c. implanted micro-osmotic-pumps (mps) before disease development prevented renal damage and reduced elevation of plasma ALT and hepatic fat accumulation, while preserving insulin sensitivity and pancreatic &#x3b2; cell mass (<xref ref-type="bibr" rid="B22">22</xref>).</p>
<p>The current study examined the effect of AN1284 (1 and 5 mg/kg/day) administered for 2 months by mps, on hepatic steatosis and fibrosis in mice with pre-existing NASH. This was produced by feeding for 4 months on a modified low-trans-fat Western-diet combined with low choline. RNA sequencing analysis (RNA-seq) confirmed that diet replicated several changes in cellular processes seen in humans with NASH. HUH7 human hepatoma cells were used to show that AN1284 decreased conversion of palmitic acid (PA) to lipid at concentrations compatible with those found in the liver in mice and to elucidate its mechanism of action.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<label>2</label>
<title>Materials and methods</title>
<sec id="s2_1">
<label>2.1</label>
<title>
<italic>In vivo</italic> NASH studies in mice on WD</title>
<p>Experiments were performed according to the guidelines of the Animal Care and Use Committee of the Hebrew University (NIH approval number OPRR-A01-5011). Male C57BL/6JOlaHsd mice, aged 4 weeks for NASH experiments and 6 weeks for the CCl<sub>4</sub> fibrosis model (Harlan; Ein Kerem, Israel), were housed (five per cage), in a pathogen-free unit under controlled 12-h light/12-h dark cycle and an ambient temperature of 21 &#xb1; 1&#xb0;C and humidity 40%&#x2013;50%. The cages contained Teklad Sani-chips (ENVIGO) bedding and two 2" small play tunnels for environmental enrichment. Male mice were selected because they develop a more severe form of the disease than females and have lower antioxidant enzymes (<xref ref-type="bibr" rid="B23">23</xref>).</p>
<p>The normal diet (ND) consisted of Teklad 2918SC radiated pellets (ENVIGO) containing 13.9% kcal from fat, 62.9% from carbohydrates, and 23.1% from protein. The modified WD (Envigo-Teklad TD.150235) had 50.5% kcal fat [trans-fat (12% of fatty acids) and saturated fat (50% of fatty acids)], 38% carbohydrates and 11.5% protein, 20% sucrose, 10% fructose, and 1.25% cholesterol with reduced choline (900 mg/kg). This diet, modified from the WD described in Farrell et&#xa0;al. (<xref ref-type="bibr" rid="B24">24</xref>), caused hepatic steatosis in mice after 1 month (<xref ref-type="supplementary-material" rid="SM1">
<bold>Figure S1B</bold>
</xref>) and inflammation and fibrosis within 4 months.</p>
<p>The mice were maintained for 2 months on WD (<italic>n</italic> = 30) or ND (<italic>n</italic> = 15) and weighed twice weekly. Then, under ketamine 100 mg/kg/xylazine 10 mg/kg anesthesia, they were implanted with mps delivering saline, or AN1284 (1 or 5 mg/kg/day)/month (ND <italic>n</italic> = 5/dose) (WD <italic>n</italic> = 10/dose) for the next 2 months (<xref ref-type="supplementary-material" rid="SM1">
<bold>Figure S1A</bold>
</xref>). A new pump was implanted under anesthesia in the second month. In a previous study, there were no significant differences in the effects of 2.5 and 5 mg/kg/day of AN1284 on the parameters measured in diabetic mice (<xref ref-type="bibr" rid="B22">22</xref>). Therefore, in the current study, we administered 1 and 5 mg/kg/day. At the end of the experiment, blood was collected by cardiac puncture under ketamine/xylazine anesthesia, and the livers were excised, weighed, and prepared for histological, cytological, biochemical, and molecular analyses.</p>
</sec>
<sec id="s2_2">
<label>2.2</label>
<title>Induction of liver fibrosis by carbon tetrachloride</title>
<p>Mice (<italic>n</italic> = 25) that were fed with ND were injected i.p. with carbon tetrachloride (CCl<sub>4</sub>) (0.5 mg/kg in corn oil) (Sigma), twice weekly for 7 weeks. Four controls were injected with saline (1 ml/kg). Four weeks later, five mice injected with CCl<sub>4</sub> were sacrificed and the livers were examined to confirm the presence of fibrosis. The remaining eight mice were given saline by s.c. injection and seven others were implanted with mps delivering AN1284 (1 mg/kg/day) for 3 weeks.</p>
<p>While the current study was in progress, we completed an examination of the pharmacokinetics and metabolism of AN1284 in mice. Peak drug concentrations were similar in plasma and liver after s.c. injection, but nearly 50-fold higher in the liver when the compound was given orally (<xref ref-type="bibr" rid="B25">25</xref>). This suggested that oral administration should enable AN1284 to reduce hepatic damage. Therefore, AN1284 (1 mg/kg/day) was given to eight mice (four per cage) for 3 weeks via the drinking fluid, 4 weeks after they had developed fibrosis induced by CCl<sub>4</sub> injections. Ten others received normal drinking fluid. They were weighed once weekly, their fluid intake was measured twice weekly, and the concentration of AN1284 in the fluid was adjusted accordingly. Seven weeks after commencement of the CCl<sub>4</sub> injections, the mice were processed for histological and biochemical analyses as described below.</p>
</sec>
<sec id="s2_3">
<label>2.3</label>
<title>Biochemical and histological analyses</title>
<p>The livers were extracted as described in Ref (<xref ref-type="bibr" rid="B26">26</xref>). and their triglyceride content was determined using the Cobas C-111 bio-analyzer (Roche, Switzerland), normalized to wet tissue weight. Plasma ALT was measured by Reflotron chemical blood analyzer (Roche Diagnostics, Mannheim, Germany). Frozen liver was placed in an embedding medium and used for the measurement of hepatic fat content by Oil Red O (ORO) staining. The rest of the liver was fixed for 24&#xa0;h in 4% formaldehyde solution (Bio-Heart Ltd., Jerusalem, Israel), induced in 70% ethanol and embedded in paraffin, cut into 5-&#xb5;m slices, and stained with hematoxylin and eosin (H&amp;E) for general damage. Fibrosis was assessed with Sirius Red (SR) (Sigma, 365548), collagen 4 (Col4) (Abcam, ab236640), and immunohistochemical staining with primary antibodies against &#x3b1;-SMA (Sigma, A2547). Antibodies against Ly6B (Bio-Rad, MCA771) were used for neutrophils and natural killer cells, F4/80 for macrophages (Bio-Rad, MCA497), CD3 for T cells (Bio-Rad, MCA1477), CD45R for B cells (Santa Cruz, sc-19597),   CD36 (Abcam, ab133625), and iNOS (Abcam, ab3523). Histopathological analysis was performed by a light microscope using the program Cellsens Entry (Olympus, Japan). Macrophages, ORO, &#x3b1;-SMA, and SR were quantified in 12 random images at &#xd7;40 magnification. Using the ImageJ software, the colored area was calculated, normalized, and expressed as a percentage of the whole picture.</p>
</sec>
<sec id="s2_4">
<label>2.4</label>
<title>Quantitative polymerase chain reaction</title>
<p>RNA was extracted from snap-frozen liver tissues (miRNeasy Micro Kit, Qiagen), from six samples/group. Its quantity and integrity were checked (Nanodrop, spectrophotometer) and reverse-transcribed into complementary DNA (qScript cDNA Synthesis Kit, QuantaBio). Genes were determined by PCR with an SYBR Green Kit and (QuantaBio) on the CFX384 Touch Real-Time PCR Detection System (Bio-Rad). The relative expression of target genes was normalized by hydroxyl methyl bilane synthase expression as an internal control. The primer sequences used are listed in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>A. Mouse primer sequences used for qPCR.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Gene</th>
<th valign="top" align="center">5&#x2019; primer</th>
<th valign="top" align="center">3&#x2019; primer</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">HMBS</td>
<td valign="top" align="left">ACTATTGGAGCCATCTGCAAAC</td>
<td valign="top" align="left">CTCTCCTCAGAGAGCTGGTTC</td>
</tr>
<tr>
<td valign="top" align="left">TNF-&#x3b1;</td>
<td valign="top" align="left">GAAAAGCAAGCAGCCAACCA</td>
<td valign="top" align="left">CGGATCATGCTTTCTGTGCTC</td>
</tr>
<tr>
<td valign="top" align="left">IL-10</td>
<td valign="top" align="left">GGTTGCCAAGCCTTATCGGA</td>
<td valign="top" align="left">ACCTGCTCCACTGCCTTGCT</td>
</tr>
<tr>
<td valign="top" align="left">CCL2 (MCP-1)</td>
<td valign="top" align="left">AAGCCAGCTCTCTCTTCCTCCA</td>
<td valign="top" align="left">GCGTTAACTGCATCTGGCTGA</td>
</tr>
<tr>
<td valign="top" align="left">FASN</td>
<td valign="top" align="left">CCCCTCTGTTAATTGGCTCC</td>
<td valign="top" align="left">TTGTGGAAGTGCAGGTTAGG</td>
</tr>
<tr>
<td valign="top" align="left">PLG</td>
<td valign="top" align="left">ACAGGCACAGCATCTTCACC</td>
<td valign="top" align="left">CATCTGGGTTTCGGCAGTAGTTC</td>
</tr>
<tr>
<td valign="top" align="left">IL-6</td>
<td valign="top" align="left">ATACCACTCCCAACAGACCTGTCT</td>
<td valign="top" align="left">CAGAATTGCCATTGCACAACTC</td>
</tr>
<tr>
<td valign="top" align="left">TGF-&#x3b2;1</td>
<td valign="top" align="left">ACCAACTATTGCTTCAGCTTACGCTCCAC</td>
<td valign="top" align="left">GATCCACTTCCAACCCAGGTC</td>
</tr>
</tbody>
</table>
</table-wrap>
<table-wrap id="T1b" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>B. Human primer sequences used for qPCR.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<td valign="top" align="left">Gene</td>
<td valign="top" align="center">5&#x2019; primer</td>
<td valign="top" align="center">3&#x2019; primer</td>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">HPRT</td>
<td valign="top" align="left">GGACAGGACTGAACGTCTTGC</td>
<td valign="top" align="left">CAACACTTCGTGGGGTCCTT</td>
</tr>
<tr>
<td valign="top" align="left">FASN</td>
<td valign="top" align="left">CAAGCTGAAGGACCTGTCTAG</td>
<td valign="top" align="left">CGGAGTGAATCTGGGTTGATG</td>
</tr>
<tr>
<td valign="top" align="left">ACOX1</td>
<td valign="top" align="left">ACTCGCAGCCAGCGTTAT</td>
<td valign="top" align="left">AGGGTCAGCGATGCCAAAC</td>
</tr>
<tr>
<td valign="top" align="left">CYP1a1</td>
<td valign="top" align="left">ACATGCTGACCCTGGGAAAG</td>
<td valign="top" align="left">GGTGTGGAGCCAATTCGGAT</td>
</tr>
<tr>
<td valign="top" align="left">SREBP-1C</td>
<td valign="top" align="left">CTACCGCTCCTCCATCAATG</td>
<td valign="top" align="left">CTTGAGTTTCTGGTTGCTGTG</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_5">
<label>2.5</label>
<title>RNA sequencing analysis</title>
<p>For RNA-Seq analysis, an Illumina Hi-seq sequencer was used to measure the differences in global gene expression between the experimental groups. Each sample generated approximately 70 &#xd7; 10<sup>6</sup> reads at the length of 86 bases. Differential expression data of the whole transcriptome was subjected to Gene Set Enrichment Analysis (GSEA) with the corresponding human ortholog gene symbols. GSEA uses all differential expression data (cutoff independent) to determine whether a priori-defined set of genes show statistically significant, concordant differences between two biological states. The hallmark gene set collection from MSigDB (molecular signature database) was used for the analysis. For each comparison, all statistically significant, differentially expressed genes were subjected to pathway enrichment analysis using QIAGEN&#x2019;s ingenuity pathway analysis (IPA, QIAGEN Redwood City, <ext-link ext-link-type="uri" xlink:href="http://www.qiagen.com/ingenuity">www.qiagen.com/ingenuity</ext-link>), GeneAnalytics and EnrichR, and functions/diseases enrichment analysis by IPA.</p>
</sec>
<sec id="s2_6">
<label>2.6</label>
<title>
<italic>In vitro</italic> studies</title>
<p>HUH7 human hepatoma cells were incubated for 24&#xa0;h in medium containing BSA. To see whether AN1284 can reduce steatosis from an FFA by a direct action on liver cells, PA was added together with different concentrations of AN1284 for 24&#xa0;h. Lipid content was quantified by ORO staining. Since RNA-seq analysis suggested that AN1284 could act via the aryl hydrocarbon receptor (AhR), we measured the effect of AN1284 on the nuclear translocation of AhR, by immunofluorescence intensity, 15&#xa0;min after its addition to the cells. We used a specific antibody (Abcam, ab190797), analyzed its intensity with ImageJ, and normalized it to the control group. RT-qPCR was used to measure the target genes of AhR after 24&#xa0;h: fatty acid synthase (FASN), SREBP-1c, acyl-CoA oxidase 1 (ACOX1), and cytochrome P450-1 (CYP1a1). siRNA for human AhR from TriFECTa Kit DsiRNA Duplex purchased from ITD was used to silence AhR. The reverse transfection of these siRNAs onto HUH7 cells was performed by means of TransIT-X2 Dynamic Delivery System (MC-MIR-6000, Mirus) according to the manufacturer&#x2019;s instructions. To examine the effect of siRNA on AhR expression, total protein was extracted from cells 48&#x2013;72 h after transfection, and AhR protein levels were measured using Western blot (WB) with primary AhR antibody (Abcam, ab190797). The siRNA-transfected cells were treated with AN1284 and analyzed.</p>
<sec id="s2_6_1">
<label>2.6.1</label>
<title>Protein extraction and Western blotting</title>
<p>Total protein extract was obtained by using Radioimmuno Precipitation Assay lysis buffer for five samples/group. Cell lysates containing 50 &#x3bc;g of total protein were then added to SDS&#x2013;PAGE gels and transferred to Nitrocellulose membranes (Bio-Rad, 1704158). Membranes were blocked in 1% non-fat milk and incubated overnight at 4&#xb0;C with primary antibodies, RXR&#x3b1; (Abcam, ab125001), and mouse anti-&#x3b2;-actin (MP Biomedicals, 691001). The signals were developed with an enhanced chemiluminescence solution (Bio-Rad, 1705060) and visualized on a Bio-Rad bioluminescence device. Band intensities were quantified using ImageJ and normalized to actin.</p>
</sec>
</sec>
<sec id="s2_7">
<label>2.7</label>
<title>Measurement of hepatic levels of AN1284 and its indole metabolite AN1422</title>
<p>Liver samples were homogenized (100 mg/ml) in phosphate buffered saline. Twenty microliters of internal standard (rivastigmine 750 ng/ml) and 20 &#xb5;l of ultra-pure water were added. AN1284 and its oxidized metabolite, AN1422, were extracted and measured as described in Weitman et&#xa0;al. (<xref ref-type="bibr" rid="B25">25</xref>).</p>
</sec>
<sec id="s2_8">
<label>2.8</label>
<title>Statistical analysis</title>
<p>Studies were designed to generate groups of equal size whenever possible, and any variation in group size within an experiment was due to unexpected loss of an animal or sample for measurement. All statistical analyses were performed using GraphPad Prism 9.50 (GraphPad Software Inc., San Diego, CA, USA). Data were compared by the Kruskal&#x2013;Wallis non-parametric method, followed by the Mann&#x2013;Whitney <italic>post-hoc</italic> test if <italic>F</italic> achieved <italic>P</italic> &lt; 0.05. Body weight changes over time were compared by a two-way repeated measures ANOVA using SPSS version 28. Data are expressed as the mean &#xb1; SD. A <italic>p</italic>-value of &lt;0.05 was considered to be significant.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<label>3</label>
<title>Results</title>
<sec id="s3_1">
<label>3.1</label>
<title>Liver concentrations of AN1284 and its oxidized metabolite</title>
<p>There were no significant differences in the hepatic concentrations of AN1284 after administration of 1 or 5 mg/kg/day (37.9 &#xb1; 9.7 and 51.4 &#xb1; 12.0 ng/g), respectively, but those of the indole metabolite, AN1422, were significantly higher after the 5 mg/kg/day dose (3.4 &#xb1; 1.1 vs. 9.4 &#xb1; 4.9 mg/kg).</p>
</sec>
<sec id="s3_2">
<label>3.2</label>
<title>AN1284 attenuates liver steatosis</title>
<p>During 4 months of feeding, mice on WD gained significantly more weight than those on the normal diet (<italic>p</italic> &lt; 0.0001; <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref>). There were no significant differences in the weight gain between the three groups of mice on the WD. At this time, livers of mice on the WD showed significant hepatic fat content as showed with ORO staining (<xref ref-type="supplementary-material" rid="SM1">
<bold>Figure S1B</bold>
</xref>). During the last 2 months after implantation of the mps, there was still a significant difference in weight gain between saline-treated mice on a WD and those on an ND. AN1284 only significantly reduced weight gain at a dose 5 mg/kg/day (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref>). After 4 months, the livers of saline-treated mice fed a WD showed extensive cell ballooning, inflammation (H&amp;E), and fat accumulation (ORO) (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>). AN1284 (1 and 5 mg/kg/day) significantly decreased liver weight (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1C, D</bold>
</xref>), lipid content (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1E</bold>
</xref>), triglycerides (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1F</bold>
</xref>), and serum ALT (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1G</bold>
</xref>), despite the fact that they remained on the WD throughout the entire period. AN1284 also reduced hepatic cell ballooning and inflammation (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>). Additionally, we checked whether AN1284 has any effect in mice fed a ND. Neither dose of AN1284 had any significant effect on body weight, liver weight, ALT, and oil red content.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>AN1284 reduces cell ballooning, inflammation, and hepatic fat accumulation in mice on a modified Western diet (WD). <bold>(A)</bold> WD causes cell ballooning (arrowheads), immune cell infiltration (arrows), fibrosis (H&amp;E), and fat accumulation detected with Oil red-O (ORO). Calibration bar, 20 &#xb5;M. WD increases body weight <bold>(B)</bold>, liver weight <bold>(C)</bold> and liver/body weight ratio <bold>(D)</bold>, ORO <bold>(E)</bold>, triglycerides <bold>(F)</bold> and ALT <bold>(G)</bold>. All measures except weight gain are significantly reduced by AN1284 (1 mg/kg/day) and all except ALT, significantly reduced by AN1284 5 mg/kg/day. ANN12284 1 mg/kg/day restores ALT to normal by AN1284. Significantly different from ND, ***p &lt; 0.001; significantly different from WD + saline, #p &lt; 0.05; ##p &lt; 0.01; ###p &lt; 0.001.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-14-1226808-g001.tif"/>
</fig>
</sec>
<sec id="s3_3">
<label>3.3</label>
<title>AN1284 attenuates liver fibrosis</title>
<p>Moderate pericellular fibrosis in the livers of mice on the WD was demonstrated by an increase in staining with SR and Col4 and by TGF-&#x3b2;1 mRNA levels (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2A-D</bold>
</xref>). AN1284 (1 and 5 mg/kg/day) decreased SR. TGF-&#x3b2;1 mRNA was significantly reduced by 1 and 5 mg/kg/day but Col4 was significantly reduced only by a dose of 1 mg/kg/day. Since the degree of fibrosis was only moderate in the mice on WD, we performed additional experiments to assess the effect of AN1284 in mice on ND in which liver fibrosis was induced by injections of CCl<sub>4</sub> during a 7-week period. Fibrosis, assessed by SR and &#x3b1;-SMA staining, was already present at 4 weeks (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2E</bold>
</xref>). SR intensity increased significantly by 7 weeks. AN1284 (1 mg/kg/day) given by mps or orally, started after 4 weeks of CCl<sub>4</sub> injections when fibrosis was clearly present, decreased the levels of SR, but &#x3b1;-SMA was only reduced significantly after oral administration. The results indicate that AN1284 is able to halt the progression of liver fibrosis (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2E-G</bold>
</xref>).</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>AN1284 reduces hepatic fibrosis in mice on a WD or after CCl4 injection. <bold>(A)</bold> WD increases the area of Sirius Red (SR) and Col4 and TGF-&#x3b2;1 compared to that in mice on ND. Calibration bar, 20 &#x3bc;M. <bold>(B)</bold> SR staining is significantly decreased by AN1284 (1 and 5 mg/kg/day). <bold>(C)</bold> Col4 staining is significantly decreased by AN1284 (1 mg/kg/day) but not by 5 mg/kg/day. <bold>(D)</bold> TGF-&#x3b2;1 mRNA is significantly reduced by AN1284 (5 mg/kg/day) but not by 1 mg/kg/day. <bold>(E)</bold> SR and &#x3b1;-SMA staining in mice is increased 4 and 7 weeks after bi-weekly injections of CCl4, a model of liver fibrosis. Calibration bar, 20 &#x3bc;M. <bold>(F)</bold> SR staining is significantly reduced by AN1284 1 mg/kg/day given by mps or in the drinking fluid. <bold>(G)</bold> &#x3b1;-SMA staining is significantly reduced by AN1284 given in the drinking fluid. Significantly different from control, *p &lt; 0.05; **p &lt; 0.01, ***p &lt; 0.001. Significantly different from CCl4 4 weeks, &#x2021;p &lt; 0.01; significantly different from saline, #p &lt; 0.05, ##p &lt; 0.01, ###p &lt; 0.001.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-14-1226808-g002.tif"/>
</fig>
</sec>
<sec id="s3_4">
<label>3.4</label>
<title>AN1284 reverses hepatic gene expression related to liver diseases</title>
<p>We used RNA-Seq analysis to elucidate the influence of AN1284 on WD-induced hepatic gene expression profile. This enabled us to identify the canonical pathways altered by both the WD and drug treatment and to assess the differences in global gene expression between groups. Principal component analysis (PCA) showed that the six experimental groups could clearly be separated by the first two principal components (PC1 and PC2; <xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref>). Compared to a ND, the WD significantly changed the expression of 4,600 genes [with a Base Mean (BM) &gt;150]. Those most changed by the WD and reversed by AN1284 are shown in <xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3B</bold>
</xref>. IPA and GSEA also revealed the top 20 pathways significantly altered by the diet that are associated with liver diseases (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3C</bold>
</xref>). The WD strongly activated pathways of hepatic steatosis and fibrosis and those encoding inflammation, oxidative stress, liver damage, and liver necrosis. All were significantly altered by AN1284 treatment, together with liver metabolism and elevation of the (FXR)/retinoid X receptor (RXR) and liver X (LXR) receptors (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3D, E</bold>
</xref>). The xenobiotic metabolism and AhR pathways were also significantly altered by AN1284. IPA prediction of the up- or downstream regulators by AN1284 (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table&#xa0;1</bold>
</xref>) indicated a role of several nuclear receptors (AhR, RXR, LXR, CAR, and FXR) and the inhibition of several cytokines and growth factors (i.e., TGF-&#x3b2;, TNF-&#x3b1;, IL-1&#x3b2;, and FGF). IPA pathways analysis suggested a decrease for AhR and an elevation of RXR and LXR (<xref ref-type="supplementary-material" rid="SM1">
<bold>Figures S2&#x2013;S4</bold>
</xref>).</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Effect of WD and AN1284 treatment on hepatic gene expression. <bold>(A)</bold> PCA plot showing RNA-Seq samples analyzed by diet and treatment groups. The WD substantially alters gene expression, while AN1284 treatment returns it to that of mice on a ND. <bold>(B)</bold> Heat map of genes most changed by the WD and the effect of AN1284 (1 and 5 mg/kg/day) on them. Red and blue colors indicate high and low gene expression, respectively. <bold>(C)</bold> IPA showing the top 20 pathways involved in liver disease and function that were significantly elevated by the WD compared to ND. Values are expressed as &#x2013;log (B&#x2013;H <italic>p</italic>-value). <bold>(D)</bold> IPA showing the top 20 canonical pathways that were significantly altered in AN1284-treated mice on a WD compared to those treated with saline. Values are expressed as &#x2013;log (B&#x2013;H <italic>p</italic>-value). <bold>(E)</bold> GSEA showing the most significant, enriched pathways that were up- or downregulated by the WD and the change reversed by AN1284 treatment.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-14-1226808-g003.tif"/>
</fig>
</sec>
<sec id="s3_5">
<label>3.5</label>
<title>Effect of AN1284 on LXR/RXR and FXR/RXR pathways</title>
<p>In recent years, the role of nuclear receptors in liver steatosis and NASH has been investigated. While some of them were initially characterized as xenobiotic receptors, subsequent observations have pointed to their equally important metabolic functions (<xref ref-type="bibr" rid="B27">27</xref>, <xref ref-type="bibr" rid="B28">28</xref>). FXR and LXR control metabolic processes abundantly expressed in the liver. IPA and GSEAs indicated that AN1284 treatment activated the FXR/RXR pathway with a <italic>p</italic>-value of 20.7 and the LXR/RXR pathway with a <italic>p</italic>-value of 15.6 (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3D</bold>
</xref>, <xref ref-type="supplementary-material" rid="SM1">
<bold>S2</bold>
</xref>, <xref ref-type="supplementary-material" rid="SM1">
<bold>S3</bold>
</xref>). This was verified by WB analysis, which showed that levels of hepatic RXR&#x3b1; protein increased by the diet were further elevated by AN1284 (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4A, B</bold>
</xref>). Although RXR&#x3b1; protein levels did not change in the liver of mice, 7 weeks after CCl<sub>4</sub> injections, they were greatly increased by both routes of AN1284 administration (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4C, D</bold>
</xref>). The WD also increased the percent area of fatty acid translocase (CD36)-positive cells (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4E, F</bold>
</xref>) and hepatic mRNA levels of FASN (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4G</bold>
</xref>) as suggested from RNA-Seq results (<xref ref-type="supplementary-material" rid="SM1">
<bold>Figure S2</bold>
</xref>). AN1284 (1 and 5 mg/kg/day) significantly decreased gene expression of CD36, ACC, and FASN.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>AN1284 increases RXR-&#x3b1; protein levels and decreases CD36 and FASN in mice on a WD. <bold>(A, B)</bold> WB of RXR&#x3b1; in mice on a WD. WD increases RXR&#x3b1; protein levels, which are further increased by AN1284 (1 mg/kg/day). The 5-mg dose was not tested. <bold>(C, D)</bold> WB of RXR&#x3b1; in mice after injection of CCl<sub>4</sub>. CCl<sub>4</sub> alone has no effect on the levels of RXR-&#x3b1;, which were markedly increased by AN1284 (1 mg/kg/day) given by mps or in the drinking water. <bold>(E, F)</bold> Immunohistochemical staining of CD36-positive cells. The cells, indicated by red staining, are a significantly greater proportion of the area in mice on WD than on ND and are markedly reduced by AN1284 (1 and 5 mg/kg/day). <bold>(G)</bold> mRNA levels of FASN in mice on WD. FASN mRNA levels are increased by the WD and reduced by AN1284 (5 mg/kg/day). 1 mg/kg/day (<italic>p</italic> = 0.05). Significantly different from ND, **<italic>p</italic> &lt; 0.01, ***<italic>p</italic> &lt; 0.001; significantly different from WD + saline, #<italic>p</italic> &lt; 0.05, ##<italic>p</italic> &lt; 0.01, ###<italic>p</italic> &lt; 0.001.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-14-1226808-g004.tif"/>
</fig>
</sec>
<sec id="s3_6">
<label>3.6</label>
<title>AN1284 switches hepatic immune response from pro- to anti-inflammatory</title>
<p>Hepatic inflammation plays an important role in the progression of NASH. Since the AhR is involved in many inflammatory responses, including suppression of cytokine release in LPS activated macrophages (<xref ref-type="bibr" rid="B28">28</xref>), we examined whether AN1284 also influences hepatic inflammation. In the livers of saline-treated mice, the WD significantly increased the number of hepatic T cells (CD3), macrophages (F4/80), and B cells (CD45R), but not neutrophils (Ly6B; <xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5A-E</bold>
</xref>). It also increased hepatic gene expression of CCL2 (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5F</bold>
</xref>), a marker of immune activation. AN1284 (1 mg/kg/day), but not 5 mg, increased the number of neutrophils and further increased that of macrophages, B cells, and T cells (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5A-E</bold>
</xref>). AN1284 depressed CCL2 gene expression (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5F</bold>
</xref>) and increased that of IL-10 (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5G</bold>
</xref>).</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Effect of AN1284 on hepatic immune cells, anti-inflammatory cytokines, and CCL2 in mice on a WD. <bold>(A&#x2013;E)</bold>. Immunohistochemical staining of immune cells in mice livers on a WD. CD3 for T cells, F4/80 for macrophages, CD45R for B cells, and Ly6B for neutrophils and NK cells. Calibration bar, 20 &#xb5;M. <bold>(F)</bold>. mRNA levels of CCL2 in the liver of mice on a WD. WD increases T cells, macrophages and CCL2 expression. AN1284 (1 mg/kg/day) significantly further increases T cells <bold>(B)</bold>, macrophages <bold>(C)</bold>, neutrophils <bold>(D)</bold>, B cells <bold>(E)</bold> and IL-10 hepatic levels <bold>(G)</bold> but decreases CCL2 mRNA <bold>(F)</bold> Significantly different from ND, *p &lt; 0.05; **p &lt; 0.01; ***p &lt; 0.001; significantly different from WD, #p &lt; 0.05; ##p &lt; 0.01; ###p &lt; 0.001.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-14-1226808-g005.tif"/>
</fig>
</sec>
<sec id="s3_7">
<label>3.7</label>
<title>AN1284 reduces steatosis in isolated human hepatoma cells through AhR nuclear translocation</title>
<p>Previous studies indicated that AhR acts as a &#x201c;double-edged sword&#x201d; in the progression of NAFLD, depending on the specific ligand (<xref ref-type="bibr" rid="B29">29</xref>). In order to determine whether AN1284 can have a direct effect on liver cells, we used a HUH7- human hepatoma cell line. The addition of PA/BSA complex to HUH7 cells for 48&#xa0;h increased fat content (<italic>p</italic> &lt; 0.0001). This was significantly reduced by AN1284 (0.21, 2.1, and 6.3 ng/ml) (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6A, B</bold>
</xref>). The concentrations were in the range of those found in the liver of mice treated with 1 and 5 mg/kg/day. BSA alone had no effect on the measurements. Since the RNA-Seq results suggested AhR as an upstream regulator, we analyzed its nuclear translocation in the HUH7 cells incubated with PA, 15&#xa0;min after the addition of AN1284, and found this to be increased by AN1284 (6.3 ng/ml) (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6C, D</bold>
</xref>), together with upregulation in the expression of AhR target gene  CYP1a1 and also ACOX1 (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6E, F</bold>
</xref>) 24&#xa0;h later. AN1284 also decreased SREBP-1c mRNA, the principal transcriptional regulator of FASN that was elevated by PA (<italic>p</italic> &lt; 0.001, <xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7E</bold>
</xref>). Similarly, FASN mRNA was decreased by AN1284 (2.1 and 6.3 ng/ml), opposing the increase caused by PA addition (<italic>p</italic> &lt; 0.001; <xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7F</bold>
</xref>). In order to confirm that AN1284 suppresses fat accumulation in HUH7 cells through AhR, we silenced the receptor by using siRNA. AN1284 no longer reduced lipid in cells pre-treated with siRNA (<xref ref-type="fig" rid="f7">
<bold>Figures&#xa0;7A, B</bold>
</xref>). AhR protein levels were substantially reduced in HUH7 cells treated with AhR siRNA (<xref ref-type="fig" rid="f7">
<bold>Figures&#xa0;7C, D</bold>
</xref>). When these cells were incubated with PA and pre-treated with AN1284 siRNA, the levels of SREBP-1 and FASN genes remained elevated (<xref ref-type="fig" rid="f7">
<bold>Figures&#xa0;7E, F</bold>
</xref>). We also checked if AN1284 directly elevated RXR-&#x3b1; in the hepatoma cells. No change was observed in its protein levels in the WB analysis (<xref ref-type="fig" rid="f7">
<bold>Figures&#xa0;7C, D</bold>
</xref>).</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>AN1284 decreases lipid generation from palmitic acid (PA), in human hepatoma cells in culture, through AhR activation. <bold>(A)</bold> Representative ORO staining in HUH7 human hepatoma cells incubated with PA/BSA and treated with increasing doses of AN1284 for 24 h. <bold>(B)</bold> Percent area of ORO in hepatoma cells after 2 h. <bold>(C)</bold> Nuclear translocation of AhR, 15 min after AN1284 addition. <bold>(D)</bold> AhR nuclear quantitation 15 min after AN1284 addition. <bold>(E)</bold> CYP1a1 mRNA levels after 24 h. <bold>(F)</bold> ACOX1 mRNA levels after 24 h. Significantly different from control **p &lt; 0.01; significantly different from BSA + PA, #p &lt; 0.05; ##p &lt; 0.01; ###p &lt; 0.001. These concentrations of AN1284 are within the range found in the liver after chronic treatment at 1 mg/kg/day by mps in this study.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-14-1226808-g006.tif"/>
</fig>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>AhR silencing in human hepatoma cells by siRNA blocks the beneficial effects of AN1284 on lipid generation. <bold>(A)</bold> Representative ORO staining in HUH7 human hepatoma cells incubated with PA/BSA and treated with AN1284 &#xb1; siRNA for 24&#xa0;h. <bold>(B)</bold> Percent area of ORO after 24&#xa0;h. <bold>(C)</bold> Western blot of AhR and RXR-&#x3b1; proteins in HUH7 hepatoma cells incubated with PA and treated with AN1284 (6 ng/ml) &#xb1; siRNA for 24&#xa0;h. <bold>(D)</bold> AhR silencing with siRNA reduced AhR protein levels in hepatoma cells but had no effect on RXR-&#x3b1; levels. <bold>(E)</bold> SREBP-1c mRNA levels after 24&#xa0;h. <bold>(F)</bold> FASN mRNA levels after 24&#xa0;h. Significantly different from control **<italic>p</italic> &lt; 0.01; ***<italic>p</italic> &lt; 0.001. Significantly different from BSA + PA, ##<italic>p</italic> &lt; 0.01; ###<italic>p</italic> &lt; 0.001.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-14-1226808-g007.tif"/>
</fig>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<label>4</label>
<title>Discussion</title>
<p>In our earlier study performed in diabetic mice (<xref ref-type="bibr" rid="B22">22</xref>), AN1284 was administered before the mice had any kidney or liver damage, in contrast to the current study in which drug treatment was only started after there were clear signs of hepatic steatosis and/or fibrosis. We now show that the WD given to mice for 4 months replicated much of the pathology in the liver of human subjects with NASH. It was supported by RNA-seq and IPA and GSEAs showing that the diet upregulated several of the major pathways affected in humans. These included hepatic steatosis, inflammation, fibrosis, hepatic cell proliferation, and oxidative stress. The findings were confirmed by direct measures of genes and proteins, which included significant increases in TGF-&#x3b2;1, Col4, and CD36, all of which are higher in humans with NASH (<xref ref-type="bibr" rid="B30">30</xref>&#x2013;<xref ref-type="bibr" rid="B32">32</xref>). CD36 facilitates the intracellular uptake of FFAs and their esterification into triglycerides, while FASN catalyzes the last step in fatty acid biosynthesis and is believed to be a major determinant of lipogenesis (<xref ref-type="bibr" rid="B32">32</xref>, <xref ref-type="bibr" rid="B33">33</xref>).</p>
<p>AN1284 (1 or 5 mg/kg/day), administered for 2 months by continuous release mps after commencement of the WD, reduced the deterioration of many of its deleterious effects, while the mice remained on the diet. This included the alterations in liver pathology, steatosis, and fibrosis and the percent of inducible nitric oxide synthase (iNOS)-positive cells (<xref ref-type="supplementary-material" rid="SM1">
<bold>Figure S5</bold>
</xref>), indicating that it was able to lower oxidative stress. AN1284 (1 mg/kg/day) also reduced the gene expression of pro-inflammatory factors TNF-&#x3b1; and CCL2 and increased that of IL-10. CCL2 promotes fibrosis by recruiting pro-inflammatory monocytes (<xref ref-type="bibr" rid="B34">34</xref>). In the later, resolution stage of NASH, macrophages change their phenotype, expressing cytokines like IL-10 that suppress the proliferation and effector functions of CD4<sup>+</sup> and CD8<sup>+</sup> T cells and repair wound healing (<xref ref-type="bibr" rid="B35">35</xref>). AN1284 decreased SREBP-1c mRNA, while increasing that of ACOX-1, an enzyme found in peroxisomes and mitochondria, which oxidizes straight chain fatty acids like PA. Other studies have shown that inhibition of ACOX-1 or an abnormal ACOX-1 gene (<xref ref-type="bibr" rid="B36">36</xref>) can increase steatosis.</p>
<p>Numerous nuclear receptors including FXR, LXR, RXR, and AhR have been suggested as regulators of NAFLD and NASH progression (<xref ref-type="bibr" rid="B27">27</xref>, <xref ref-type="bibr" rid="B28">28</xref>). RNA-Seq analysis points to the involvement of these nuclear receptors in the mechanism of action of AN1284. RXR&#x3b1; is a nuclear receptor that forms a heterodimer with other such receptors like FXR, LXR, and PPAR to promote cholesterol efflux. It helps to regulate glucose metabolism, apoptotic cell clearance, immune cell proliferation, and inflammatory gene repression (<xref ref-type="bibr" rid="B37">37</xref>). FXR is reduced in patients with NASH (<xref ref-type="bibr" rid="B38">38</xref>), and its levels of expression are inversely correlated with disease severity (<xref ref-type="bibr" rid="B39">39</xref>). When given either by mps or in the drinking water, AN1284 activated the FXR&#x2013;RXR pathway and increased the levels of RXR&#x3b1; protein in mice on the WD and also in those with fibrosis, induced by CCl<sub>4</sub> injections.</p>
<p>Using RNA-Seq to elucidate the mechanism of action of AN1284, we found that it reduced AhR mRNA levels and activated genes downstream of AhR. AhR signaling appears to be involved in immune-mediated diseases in humans (<xref ref-type="bibr" rid="B40">40</xref>). Depending on the particular cell type and the activating ligands, AhR was reported to have an anti-inflammatory and tissue-protective function in immune-mediated liver disease (<xref ref-type="bibr" rid="B41">41</xref>). Yet, the role of AhR in NAFLD remains controversial and appears to depend on the model used. In mice with constitutively activated human AhR given a WD, the level of steatosis was higher than in controls (<xref ref-type="bibr" rid="B42">42</xref>). However, stimulation of AhR with indole propionic acid, which shares some of the anti-inflammatory activity of indolines, but at higher concentrations (<xref ref-type="bibr" rid="B43">43</xref>), alleviated steatosis in mice on a WD (<xref ref-type="bibr" rid="B44">44</xref>). Moreover, activation of AhR in hepatic stellate cells prevented fibrosis induced by CCl<sub>4</sub> injections by blocking downstream genes required for fibrogenesis (<xref ref-type="bibr" rid="B45">45</xref>). Additionally, AhR was shown to play a role in the regulation of body mass in mice fed a WD (<xref ref-type="bibr" rid="B46">46</xref>). In a previous study, on db/db mice, AN1284 arrested body weight gain at a dose of 5 mg/kg/day only after 2 months of treatment and significantly increased total body fat oxidation (<xref ref-type="bibr" rid="B22">22</xref>). In the current study, both doses of AN1284 attenuated liver weight, but body weight gain was again only significantly decreased by a dose of 5 mg/kg/day.</p>
<p>In a human hepatoma cell line incubated with PA, we found that AhR was translocated to the nucleus 15&#xa0;min following the administration of AN1284. The expression of CYP1a1 gene downstream of AhR, was upregulated 24 h later, but AN1284 had no direct effect on protein levels of AhR and RXR-&#x3b1; (<xref ref-type="fig" rid="f7">
<bold>Figures&#xa0;7C, D</bold>
</xref>). On the other hand, genes related to the LXR pathway, FASN and SREBP-1c, were significantly reduced by AN1284 (2.1 and 6.3 ng/ml). Silencing AhR in the hepatoma cells confirmed that part of the direct actions of AN1284 is mediated through AhR activation.</p>
<p>While one or the other of the two doses of AN1284 given in this study appeared to be more effective in altering some measures of liver pathology, there were no statistically significant differences between any of their effects. Neither did they produce significant differences in hepatic concentrations, but those of the indole metabolite were higher after 5 mg/kg/day. Although not measured in the current study, the hepatic concentrations of AN1284 after administration of 1 mg/kg/day in the drinking water that significantly reduced fibrosis in the CCl<sub>4</sub> model were similar to those achieved by administration of 2.5 mg/kg/day by mps (<xref ref-type="bibr" rid="B25">25</xref>).</p>
<p>In conclusion, AN1284 given to mice for 2 months at doses of 1 and 5 mg/kg/day can mitigate the deterioration of hepatic damage, steatosis, and fibrosis caused by a modified WD, in part through the AhR nuclear receptor that controls several, independent processes that were shown to promote NASH in human subjects. The beneficial effect of AN1284 on liver pathology in NASH may be due to a combination of a reduction in liver weight, inflammation, oxidative stress, and fibrosis.</p>
</sec>
<sec id="s5" sec-type="data-availability">
<title>Data availability statement</title>
<p>The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: GSE186116 (GEO).</p>
</sec>
<sec id="s6" sec-type="ethics-statement">
<title>Ethics statement</title>
<p>The animal study was reviewed and approved by Experiments were performed according to the guidelines of the Animal Care and Use Committee of the Hebrew University (NIH approval number OPRR-A01-5011).</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author contributions</title>
<p>RA and MW contributed to conception and design of the study. ASY, NA, and RA performed the experiments. ASY, RA, and MW organized the database. SE, HB, and YN performed the bioinformatics analysis. MW and RA wrote the manuscript. All authors contributed to manuscript revision, and read and approved the submitted version.</p>
</sec>
</body>
<back>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>The study was supported by the Chief Scientist Office of the Israeli Ministry of Health (Grant 3-15115) and the Sylvia and David Salzberg Fund and University Research funds of MW.</p>
</sec>
<ack>
<title>Acknowledgments</title>
<p>We thank Prof. Abraham Nudelman for supplying AN1284, Dr. Michal Weitman for performing the measurements of AN1284 and its metabolite in the liver, Dr. Michal Melamed, Ms. Corina Bejar for technical help, and Mrs. Donna Schorer-Apelbaum for assistance with statistics and graphics.</p>
</ack>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s10" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s11" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fendo.2023.1226808/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fendo.2023.1226808/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="Image_1.pdf" id="SF1" mimetype="application/pdf"/>
<supplementary-material xlink:href="Table_1.pdf" id="SM1" mimetype="application/pdf"/>
</sec>
<fn-group>
<title>Abbreviations</title>
<fn fn-type="abbr">
<p>ACOX1, acyl-CoA oxidase 1; AhR, aryl hydrocarbon receptor; ALT, alanine transaminase; CCl<sub>4</sub>, carbon tetrachloride; Col4, collagen 4; CYP1a1, cytochrome P450-a1; FASN, fatty acid synthase; FFAs, free fatty acids; FXR, Farnesoid X receptor; GSEA, Gene Set Enrichment Analysis; H&amp;E, hematoxylin and eosin; IPA, ingenuity pathway analysis; h, hours; LPS, lipopolysaccharide; LXR, liver X receptor; mps, micro-osmotic-pumps; NAFLD, non-alcoholic fatty liver disease; NASH, non-alcoholic steatohepatitis; ND, normal diet; ORO, Oil Red O; PA, palmitic acid; PCA, principal component analysis; PPAR, proliferator-activated receptor; RXR, retinoid X receptor; SR, Sirius red; SREBP-1c, sterol regulatory element-binding protein 1c; WD, Western diet.</p>
</fn>
</fn-group>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Enomoto</surname> <given-names>H</given-names>
</name>
<name>
<surname>Bando</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Nakamura</surname> <given-names>H</given-names>
</name>
<name>
<surname>Nishiguchi</surname> <given-names>S</given-names>
</name>
<name>
<surname>Koga</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Liver fibrosis markers of nonalcoholic steatohepatitis</article-title>. <source>World J Gastroenterol</source> (<year>2015</year>) <volume>21</volume>:<page-range>7427&#x2013;35</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.3748/wjg.v21.i24.7427</pub-id>
</citation>
</ref>
<ref id="B2">
<label>2</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Spahis</surname> <given-names>S</given-names>
</name>
<name>
<surname>Delvin</surname> <given-names>E</given-names>
</name>
<name>
<surname>Borys</surname> <given-names>JM</given-names>
</name>
<name>
<surname>Levy</surname> <given-names>E</given-names>
</name>
</person-group>. <article-title>Oxidative stress as a critical factor in nonalcoholic fatty liver disease pathogenesis</article-title>. <source>Antioxid Redox Signal</source> (<year>2017</year>) <volume>26</volume>:<page-range>519&#x2013;41</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1089/ars.2016.6776</pub-id>
</citation>
</ref>
<ref id="B3">
<label>3</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Marra</surname> <given-names>F</given-names>
</name>
<name>
<surname>Svegliati-Baroni</surname> <given-names>G</given-names>
</name>
</person-group>. <article-title>Lipotoxicity and the gut-liver axis in NASH pathogenesis</article-title>. <source>J Hepatol</source> (<year>2018</year>) <volume>68</volume>:<page-range>280&#x2013;95</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jhep.2017.11.014</pub-id>
</citation>
</ref>
<ref id="B4">
<label>4</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xiang</surname> <given-names>M</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>PX</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>AB</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>XJ</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>P</given-names>
</name>
<etal/>
</person-group>. <article-title>Targeting hepatic TRAF1-ASK1 signaling to improve inflammation, insulin resistance, and hepatic steatosis</article-title>. <source>J Hepatol</source> (<year>2016</year>) <volume>64</volume>:<page-range>1365&#x2013;77</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jhep.2016.02.002</pub-id>
</citation>
</ref>
<ref id="B5">
<label>5</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>RM</given-names>
</name>
<name>
<surname>Desai</surname> <given-names>LP</given-names>
</name>
</person-group>. <article-title>Reciprocal regulation of TGF-beta and reactive oxygen species: A perverse cycle for fibrosis</article-title>. <source>Redox Biol</source> (<year>2015</year>) <volume>6</volume>:<page-range>565&#x2013;77</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.redox.2015.09.009</pub-id>
</citation>
</ref>
<ref id="B6">
<label>6</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Caesar</surname> <given-names>R</given-names>
</name>
<name>
<surname>Tremaroli</surname> <given-names>V</given-names>
</name>
<name>
<surname>Kovatcheva-Datchary</surname> <given-names>P</given-names>
</name>
<name>
<surname>Cani</surname> <given-names>PD</given-names>
</name>
<name>
<surname>Backhed</surname> <given-names>F</given-names>
</name>
</person-group>. <article-title>Crosstalk between Gut Microbiota and Dietary Lipids Aggravates WAT Inflammation through TLR Signaling</article-title>. <source>Cell Metab</source> (<year>2015</year>) <volume>22</volume>:<page-range>658&#x2013;68</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.cmet.2015.07.026</pub-id>
</citation>
</ref>
<ref id="B7">
<label>7</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dulai</surname> <given-names>PS</given-names>
</name>
<name>
<surname>Singh</surname> <given-names>S</given-names>
</name>
<name>
<surname>Patel</surname> <given-names>J</given-names>
</name>
<name>
<surname>Soni</surname> <given-names>M</given-names>
</name>
<name>
<surname>Prokop</surname> <given-names>LJ</given-names>
</name>
<name>
<surname>Younossi</surname> <given-names>Z</given-names>
</name>
<etal/>
</person-group>. <article-title>Increased risk of mortality by fibrosis stage in nonalcoholic fatty liver disease: Systematic review and meta-analysis</article-title>. <source>Hepatology</source> (<year>2017</year>) <volume>65</volume>:<page-range>1557&#x2013;65</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/hep.29085</pub-id>
</citation>
</ref>
<ref id="B8">
<label>8</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Carpino</surname> <given-names>G</given-names>
</name>
<name>
<surname>Del Ben</surname> <given-names>M</given-names>
</name>
<name>
<surname>Pastori</surname> <given-names>D</given-names>
</name>
<name>
<surname>Carnevale</surname> <given-names>R</given-names>
</name>
<name>
<surname>Baratta</surname> <given-names>F</given-names>
</name>
<name>
<surname>Overi</surname> <given-names>D</given-names>
</name>
<etal/>
</person-group>. <article-title>Increased liver localization of lipopolysaccharides in human and experimental NAFLD</article-title>. <source>Hepatology</source> (<year>2020</year>) <volume>72</volume>:<page-range>470&#x2013;85</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/hep.31056</pub-id>
</citation>
</ref>
<ref id="B9">
<label>9</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bao</surname> <given-names>L</given-names>
</name>
<name>
<surname>Yin</surname> <given-names>J</given-names>
</name>
<name>
<surname>Gao</surname> <given-names>W</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Yao</surname> <given-names>W</given-names>
</name>
<name>
<surname>Gao</surname> <given-names>X</given-names>
</name>
</person-group>. <article-title>A long-acting FGF21 alleviates hepatic steatosis and inflammation in a mouse model of non-alcoholic steatohepatitis partly through an FGF21-adiponectin-IL17A pathway</article-title>. <source>Br J Pharmacol</source> (<year>2018</year>) <volume>175</volume>:<page-range>3379&#x2013;93</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/bph.14383</pub-id>
</citation>
</ref>
<ref id="B10">
<label>10</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kim</surname> <given-names>MH</given-names>
</name>
<name>
<surname>Kang</surname> <given-names>KS</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>YS</given-names>
</name>
</person-group>. <article-title>The inhibitory effect of genistein on hepatic steatosis is linked to visceral adipocyte metabolism in mice with diet-induced non-alcoholic fatty liver disease</article-title>. <source>Br J Nutr</source> (<year>2010</year>) <volume>104</volume>:<page-range>1333&#x2013;42</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1017/S0007114510002266</pub-id>
</citation>
</ref>
<ref id="B11">
<label>11</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Park</surname> <given-names>EJ</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>YM</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>HJ</given-names>
</name>
<name>
<surname>Jang</surname> <given-names>SY</given-names>
</name>
<name>
<surname>Oh</surname> <given-names>MH</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>DH</given-names>
</name>
<etal/>
</person-group>. <article-title>(S)YS-51, a novel isoquinoline alkaloid, attenuates obesity-associated non-alcoholic fatty liver disease in mice by suppressing lipogenesis, inflammation and coagulation</article-title>. <source>Eur J Pharmacol</source> (<year>2016</year>) <volume>788</volume>:<page-range>200&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ejphar.2016.06.040</pub-id>
</citation>
</ref>
<ref id="B12">
<label>12</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Romero-Zerbo</surname> <given-names>SY</given-names>
</name>
<name>
<surname>Garcia-Fernandez</surname> <given-names>M</given-names>
</name>
<name>
<surname>Espinosa-Jimenez</surname> <given-names>V</given-names>
</name>
<name>
<surname>Pozo-Morales</surname> <given-names>M</given-names>
</name>
<name>
<surname>Escamilla-Sanchez</surname> <given-names>A</given-names>
</name>
<name>
<surname>Sanchez-Salido</surname> <given-names>L</given-names>
</name>
<etal/>
</person-group>. <article-title>The atypical cannabinoid abn-CBD reduces inflammation and protects liver, pancreas, and adipose tissue in a mouse model of prediabetes and non-alcoholic fatty liver disease</article-title>. <source>Front Endocrinol (Lausanne)</source> (<year>2020</year>) <volume>11</volume>:<elocation-id>103</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fendo.2020.00103</pub-id>
</citation>
</ref>
<ref id="B13">
<label>13</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yao</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Li</surname> <given-names>S</given-names>
</name>
<name>
<surname>Li</surname> <given-names>X</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>F</given-names>
</name>
<name>
<surname>Tu</surname> <given-names>C</given-names>
</name>
</person-group>. <article-title>Myricetin modulates macrophage polarization and mitigates liver inflammation and fibrosis in a murine model of nonalcoholic steatohepatitis</article-title>. <source>Front Med (Lausanne)</source> (<year>2020</year>) <volume>7</volume>:<elocation-id>71</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fmed.2020.00071</pub-id>
</citation>
</ref>
<ref id="B14">
<label>14</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Patil</surname> <given-names>NY</given-names>
</name>
<name>
<surname>Rus</surname> <given-names>I</given-names>
</name>
<name>
<surname>Downing</surname> <given-names>E</given-names>
</name>
<name>
<surname>Mandala</surname> <given-names>A</given-names>
</name>
<name>
<surname>Friedman</surname> <given-names>JE</given-names>
</name>
<name>
<surname>Joshi</surname> <given-names>AD</given-names>
</name>
</person-group>. <article-title>Cinnabarinic acid provides hepatoprotection against nonalcoholic fatty liver disease</article-title>. <source>J Pharmacol Exp Ther</source> (<year>2022</year>) <volume>383</volume>:<fpage>32</fpage>&#x2013;<lpage>43</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1124/jpet.122.001301</pub-id>
</citation>
</ref>
<ref id="B15">
<label>15</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gapp</surname> <given-names>B</given-names>
</name>
<name>
<surname>Jourdain</surname> <given-names>M</given-names>
</name>
<name>
<surname>Bringer</surname> <given-names>P</given-names>
</name>
<name>
<surname>Kueng</surname> <given-names>B</given-names>
</name>
<name>
<surname>Weber</surname> <given-names>D</given-names>
</name>
<name>
<surname>Osmont</surname> <given-names>A</given-names>
</name>
<etal/>
</person-group>. <article-title>Farnesoid X receptor agonism, acetyl-coenzyme A carboxylase inhibition, and back translation of clinically observed endpoints of <italic>de novo</italic> lipogenesis in a murine NASH model</article-title>. <source>Hepatol Commun</source> (<year>2020</year>) <volume>4</volume>:<page-range>109&#x2013;25</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/hep4.1443</pub-id>
</citation>
</ref>
<ref id="B16">
<label>16</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Alkhouri</surname> <given-names>N</given-names>
</name>
<name>
<surname>Lawitz</surname> <given-names>E</given-names>
</name>
<name>
<surname>Noureddin</surname> <given-names>M</given-names>
</name>
<name>
<surname>DeFronzo</surname> <given-names>R</given-names>
</name>
<name>
<surname>Shulman</surname> <given-names>GI</given-names>
</name>
</person-group>. <article-title>GS-0976 (Firsocostat): an investigational liver-directed acetyl-CoA carboxylase (ACC) inhibitor for the treatment of non-alcoholic steatohepatitis (NASH)</article-title>. <source>Expert Opin Investig Drugs</source> (<year>2020</year>) <volume>29</volume>:<page-range>135&#x2013;41</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/13543784.2020.1668374</pub-id>
</citation>
</ref>
<ref id="B17">
<label>17</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kaul</surname> <given-names>U</given-names>
</name>
<name>
<surname>Parmar</surname> <given-names>D</given-names>
</name>
<name>
<surname>Manjunath</surname> <given-names>K</given-names>
</name>
<name>
<surname>Shah</surname> <given-names>M</given-names>
</name>
<name>
<surname>Parmar</surname> <given-names>K</given-names>
</name>
<name>
<surname>Patil</surname> <given-names>KP</given-names>
</name>
<etal/>
</person-group>. <article-title>New dual peroxisome proliferator activated receptor agonist-Saroglitazar in diabetic dyslipidemia and non-alcoholic fatty liver disease: integrated analysis of the real world evidence</article-title>. <source>Cardiovasc Diabetol</source> (<year>2019</year>) <volume>18</volume>:<fpage>80</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s12933-019-0884-3</pub-id>
</citation>
</ref>
<ref id="B18">
<label>18</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Boeckmans</surname> <given-names>J</given-names>
</name>
<name>
<surname>Natale</surname> <given-names>A</given-names>
</name>
<name>
<surname>Rombaut</surname> <given-names>M</given-names>
</name>
<name>
<surname>Buyl</surname> <given-names>K</given-names>
</name>
<name>
<surname>Rogiers</surname> <given-names>V</given-names>
</name>
<name>
<surname>De Kock</surname> <given-names>J</given-names>
</name>
<etal/>
</person-group>. <article-title>Anti-NASH drug development hitches a lift on PPAR agonism</article-title>. <source>Cells</source> (<year>2020</year>) <volume>9</volume>(1):37. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/cells9010037</pub-id>
</citation>
</ref>
<ref id="B19">
<label>19</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dufour</surname> <given-names>JF</given-names>
</name>
<name>
<surname>Anstee</surname> <given-names>QM</given-names>
</name>
<name>
<surname>Bugianesi</surname> <given-names>E</given-names>
</name>
<name>
<surname>Harrison</surname> <given-names>S</given-names>
</name>
<name>
<surname>Loomba</surname> <given-names>R</given-names>
</name>
<name>
<surname>Paradis</surname> <given-names>V</given-names>
</name>
<etal/>
</person-group>. <article-title>Current therapies and new developments in NASH</article-title>. <source>Gut</source> (<year>2022</year>) <volume>71</volume>:<page-range>2123&#x2013;34</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1136/gutjnl-2021-326874</pub-id>
</citation>
</ref>
<ref id="B20">
<label>20</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zeeli</surname> <given-names>S</given-names>
</name>
<name>
<surname>Weill</surname> <given-names>T</given-names>
</name>
<name>
<surname>Finkin-Groner</surname> <given-names>E</given-names>
</name>
<name>
<surname>Bejar</surname> <given-names>C</given-names>
</name>
<name>
<surname>Melamed</surname> <given-names>M</given-names>
</name>
<name>
<surname>Furman</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>Synthesis and biological evaluation of derivatives of indoline as highly potent antioxidant and anti-inflammatory agents</article-title>. <source>J Med Chem</source> (<year>2018</year>) <volume>61</volume>:<page-range>4004&#x2013;19</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1021/acs.jmedchem.8b00001</pub-id>
</citation>
</ref>
<ref id="B21">
<label>21</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Finkin-Groner</surname> <given-names>E</given-names>
</name>
<name>
<surname>Finkin</surname> <given-names>S</given-names>
</name>
<name>
<surname>Zeeli</surname> <given-names>S</given-names>
</name>
<name>
<surname>Weinstock</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Indoline derivatives mitigate liver damage in a mouse model of acute liver injury</article-title>. <source>Pharmacol Rep</source> (<year>2017</year>) <volume>69</volume>:<fpage>894</fpage>&#x2013;<lpage>902</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.pharep.2017.03.025</pub-id>
</citation>
</ref>
<ref id="B22">
<label>22</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Permyakova</surname> <given-names>A</given-names>
</name>
<name>
<surname>Gammal</surname> <given-names>A</given-names>
</name>
<name>
<surname>Hinden</surname> <given-names>L</given-names>
</name>
<name>
<surname>Weitman</surname> <given-names>M</given-names>
</name>
<name>
<surname>Weinstock</surname> <given-names>M</given-names>
</name>
<name>
<surname>Tam</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>A novel indoline derivative ameliorates diabesity-induced chronic kidney disease by reducing metabolic abnorMalities</article-title>. <source>Front Endocrinol (Lausanne)</source> (<year>2020</year>) <volume>11</volume>:<elocation-id>91</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fendo.2020.00091</pub-id>
</citation>
</ref>
<ref id="B23">
<label>23</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Della Torre</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>Non-alcoholic fatty liver disease as a canonical example of metabolic inflammatory-based liver disease showing a sex-specific prevalence: relevance of estrogen signaling</article-title>. <source>Front Endocrinol (Lausanne)</source> (<year>2020</year>) <volume>11</volume>:<elocation-id>572490</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fendo.2020.572490</pub-id>
</citation>
</ref>
<ref id="B24">
<label>24</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Farrell</surname> <given-names>G</given-names>
</name>
<name>
<surname>Schattenberg</surname> <given-names>JM</given-names>
</name>
<name>
<surname>Leclercq</surname> <given-names>I</given-names>
</name>
<name>
<surname>Yeh</surname> <given-names>MM</given-names>
</name>
<name>
<surname>Goldin</surname> <given-names>R</given-names>
</name>
<name>
<surname>Teoh</surname> <given-names>N</given-names>
</name>
<etal/>
</person-group>. <article-title>Mouse models of nonalcoholic steatohepatitis: toward optimization of their relevance to human nonalcoholic steatohepatitis</article-title>. <source>Hepatology</source> (<year>2019</year>) <volume>69</volume>:<page-range>2241&#x2013;57</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/hep.30333</pub-id>
</citation>
</ref>
<ref id="B25">
<label>25</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Weitman</surname> <given-names>M</given-names>
</name>
<name>
<surname>Bejar</surname> <given-names>C</given-names>
</name>
<name>
<surname>Melamed</surname> <given-names>M</given-names>
</name>
<name>
<surname>Weill</surname> <given-names>T</given-names>
</name>
<name>
<surname>Yanovsky</surname> <given-names>I</given-names>
</name>
<name>
<surname>Zeeli</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>Comparison of the tissue distribution and metabolism of AN1284, a potent anti-inflammatory agent, after subcutaneous and oral administration in mice</article-title>. <source>Naunyn Schmiedebergs Arch Pharmacol</source> (<year>2021</year>) <volume>394</volume>(<issue>10</issue>):<page-range>2077&#x2013;89</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00210-021-02125-y</pub-id>
</citation>
</ref>
<ref id="B26">
<label>26</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Folch</surname> <given-names>J</given-names>
</name>
<name>
<surname>Lees</surname> <given-names>M</given-names>
</name>
<name>
<surname>Sloane</surname> <given-names>SGH</given-names>
</name>
</person-group>. <article-title>A simple method for the isolation and purification of total lipides from animal tissues</article-title>. <source>J Biol Chem</source> (<year>1957</year>) <volume>226</volume>:<fpage>497</fpage>&#x2013;<lpage>509</lpage>. doi: <pub-id pub-id-type="doi">10.1016/S0021-9258(18)64849-5</pub-id>
</citation>
</ref>
<ref id="B27">
<label>27</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>P</given-names>
</name>
<name>
<surname>Xie</surname> <given-names>W</given-names>
</name>
</person-group>. <article-title>Atypical functions of xenobiotic receptors in lipid and glucose metabolism</article-title>. <source>Med Rev</source> (<year>2022</year>) <volume>2</volume>:<page-range>611&#x2013;24</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1515/mr-2022-0032</pub-id>
</citation>
</ref>
<ref id="B28">
<label>28</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Puengel</surname> <given-names>T</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>H</given-names>
</name>
<name>
<surname>Guillot</surname> <given-names>A</given-names>
</name>
<name>
<surname>Heymann</surname> <given-names>F</given-names>
</name>
<name>
<surname>Tacke</surname> <given-names>F</given-names>
</name>
<name>
<surname>Peiseler</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Nuclear receptors linking metabolism, inflammation, and fibrosis in nonalcoholic fatty liver disease</article-title>. <source>Int J Mol Sci</source> (<year>2022</year>) <volume>23</volume>:<elocation-id>2668</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/ijms23052668</pub-id>
</citation>
</ref>
<ref id="B29">
<label>29</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nguyen</surname> <given-names>NT</given-names>
</name>
<name>
<surname>Hanieh</surname> <given-names>H</given-names>
</name>
<name>
<surname>Nakahama</surname> <given-names>T</given-names>
</name>
<name>
<surname>Kishimoto</surname> <given-names>T</given-names>
</name>
</person-group>. <article-title>The roles of aryl hydrocarbon receptor in immune responses</article-title>. <source>Int Immunol</source> (<year>2013</year>) <volume>25</volume>:<page-range>335&#x2013;43</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/intimm/dxt011</pub-id>
</citation>
</ref>
<ref id="B30">
<label>30</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Patil</surname> <given-names>NY</given-names>
</name>
<name>
<surname>Friedman</surname> <given-names>JE</given-names>
</name>
<name>
<surname>Joshi</surname> <given-names>AD</given-names>
</name>
</person-group>. <article-title>Role of hepatic aryl hydrocarbon receptor in non-alcoholic fatty liver disease</article-title>. <source>Receptors</source> (<year>2023</year>) <volume>2</volume>:<fpage>1</fpage>&#x2013;<lpage>15</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/receptors201000</pub-id>
</citation>
</ref>
<ref id="B31">
<label>31</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Che</surname> <given-names>L</given-names>
</name>
<name>
<surname>Paliogiannis</surname> <given-names>P</given-names>
</name>
<name>
<surname>Cigliano</surname> <given-names>A</given-names>
</name>
<name>
<surname>Pilo</surname> <given-names>MG</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>X</given-names>
</name>
<name>
<surname>Calvisi</surname> <given-names>DF</given-names>
</name>
</person-group>. <article-title>Pathogenetic, prognostic, and therapeutic role of fatty acid synthase in human hepatocellular carcinoma</article-title>. <source>Front Oncol</source> (<year>2019</year>) <volume>. 9</volume>:<elocation-id>1412</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fonc.2019.01412</pub-id>
</citation>
</ref>
<ref id="B32">
<label>32</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dorn</surname> <given-names>C</given-names>
</name>
<name>
<surname>Riener</surname> <given-names>MO</given-names>
</name>
<name>
<surname>Kirovski</surname> <given-names>G</given-names>
</name>
<name>
<surname>Saugspier</surname> <given-names>M</given-names>
</name>
<name>
<surname>Steib</surname> <given-names>K</given-names>
</name>
<name>
<surname>Weiss</surname> <given-names>TS</given-names>
</name>
<etal/>
</person-group>. <article-title>Expression of fatty acid synthase in nonalcoholic fatty liver disease</article-title>. <source>Int J Clin Exp Pathol</source> (<year>2010</year>) <volume>3</volume>:<page-range>505&#x2013;14</page-range>.</citation>
</ref>
<ref id="B33">
<label>33</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rada</surname> <given-names>P</given-names>
</name>
<name>
<surname>Gonzalez-Rodriguez</surname> <given-names>A</given-names>
</name>
<name>
<surname>Garcia-Monzon</surname> <given-names>C</given-names>
</name>
<name>
<surname>Valverde</surname> <given-names>AM</given-names>
</name>
</person-group>. <article-title>Understanding lipotoxicity in NAFLD pathogenesis: is CD36 a key driver</article-title>? <source>Cell Death Dis</source> (<year>2020</year>) <volume>11</volume>:<fpage>802</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41419-020-03003-w</pub-id>
</citation>
</ref>
<ref id="B34">
<label>34</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ehling</surname> <given-names>J</given-names>
</name>
<name>
<surname>Bartneck</surname> <given-names>M</given-names>
</name>
<name>
<surname>Wei</surname> <given-names>X</given-names>
</name>
<name>
<surname>Gremse</surname> <given-names>F</given-names>
</name>
<name>
<surname>Fech</surname> <given-names>V</given-names>
</name>
<name>
<surname>Mockel</surname> <given-names>D</given-names>
</name>
<etal/>
</person-group>. <article-title>CCL2-dependent infiltrating macrophages promote angiogenesis in progressive liver fibrosis</article-title>. <source>Gut</source> (<year>2014</year>) <volume>63</volume>:<page-range>1960&#x2013;71</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1136/gutjnl-2013-306294</pub-id>
</citation>
</ref>
<ref id="B35">
<label>35</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wen</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Lambrecht</surname> <given-names>J</given-names>
</name>
<name>
<surname>Ju</surname> <given-names>C</given-names>
</name>
<name>
<surname>Tacke</surname> <given-names>F</given-names>
</name>
</person-group>. <article-title>Hepatic macrophages in liver homeostasis and diseases-diversity, plasticity and therapeutic opportunities</article-title>. <source>Cell Mol Immunol</source> (<year>2021</year>) <volume>18</volume>:<fpage>45</fpage>&#x2013;<lpage>56</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41423-020-00558-8</pub-id>
</citation>
</ref>
<ref id="B36">
<label>36</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Moreno-Fernandez</surname> <given-names>ME</given-names>
</name>
<name>
<surname>Giles</surname> <given-names>DA</given-names>
</name>
<name>
<surname>Stankiewicz</surname> <given-names>TE</given-names>
</name>
<name>
<surname>Sheridan</surname> <given-names>R</given-names>
</name>
<name>
<surname>Karns</surname> <given-names>R</given-names>
</name>
<name>
<surname>Cappelletti</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Peroxisomal beta-oxidation regulates whole body metabolism, inflammatory vigor, and pathogenesis of nonalcoholic fatty liver disease</article-title>. <source>JCI Insight</source> (<year>2018</year>) <volume>3(6):e93626</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.1172/jci.insight.93626</pub-id>
</citation>
</ref>
<ref id="B37">
<label>37</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hiebl</surname> <given-names>V</given-names>
</name>
<name>
<surname>Ladurner</surname> <given-names>A</given-names>
</name>
<name>
<surname>Latkolik</surname> <given-names>S</given-names>
</name>
<name>
<surname>Dirsch</surname> <given-names>VM</given-names>
</name>
</person-group>. <article-title>Natural products as modulators of the nuclear receptors and metabolic sensors LXR, FXR and RXR</article-title>. <source>Biotechnol Adv</source> (<year>2018</year>) <volume>36</volume>:<page-range>1657&#x2013;98</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.bioteChadv.2018.03.003</pub-id>
</citation>
</ref>
<ref id="B38">
<label>38</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cariello</surname> <given-names>M</given-names>
</name>
<name>
<surname>Piccinin</surname> <given-names>E</given-names>
</name>
<name>
<surname>Moschetta</surname> <given-names>A</given-names>
</name>
</person-group>. <article-title>Transcriptional regulation of metabolic pathways via lipid-sensing nuclear receptors PPARs, FXR, and LXR in NASH</article-title>. <source>Cell Mol Gastroenterol Hepatol</source> (<year>2021</year>) <volume>11</volume>:<page-range>1519&#x2013;39</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jcmgh.2021.01.012</pub-id>
</citation>
</ref>
<ref id="B39">
<label>39</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname> <given-names>ZX</given-names>
</name>
<name>
<surname>Shen</surname> <given-names>W</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>H</given-names>
</name>
</person-group>. <article-title>Effects of nuclear receptor FXR on the regulation of liver lipid metabolism in patients with non-alcoholic fatty liver disease</article-title>. <source>Hepatol Int</source> (<year>2010</year>) <volume>4</volume>:<page-range>741&#x2013;8</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s12072-010-9202-6</pub-id>
</citation>
</ref>
<ref id="B40">
<label>40</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gutierrez-Vazquez</surname> <given-names>C</given-names>
</name>
<name>
<surname>Quintana</surname> <given-names>FJ</given-names>
</name>
</person-group>. <article-title>Regulation of the immune response by the aryl hydrocarbon receptor</article-title>. <source>Immunity</source> (<year>2018</year>) <volume>48</volume>:<fpage>19</fpage>&#x2013;<lpage>33</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.immuni.2017.12.012</pub-id>
</citation>
</ref>
<ref id="B41">
<label>41</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Carambia</surname> <given-names>A</given-names>
</name>
<name>
<surname>Schuran</surname> <given-names>FA</given-names>
</name>
</person-group>. <article-title>The aryl hydrocarbon receptor in liver inflammation</article-title>. <source>Semin Immunopathol</source> (<year>2021</year>) <volume>43</volume>:<page-range>563&#x2013;75</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00281-021-00867-8</pub-id>
</citation>
</ref>
<ref id="B42">
<label>42</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lu</surname> <given-names>P</given-names>
</name>
<name>
<surname>Yan</surname> <given-names>J</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>K</given-names>
</name>
<name>
<surname>Garbacz</surname> <given-names>WG</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>P</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Activation of aryl hydrocarbon receptor dissociates fatty liver from insulin resistance by inducing fibroblast growth factor 21</article-title>. <source>Hepatology</source> (<year>2015</year>) <volume>61</volume>:<page-range>1908&#x2013;19</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/hep.27719</pub-id>
</citation>
</ref>
<ref id="B43">
<label>43</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Furman</surname> <given-names>S</given-names>
</name>
<name>
<surname>Nissim-Bardugo</surname> <given-names>E</given-names>
</name>
<name>
<surname>Zeeli</surname> <given-names>S</given-names>
</name>
<name>
<surname>Weitman</surname> <given-names>M</given-names>
</name>
<name>
<surname>Nudelman</surname> <given-names>A</given-names>
</name>
<name>
<surname>Finkin-Groner</surname> <given-names>E</given-names>
</name>
<etal/>
</person-group>. <article-title>Synthesis and in <italic>vitro</italic> evaluation of anti-inflammatory activity of ester and amine derivatives of indoline in RAW 264.7 and peritoneal macrophages</article-title>. <source>Bioorg Med Chem Lett</source> (<year>2014</year>) <volume>24</volume>:<page-range>2283&#x2013;7</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.bmcl.2014.03.081</pub-id>
</citation>
</ref>
<ref id="B44">
<label>44</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xu</surname> <given-names>X</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>S</given-names>
</name>
<name>
<surname>Liang</surname> <given-names>L</given-names>
</name>
<name>
<surname>Lou</surname> <given-names>C</given-names>
</name>
<name>
<surname>He</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Ran</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Role of the aryl hydrocarbon receptor and gut microbiota-derived metabolites indole-3-acetic acid in sulforaphane alleviates hepatic steatosis in mice</article-title>. <source>Front Nutr</source> (<year>2021</year>) <volume>8</volume>:<elocation-id>756565</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fnut.2021.756565</pub-id>
</citation>
</ref>
<ref id="B45">
<label>45</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yan</surname> <given-names>J</given-names>
</name>
<name>
<surname>Tung</surname> <given-names>HC</given-names>
</name>
<name>
<surname>Li</surname> <given-names>S</given-names>
</name>
<name>
<surname>Niu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Garbacz</surname> <given-names>WG</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>P</given-names>
</name>
<etal/>
</person-group>. <article-title>Aryl hydrocarbon receptor signaling prevents activation of hepatic stellate cells and liver fibrogenesis in mice</article-title>. <source>Gastroenterology</source> (<year>2019</year>) <volume>157</volume>:<fpage>793</fpage>&#x2013;<lpage>806 e714</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1053/j.gastro.2019.05.066</pub-id>
</citation>
</ref>
<ref id="B46">
<label>46</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Moyer</surname> <given-names>BJ</given-names>
</name>
<name>
<surname>Rojas</surname> <given-names>IY</given-names>
</name>
<name>
<surname>Kerley-Hamilton</surname> <given-names>JS</given-names>
</name>
<name>
<surname>Hazlett</surname> <given-names>HF</given-names>
</name>
<name>
<surname>Nemani</surname> <given-names>KV</given-names>
</name>
<name>
<surname>Trask</surname> <given-names>HW</given-names>
</name>
<etal/>
</person-group>. <article-title>Inhibition of the aryl hydrocarbon receptor prevents Western diet-induced obesity. Model for AHR activation by kynurenine via oxidized-LDL, TLR2/4, TGF&#x3b2;, and IDO1</article-title>. <source>Toxicol Appl Pharmacol</source> (<year>2016</year>) <volume>300</volume>:<fpage>13</fpage>&#x2013;<lpage>24</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.taap.2016.03.011</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>