We used the RiboTag mouse model (54, 55) crossed with Kiss1Cre mice to identify actively-translated gene transcripts that are co-expressed specifically in MeA Kiss1 neurons, following methods previously described (25, 54, 55). Briefly, RiboTag (Rpl22^HA+ ) mice have a wild-type C-terminal exon floxed on the Rpl22 gene that is followed by three copies of a hemagglutinin (HA) epitope sequence inserted prior to a stop codon (54). Cell-type-specific recombination can be induced by crossing RiboTag mice with a cell type-specific Cre recombinase-expressing mouse line, which leads to Cre-mediated recombination and expression of HA tags on ribosomes only in cells expressing Cre recombinase(54, 56). Here, Rpl22^HA+ mice were crossed with Kiss1Cre mice (courtesy of Carol Elias) (57) to generate Kiss1Cre+/Rpl22^HA+/+ female mice to be used for this study. Kiss1Cre+/Rpl22^HA+/+ mice express the HA-tagged ribosomes only in Kiss1-expressing cells, permitting isolation of ribosome-associated transcripts from just Kiss1 cells in specific brain regions, such as the MeA. In addition to adult (8-10 weeks old) Kiss1Cre+/Rpl22^HA+/+ females, a small cohort of adult Kiss1Cre-/Rpl22^HA+/+ females was used as controls. These control mice do not have HA-tagged ribosomes in Kiss1-expressing cells and therefore, no Kiss1 cell-specific RNA should be isolated. Tail DNA was used to genotype mice via polymerase chain reaction (PCR) to confirm genotypes of Kiss1Cre+/Rpl22^HA+/+ and Kiss1Cre-/Rpl22^HA+/+ mice (henceforth referred to as “Kiss^Ribo” or “Control” mice, respectively). Additionally, any mice with germline recombination were excluded from the study.

In a separate experiment, adult Kiss1Cre/tdTomato mice were used to validate co-expression of select genes in MeA Kiss1 neurons using immunohistochemistry and in situ hybridization co-detection (IHC-ISH). Kiss1Cre/tdTomato mice (“Kiss^tdTom”) were generated by crossing Kiss1Cre mice with tdTomato mice (Ai9 strain, JAX stock #007909) (58), permitting tdtomato fluorescent reporter to be expressed exclusively in Kiss1-expressing cells.

All mice were housed 2-3 per cage (Kiss^Ribo and Control mice) or 2-5 per cage (Kiss^tdTom mice) in a 12hr:12hr light:dark cycle (lights off at 18:00h), with access to food and water ad libitum. All animal procedures were approved by local IACUC committees at the University of California, San Diego (Kiss^Ribo and Control mice) or Albany Medical College (Kiss^tdTom mice).

MeA Kiss1 expression is known to be stimulated by E₂ (20). Thus, all Kiss^Ribo and Control mice were ovariectomized (OVX) at 8 weeks of age, under isoflurane anesthesia, and pre-treated at this time with high dose E₂ (2 mm of 1:30 E2: cholesterol powder) via subcutaneous Silastic capsule for 4 days. This dose of E₂ in mice is known to increase MeA Kiss1 expression, as well as induce E₂ negative feedback to suppress LH levels (13, 14, 17, 18, 20, 25). This E₂ pre-treatment was used to drive sufficient Cre expression in MeA Kiss1 cells in all Kiss^Ribo mice and promote a high degree of incorporation of HA-tagged ribosomes in these neurons, regardless of subsequent E₂ and OVX treatment conditions (25). For consistency between genotypes, Cre- controls were similarly given the E₂ pre-treatment. All pre-treatment E₂ implants were removed after 4 days and all mice were given 7 days to wash out any residual circulating E₂. After the 1-week washout period, half of the mice were re-implanted with a new E₂ Silastic capsule (E₂ group, n = 12 Kiss^Ribo; n=4 Controls), while the remaining females received no additional E₂ treatment and served as the OVX group (n = 12 Kiss^Ribo; n=4 Controls). 5 days after receiving the second E₂ implant (or no implant), all females were euthanized between 11:00h and 14:00h. Blood was collected at this time via retroorbital bleed, and brains were collected fresh frozen on dry ice. Blood serum was assayed for LH concentrations to confirm low LH levels in the E₂-treated group (indicating proper E₂ negative feedback) and elevated LH levels in the OVX group (indicating lack of E₂ negative feedback). Serum LH was measured via a highly sensitive mouse LH radioimmunoassay performed by the University of Virginia Ligand Assay Core (lower detection limit: 0.04 ng/mL; average reportable range: 0.04-75 ng/mL). As expected, E₂-treated OVX females had significantly reduced mean LH levels compared to OVX females lacking E₂ (0.22 ± 0.04 ng/mL vs 3.04 ± 0.22 ng/mL, respectively, p<0.05).

Fresh frozen brains were processed for RiboTag immunoprecipitation. The brain was micro-dissected on a coronal plane and 2 consecutive 400 µm thick slices spanning the MeA region were micro-punched bilaterally using a 2 mm diameter sampling tool. To ensure sufficient yield of isolated mRNA following immunoprecipitation, MeA micro-punches from n = 4 mice were pooled for each treatment (E₂ and OVX groups). The total number of pooled samples per group were as follows: n = 3 for both OVX Kiss^Ribo and E₂ Kiss^Ribo, n = 1 for both OVX and E₂ Cre- controls. Prior to the RiboTag immunoprecipitation, all pooled MeA micro-punch samples were stored at -80°C in 1.7 mL Eppendorf tubes.

For the ISH/IHC co-expression experiments, female Kiss^tdTom mice (n=3) were ovariectomized and received a similar E₂ Silastic capsule for 5 days, as was done for the Kiss^Ribo mice. Brains were then collected in 4% paraformaldehyde, transferred to 30% sucrose 24 hours later, and stored at 4°C prior to slicing. Brains were then sectioned at 25 µm/slice, and sections containing the MeA mounted on SuperFrost Plus slides (Fisher Scientific), air dried, and stored at -80°C until the assay.

RiboTag immunoprecipitation on pooled MeA samples from Kiss^Ribo and Control females was performed following published protocols (54, 56). Some modifications to the original protocol were performed to maximize isolation of ribosomes and their attached mRNA transcripts from MeA Kiss1 neurons (25). Specifically, pooled MeA samples were homogenized in a homogenization buffer solution (72% H2O, 9.6% NP-40, 9.6% 2M KCl, 3.2% 1.5M Tris – pH 7.4, 1.2% 1M MgCl2, 2% Cyclohexamide 5mg/ml, 1% Protease Inhibitors, 1% heparin 100mg/ml, 0.5% RNAsin, and 0.1% DTT) at 3% weight by volume. The samples were then centrifuged at 10K rpm for 10 minutes at 4°C. After centrifugation, 10% of the lysate was saved in a separate tube as the “Input” sample, which contains mRNA from all cell types present in the MeA micropunch, including but not limited to Kiss1 cells. To store the Input samples, 350µL of lysis buffer (from Qiagen Kit #74034) was added and briefly vortexed, and then the samples flash frozen and stored at -80°C. The remaining lysate was then used for the immunoprecipitation procedure. To precipitate Kiss1 cell ribosomes and their associated RNA transcripts from each lysate sample, 0.25µL of antibody/100µL lysate of Biolegend Purified anti-Ha.11 Epitope Tag Antibody (#910501) was added to the remaining lysate volume and incubated for 2 hours on a gentle sample rotator at 4°C. Magnetic beads (Pierce Protein A/G #88803; 25µL beads/100µL sample) were washed with homogenization buffer (described above). Following the antibody incubation, the sample was transferred to the washed magnetic beads and incubated again at 4°C for 1 hour on gentle rotation. The lysate was removed by placing the sample tubes on a magnetic tube rack and the beads washed 3 times for 10 minutes each on a gentle rotator at 4°C with a high salt buffer (53.4% H2O, 30% 2M KCl, 10% NP-40, 3.3% 1.5M Tris – pH 7.4, 1.2% 1M MgCl2, 2% Cyclohexamide 5mg/ml, and 0.05% DTT), using fresh high salt buffer for each wash. Immediately following the washes, 350µL lysis buffer (Qiagen Kit #74034) was added to each sample and vortexed for 30 seconds. Sample tubes were then secured in a magnetic tube rack and the resulting lysate (termed the “IP” sample) was separated from the magnetic beads and transferred into another tube, flash frozen, and stored at -80°C. The IP samples only contain RNA from the HA-tagged ribosomes, which in this experiment were only present in Kiss1 neurons. Thus, the IP samples from Kiss^Ribo mice contained RNA specific to MeA Kiss1 neurons. To extract RNA from the Input and IP samples, the Qiagen RNeasy Plus Micro Kit (#74034) kit was used per kit instructions, and isolated RNA was stored in aliquots at -80°C until RT-PCR and RNA-sequencing.

A double-label ISH/IHC co-detection assay was performed to examine the co-expression of Cck, a gene known to be expressed in the MeA (59, 60), in Kiss1 neurons. This assay was performed on MeA-containing brain slices from adult Kiss^tdTom female mice (1 slice/mouse, n = 3 mice total). The assay measured co-expression of Cck mRNA (cholecystokinin) in MeA Kiss1 neurons (labeled with tdtomato). To perform the co-expression assay, we used Advanced Cell Diagnostics’ RNAscope^® multiplex fluorescent V2 ISH assay with IHC co-detection, with the following RNAscope^® catalog probe: Mm-Cck-C3 – Mus musculus cholecystokinin (Cck) mRNA. For IHC detection of tdtomato, Rockland rabbit anti-RFP (red fluorescent protein, #600-401-379) primary antibody was used along with Invitrogen goat anti-rabbit IgG Alexa Fluor 594 (#A-11037) secondary antibody.

To validate the efficacy of the Kiss1Cre/RiboTag method to isolate mRNA from MeA Kiss1 neurons, we performed RT-PCR on Input and IP samples for Kiss1 and Cck, which is known to be expressed in the MeA where Kiss1 cells are located (59, 60) and was identified in the first experiment ( Figure 1 ) to be co-expressed in Kiss1 neurons. To confirm specificity, we also performed RT-PCR for Avp, a gene known to be expressed in the MeA, but not typically in the posterior MeA where Kiss1 expression is observed (61). RT-PCR was performed using the iScript cDNA Synthesis Kit (Bio-Rad #1708891), per kit instructions, to synthesize cDNA from 10ng of RNA from the Input and IP samples. Using RNA-specific primers for each transcript (Kiss1 Forward-CTGTGTCGCCACCTATGGGG; Kiss1 Reverse- GGCCTCTACAATCCACCTGC; Cck Forward- CTCGGTATGTCTGTGCGTGG; Cck Reverse- GGTCTGGGAGTCACTGAAGG; Avp Forward- CCCGAGTGCCACGACGGTTT; Avp Reverse- CCCGGGGCTTGGCAGAATCC), the levels of Kiss1, Cck, and Avp mRNA in the IP and Input samples were measured via PCR. The PCR reaction mix included 1µL of cDNA, Jumpstart RedTaq mix (Sigma #P0982), forward and reverse primers, and RNase-free water. The PCR conditions were as follows: 94 x15’, (94 x 30”, annealing x 30”, 72 x 60”) repeat 30 times, 72 x 5’, 4 x 5’. The annealing temperature was 57°C for Kiss1 and Cck and 62°C for Avp.

RNA sequencing was performed by the Genomics Center at UC San Diego’s Institute for Genomic Medicine, using RNA from the MeA IP samples of Kiss^Ribo mice, for both E₂ and OVX (no E₂) treatments. Agilent High Sensitivity RNA ScreenTape System was used to determine the quality of all MeA IP RNA samples prior to RNA sequencing, and library preparation was only performed on IP samples with an RNA integrity number >7.6. The library was created using Illumina unstranded mRNA library kits with polyA enrichment. The Illumina HiSeq4000 platform (SR75 run type) was used to perform RNA sequencing. Raw RNA sequencing data quality control analysis was performed using Fastqc v0.11.8, then read trimming was performed using Trimmomatic 0.38, followed by alignment using STAR v2.6.0a, and then quantification of reads (RSEMv1.3.0) using GRCm38.p6/mm10 and Mus-musculus.GRCm38.98.gtf.

The Center for Computational Biology and Bioinformatics at UC San Diego performed all RNA sequencing analyses and statistics. All analyses were limited to known protein coding regions. To prepare for data exploration and preprocessing using edgeR Bioconductor package (62) written in R (63), integration and annotation of sample inputs was performed using per-gene-per-sample counts from both the count preparation and quality control were used with the per-sample RNA-seq metadata. The edgeR Bioconductor package and limma package (64) were used to explore and pre-process annotated data for determining differential gene expression specifically in transcripts produced by MeA Kiss1 neurons. In order to eliminate low-expressing genes from comparative analyses, only transcripts with a mean CPM >1 for all 3 samples in at least one hormone treatment group (OVX or E₂) were used for differential expression (OVX vs E₂) and biological KEGG pathway analyses. The voom technique (65, 66), which utilizes limma and edgeR Bioconductor packages, was used to determine differential expression of any retained transcripts between the two treatment groups (E₂ versus OVX). To test for the presence of specific genes and differential gene expression in annotated functions, pathways, and diseases, the overall data and differential gene data were analyzed with WebGestalt (67). We then performed a KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway analysis (68) using PathView (69) in both E₂ and OVX groups to examine the primary KEGG pathways observed in the overall MeA Kiss1 RNA sequencing dataset, as well as for any pathways that were represented differently between E₂ and OVX groups. The data set containing all identified gene transcripts is available in the Gene Expression Omnibus (geo) data repository (70).

A double-label ISH/IHC co-detection assay was performed to validate the co-expression of Cartpt, a gene found to be highly expressed in our RNA-seq dataset, in MeA Kiss1 neurons. Using brain slices from 3 female Kiss^tdTom mice (1 slice/mouse), a double-label ISH/IHC for Cartpt mRNA and TdTomato, representing MeA Kiss1 cells, was performed using Advanced Cell Diagnostics’ RNAscope^® multiplex fluorescent V2 ISH assay with IHC co-detection, as described previously for the detection of Cck in Kiss1 cells. This assay used the RNAscope catalog probe for Cartpt: Mm-Cartpt-C2 – Mus musculus cocaine- and amphetamine-regulated transcript prepropeptide (Cartpt) mRNA.

The manufacturer’s protocol was followed for multiplex fluorescent V2 ISH assay with IHC co-detection for fixed frozen tissue, with some modifications to preserve tissue integrity. Briefly, slides containing brain slices with the MeA region were briefly washed with Milli-Q water, baked at 60°C for 1 hour, and post-fixed in fresh 4% paraformaldehyde for 2 hours at 4°C. The tissue was dehydrated in 50%, 70%, and 100% ethanol washes, treated with hydrogen peroxide for 10 minutes, washed with Milli-Q water, and baked for an additional 30 minutes at 60°C. Following baking, the tissue was incubated at 98-102°C for 5 minutes in 1X RNAscope^® target retrieval reagent, and briefly washed with Milli-Q water followed by 1X PBS-T. 200µL primary antibody (1:1000, anti-RFP) was added to each slide and slides were incubated overnight at 4°C. On Day 2, the slides were washed 3 times in 1X PBS-T, transferred to fresh 4% paraformaldehyde for 30 minutes at room temperature, followed by four washes in 1X PBS-T. 2-4 drops of Protease Plus was added to each slide and incubated at 40°C for 30 minutes, followed by 3 brief washes in Milli-Q water. Excess liquid was removed and a probe mix (Probe Diluent + RNAscope probe) was added to each slide and hybridized to the tissue at 40°C for 2 hours. The slides were washed twice with RNAscope^® 1X Wash Buffer at room temperature, followed by 3 amplification hybridization steps (AMP 1 and 2 for 30 minutes at 40°C, and AMP 3 for 15 minutes at 40°C) with two washes with 1X wash buffer between each amplification hybridization step. After hybridization, the HRP-C2 fluorescent signal was developed for each respective probe by adding 2-4 drops of HRP-C2 to each sample and incubating for 15min at 40°C, washing twice with 1X wash buffer, incubating with 150µL diluted Opal™ dye for 30 minutes at 40°C, and washing twice with 1X wash buffer. This was repeated again, using HRP-C3 (instead of HRP-C2) to develop the HRP-C3 fluorescent signal. The Opal™ dyes used were: Opal 520 (Cck) and Opal 690 (Cartpt). After developing the HRP-C3 signal, the 200μL secondary antibody (Goat anti-rabbit), diluted 1:100 in co-detection Antibody Diluent, was incubated on each slide for 30 minutes at room temperature, followed by two washes with PBS-T. After incubating with the secondary antibody, 4 drops of DAPI were added to each slide, incubated for 30 seconds, excess DAPI removed, and the slides then immediately coverslipped using ProLong Gold Antifade Mountant. Slides were stored at 4°C in the dark.

Using a Zeiss LSM 880 confocal microscope, images of Cck or Cartpt mRNA with TdTomato fluorescent staining were obtained at 40X (oil) magnification for one unilateral brain slice containing the MeA for each female. For each female, the number of TdTomato (reporter for kisspeptin) cells were identified (minimum 79 cells/mouse) and the number of Kiss1 cells that co-expressed Cck or Cartpt were counted, using the RNAscope manufacturer’s criteria as a guideline (cell = ≥15 clustered dots). The mean percent of MeA Kiss1 cells that contained Cck or Carpt was calculated.

T-tests were performed to compare LH levels between the OVX and E₂-treated females. To statistically test for differences in gene expression between OVX and E₂-treated females, the voom technique, which uses limma and edgeR Bioconductor packages (64–66), was used. This technique using simple linear regression models and produces a modified t-statistic that is interpreted like other t-statistics, with the exception that the standard errors have been moderated across genes using a simple Bayesian model (64–66). The reported p-value for all RNA-seq statistical analyses is an Benjamini-Hochberg-adjusted p-value to account for the number of genes analyzed in the dataset (71). The statistical significance was set so the adjusted p-value < 0.05.

Genes that are co-expressed in MeA kisspeptin neurons are unknown, though Cck is known to be expressed in the MeA region (59, 60), suggesting it may also be expressed specifically in kisspeptin neurons in this region. As a search for a positive control gene that is expressed in MeA kisspeptin neurons, we first performed a double-label assay to assess if Cck is in fact present in MeA kisspeptin neurons. Indeed, we observed that most MeA Kiss1 cells of female mice also express high levels of Cck ( Figure 1 ), with 88% of MeA Kiss1 cells co-expressing Cck mRNA. Thus, Cck expression was selected as a positive control for subsequent Ribotag pulldown validation purposes.

In order to validate the Ribotag isolation procedure, we performed RT-PCR using cDNA from both the Input samples (mRNA from all cells in the MeA micropunches, including Kiss1 cells) and IP samples (mRNA from only Kiss1 cell ribosomes) to confirm that the immunoprecipitation procedure was specific to Kiss1 cells. As expected, both the Input and IP samples of Kiss^Ribo mice contained Kiss1 transcripts ( Figure 2 ). As also expected, Kiss1 was also found in the Input samples of Control (Cre-) mice, but was not detected in the IP samples of these Controls ( Figure 2 ), confirming that the immuno-pulldown was specific to Kiss1 cells that had undergone Cre-mediated recombination to express the HA+ tag. Our positive control gene, Cck, was also found to be highly expressed in all the Input samples as well as in IP samples of both E₂-treated and OVX Kiss^Ribo mice, but not in the IP of Control mice ( Figure 2 ), further validating the selectivity of the Ribotag isolation technique. Given that little is currently known about what genes are or are not expressed in MeA Kiss1 neurons, it is difficult to identify a true negative control. We selected Avp because Avp is expressed in the MeA region, but typically more in the rostral part of the MeA (61), whereas Kiss1 is expressed in the more caudal (posterior) part of the MeA. Thus, AVP and Kiss1 are in different anatomical sub-regions of the MeA and unlikely to be co-expressed in the same cells, serving as a useful negative control for our Riobotag pulldown selectivity. Indeed, here we confirmed that Avp mRNA was present, at low to moderate levels, in all Input samples but was absent in all IP samples ( Figure 2 ), suggesting that MeA Kiss1 cells do not express Avp but other MeA cell types do.

The goal of the current study is to identify what neuropeptides, neurotransmitter synthesis and transport factors, and receptors are made by MeA Kiss1 neurons to begin to understand the regulation and function of this Kiss1 neuronal population. RNA quality for all E₂ and OVX Kiss^Ribo samples was sufficient for RNA-seq, with RNA integrity values of at least 7.6 for all 6 Kiss^Ribo IP samples. As expected, the RNA quality for our Cre- control samples, which lack the HA+ tag in Kiss1 cells, was low, <5.8. Due to the low integrity of the RNA from our control samples, only the Kiss^Ribo IP samples were processed for RNA-seq. The library size for each Kiss^Ribo sample was ≥ 25M total reads per sample, well above the 5-25M reads per sample recommended by Illumina, and well over the 10M reads aligned reach threshold, indicating a high RNA-seq quality. RNA-seq of the Kiss^Ribo samples identified approximately 13,800 different mRNA transcripts, including Kiss1 and Cck, as well as other transcripts such as Esr1, Esr2, Ar, Gal, Cartpt, Pdyn, Oxtr, and Npy2r ( Figure 3 ). Our first analysis identified the top 75 genes expressed by MeA Kiss1 cells, regardless of E₂ treatment. The top 3 most highly expressed genes (Sptbn1, Sptan1, and Sptbn2) are coding genes for spectrin proteins, which are involved in actin crosslinking, cell communication, and cell regulation. Other very highly expressed transcripts included several genes related to intra-cell signaling, such as Gprasp1, Atp1a3, Calm1, and Ywhag, genes important for protein synthesis and regulation, including Cpe, Hspa8, Hsp90ab1, Eef1a1, and Ubb, and genes involved with secretion and synapses, like App, Syp, and Rtn1. The 75 transcripts with the highest overall mean expression (i.e., the mean expression of all OVX and E₂ samples combined) in MeA Kiss1 cells are listed in Table 1 .

Many transcripts for genes encoding neuropeptides, receptors, and proteins involved in neurotransmitter synthesis or transport were found to be highly expressed in the RNA-seq data. In addition to Gabbr1 and Gabbr2 being expressed in the RNA-seq dataset, which supports previous co-expression double-label assays with GABA_BR and Kiss1 in the MeA (19), the RNAseq identified new transcripts that appear to be expressed by MeA Kiss1 cells, some of which are implicated in reproductive function or other behaviors. Aside from Kiss1, RNAseq identified other neuropeptides implicated in modulating reproduction, metabolism, and stress, such as Cck, Pdyn, Tac1, Gal, Cartpt, Trh, Sst, Npy, Agt, Vgf, and Penk ( Table 2 ). Transcripts related to GABA synthesis and transport, like Vgat, Gad1, and Gad2, were also expressed, as were genes important for glutamate transport and synthesis, such as Glud1, Vglut1, and Vglut2 ( Table 2 ). Table 2 provides a more detailed list of ligand (or their related enzymes) gene transcripts identified in this RNA-seq dataset. A few ligands of interest that were absent include Avp, C3, Calca, Nmu, Oxt, Ghrh, Gnrh1, and Tshb.

We examined transcripts for receptors in the RNA-seq data, which might provide insight into how MeA Kiss1 neurons are regulated, either by hormones or neural signaling. Sex steroid receptors were present, as might be predicted given estrogen’s known ability to upregulate Kiss1 in the MeA. Specifically, estrogen receptor alpha (Esr1), androgen receptor (Ar), and progesterone receptor (Pgr) were each moderately expressed, while estrogen receptor beta (Esr2) had lower expression levels ( Table 3 ). Some additional receptors expressed in the RNA-seq data include Gabbr1, Gabbr2, Cnr1, Crhr1, Crhr2, Npy1r, Npy2r, Npy5r, Tacr1, and Thra. A more detailed list of the receptors expressed by MeA Kiss1 cells is in Table 3 . Of note, the following gene transcripts are for some receptors that were absent (not expressed) in the current RNA-seq dataset: Chrna5, Ahrnb4, Pacapr1, Gpr50, Nmur2, P2rx2, Aplnr, Bdkrb2, Chrnb1, Lpar4, Npy4r, Rxfp2, Sctr, and Tbxa2r.

Kiss1 gene expression in the MeA is known to be upregulated with E₂ treatment whereas Kiss1 levels in the MeA are very low or absent in gonadectomized mice lacking E₂. Thus, we hypothesized that other gene transcripts in MeA Kiss1 cells might also change expression levels in the presence/absence of E₂. Of the approximately 13,800 transcripts identified in the current RNA-seq data, only 45 genes had significantly different expression levels following 5-day E₂ treatment, in comparison to OVX mice lacking E₂ ( Table 4 ; Figure 4 ). 10 of these genes were more highly expressed in OVX females ( Figure 3 , orange dots; Figure 4 ), while the remaining 35 genes were more highly expressed in E₂-treated females ( Figure 3 , green dots; Figure 4 ). Table 4 provides a complete list of these differentially expressed genes, while Figure 4 is a heat map representing the expression patterns of each differentially expressed transcript for each of the 3 IP samples per treatment. As expected, Kiss1 is more highly expressed in E₂-treated females in comparison to OVX females ( Table 4 , Figure 4 ). In addition to Kiss1, E₂ treatment upregulated transcripts encoding Galanin (Gal) and oxytocin receptor (Oxtr) as well as those for fibroblast growth factor receptor 1 (Fgfr1) and prokineticin receptor 2 (Prokr2), two genes whose loss of function results in Kallmann syndrome (72, 73), and relaxin family peptide receptor 1 (Rxfp1), which is implicated in regulating sperm motility, pregnancy and birth (74, 75). Scg2 and Ecel1 (Endothelin Converting Enzyme Like 1) are important for neuropeptide release and are also higher in E₂-treated than OVX females. E₂ treatment also resulted in greater expression in several genes linked to obesity and/or diabetes (insulin receptor substrate 2, Irs2 (76); Neuropeptide Y receptor 2, Npy2r (77); Transcription Elongation Regulator 1 Like, Tcerg1l (78)), nervous system development (roundabout guidance receptor 3: Robo3 (79)), and cancer (acid sensing ion channel 2, Asic2 (80); Family With Sequence Similarity 107 Member A, FAM107A (81)). Though more gene transcripts were upregulated by E₂, several genes were downregulated by E₂ including Esr1, Cytochrome P450 Family 26 Subfamily B Member 1 (Cyp26b1; steroid synthesis), EPH receptor A4 (Epha4; nervous system development), and two genes linked to cancer (Paternally Expressed Gene 10, Peg10; Inka Box Actin Regulator 2, Inka2). Interestingly, most of the gene transcripts produced by MeA Kiss1 cells were not found to be significantly regulated by E₂ in the present study ( Figure 3 , grey dots; Figure 4 ).

Biological pathway analysis, using KEGG pathways (68), was completed to identify potential functions of MeA Kiss1 cells. Pathway analysis examines how sets of gene transcripts cluster together to affect various biological processes. The top biological KEGG pathways with the lowest false discovery rate (pGFdr) were identified ( Table 5 ). These pathways involve signaling pathways, such as the MAPK signaling pathway, calcium signaling pathway, and neurotrophin signaling pathway. Other interesting pathways include pathways for amphetamine addiction and alcoholism, as well as those involved in regulating diseases, such as basal cell carcinoma and herpes simplex infection. There were no KEGG pathways identified that were significantly altered by E₂ treatment.

The RNA-seq data suggested that MeA Kiss1 cells express >13,800 gene transcripts, almost all of which have never been reported before for this specific Kiss1 population. Therefore, in addition to validating our immuno-pulldown procedure via RT-PCR ( Figure 2 ), we performed double-label ISH/IHC on brains from female Kiss^tdTom mice to confirm the co-expression of a gene identified in the RNA-seq dataset that was not previously known to be present in MeA Kiss1 neurons (Cartpt; Figure 5 , Table 2 ). We found that Cartpt mRNA was highly expressed in MeA brain slices, including very high overlap with MeA kisspeptin cells (tdTomato fluorescence; Figure 5 ). Quantitatively, virtually all Kiss1 ^TdTomato cells (99%) in the MeA expressed Cartpt in this ISH/IHC assay.