<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Endocrinol.</journal-id>
<journal-title>Frontiers in Endocrinology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Endocrinol.</abbrev-journal-title>
<issn pub-type="epub">1664-2392</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fendo.2022.863360</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Endocrinology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Identification of SF-1 and <italic>FOXL2</italic> and Their Effect on Activating P450 Aromatase Transcription <italic>via</italic> Specific Binding to the Promoter Motifs in Sex Reversing <italic>Cheilinus undulatus</italic>
</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Ji</surname>
<given-names>Xinxin</given-names>
</name>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Bu</surname>
<given-names>Shaoyang</given-names>
</name>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhu</surname>
<given-names>Yi</given-names>
</name>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Yi</given-names>
</name>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wen</surname>
<given-names>Xin</given-names>
</name>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Song</surname>
<given-names>Feibiao</given-names>
</name>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Luo</surname>
<given-names>Jian</given-names>
</name>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/936063"/>
</contrib>
</contrib-group>
<aff id="aff1">
<institution>State Key Laboratory of Marine Resorce Utilization in South China Sea, Hainan Aquaculture Breeding Engineering Research Center, Hainan Academician Team Innovation Center, Hainan University</institution>, <addr-line>Haikou</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Gustavo M. Somoza, Instituto Tecnol&#xf3;gico de Chascom&#xfa;s (CONICET-UNSAM), Argentina</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Kohei Ohta, Kyushu University, Japan; Xin Qi, Ocean University of China, China</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Jian Luo, <email xlink:href="mailto:luojian@hainanu.edu.cn">luojian@hainanu.edu.cn</email>
</p>
</fn>
<fn fn-type="equal" id="fn003">
<p>&#x2020;These authors have contributed equally to this work</p>
</fn>
<fn fn-type="other" id="fn002">
<p>This article was submitted to Experimental Endocrinology, a section of the journal Frontiers in Endocrinology</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>10</day>
<month>05</month>
<year>2022</year>
</pub-date>
<pub-date pub-type="collection">
<year>2022</year>
</pub-date>
<volume>13</volume>
<elocation-id>863360</elocation-id>
<history>
<date date-type="received">
<day>31</day>
<month>01</month>
<year>2022</year>
</date>
<date date-type="accepted">
<day>08</day>
<month>03</month>
<year>2022</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2022 Ji, Bu, Zhu, Wang, Wen, Song and Luo</copyright-statement>
<copyright-year>2022</copyright-year>
<copyright-holder>Ji, Bu, Zhu, Wang, Wen, Song and Luo</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>The giant wrasse <italic>Cheilinus undulatus</italic> is a protogynous socially hermaphroditic fish. However, the physiological basis of its sex reversal remains largely unknown. <italic>cyp19</italic> is a key gender-related gene encoding P450 aromatase, which converts androgens to estrogens. <italic>cyp19</italic> transcription regulation is currently unknown in socially sexually reversible fish. We identified <italic>NR5A1</italic> by encoding SF-1, and <italic>FOXL2</italic> from giant wrasse cDNA and <italic>cyp19a1a</italic> and <italic>cyp19a1b</italic> promoter regions were cloned from genomic DNA to determine the function of both genes in <italic>cyp19a1</italic> regulation. Structural analysis showed that SF-1 contained a conserved DNA-binding domain (DBD) and a C-terminal ligand-binding domain (LBD). FOXL2 was comprised of an evolutionarily conserved Forkhead domain. <italic>In vitro</italic> transfection assays showed that SF-1 could upregulate <italic>cyp19a1</italic> promoter activities, but FOXL2 could only enhance <italic>cyp19a1b</italic> promoter transcriptional activity in the HEK293T cell line. Furthermore, HEK293T and COS-7 cell lines showed that co-transfecting the two transcription factors significantly increased <italic>cyp19a1</italic> promoter activity. The &#x2212;120 to &#x2212;112 bp (5&#x2032;-CAAGGGCAC-3&#x2032;) and &#x2212;890 to &#x2212;872 bp (5&#x2032;-AGAGGAGAACAAGGGGAG-3&#x2032;) regions of the <italic>cyp19a1a</italic> promoter were the core regulatory elements for SF-1 and FOXL2, respectively, to regulate <italic>cyp19a1b</italic> promoter transcriptional activity. Collectively, these results suggest that both FOXL2 and SF-1 are involved in giant wrasse sex reversal.</p>
</abstract>
<kwd-group>
<kwd>promoter</kwd>
<kwd>SF-1</kwd>
<kwd>
<italic>FOXL2</italic>
</kwd>
<kwd>
<italic>cyp19a1a</italic>
</kwd>
<kwd>
<italic>cyp19a1b</italic>
</kwd>
<kwd>transcriptional regulation</kwd>
</kwd-group>
<counts>
<fig-count count="13"/>
<table-count count="1"/>
<equation-count count="0"/>
<ref-count count="42"/>
<page-count count="14"/>
<word-count count="5050"/>
</counts>
</article-meta>
</front>
<body>
<sec id="s1">
<title>1 Introduction</title>
<p>In many teleost species, sex fate is not an irreversible deterministic process. Instead, it is actively regulated <italic>via</italic> the suppression or activation of opposing genetic networks, creating the potential for flexibility in sexual phenotype in adulthood (<xref ref-type="bibr" rid="B1">1</xref>). Under natural conditions, many fish exhibit sequential hermaphroditism, including female-to-male (protogynous), male-to-female (protandrous), or bidirectional (serial) sex changes. Sex changes involve complex coordinated transformations across multiple biological systems, including behavioral, anatomical, neuroendocrine, and molecular axes. P450 aromatase is a key enzyme in the hormonal steroidogenic pathway (<xref ref-type="bibr" rid="B2">2</xref>), playing a switch role in converting androgen to estrogen and is the key enzyme in sex determination and differentiation (<xref ref-type="bibr" rid="B3">3</xref>). Estrogens and <italic>cyp19a1a</italic> are critical in controlling ovarian and testicular differentiation in gonochoristic and hermaphroditic fish species (<xref ref-type="bibr" rid="B4">4</xref>). Teleosts exhibit intense aromatase activity because of the strong expression of one of the two aromatase genes (aromatase A or <italic>cyp19a1a</italic> and aromatase B or <italic>cyp19a1b</italic>) that arise from a gene duplication event. Interestingly, only radial glial cells (RGC) express aromatase B in adult fish (<xref ref-type="bibr" rid="B5">5</xref>).</p>
<p>Fushi-tarazu factor-1 (FTZ-F1) is a member of the orphan nuclear receptor family discovered in <italic>Drosophila</italic>. According to function and expression type, <italic>FTZ-F1</italic> gene is divided into two subgroups, and the liver receptor hormone-1 gene (<italic>LRH-1</italic>) constitutes the nuclear receptor subfamily 5 group A member 2 (<italic>NR5A2)</italic> subgroup, mainly expressed in the liver. Steroidogenic factor-1 (SF-1/adrenal 4 binding protein (Ad4BP)) is part of the <italic>NR5A1</italic> subgroup and is mainly expressed in tissues related to steroid synthesis (<xref ref-type="bibr" rid="B6">6</xref>). Therefore, SF-1 is used as a steroid-producing factor to regulate gonadal development and sex determination (<xref ref-type="bibr" rid="B7">7</xref>). SF-1 potentially plays a role in transcriptional regulation of P450 aromatase gene (<italic>cyp19a1</italic>) in medaka ovarian follicles (<xref ref-type="bibr" rid="B8">8</xref>). SF-1 directly binds to the <italic>cyp19a1</italic> promoter on a conserved binding site to activate <italic>cyp19a1</italic> mRNA transcription in chicken ovaries (<xref ref-type="bibr" rid="B9">9</xref>). In mammals, SF-1 knockout male mice showed abnormal and underdeveloped testis structure. Additionally, the expression of <italic>cyp11a</italic> and the steroidogenic acute regulatory protein (<italic>STAR</italic>), two Leydig cell function markers, was impaired, indicating a defect in androgen biosynthesis (<xref ref-type="bibr" rid="B10">10</xref>). Collectively, SF-1 could be crucial in sex reversal in giant wrasses by regulating <italic>cyp19</italic> gene transcription.</p>
<p>On the other hand, Forkhead (FH) box (FOX) L2 (FOXL2), another important transcription factor discovered in dermatolysis palpebrarum, is a member of the FOX transcription factor family. In recent decades, <italic>FOXL2</italic> has been recognized as a key gene in ovarian differentiation and egg formation in vertebrates (especially mammals) (<xref ref-type="bibr" rid="B11">11</xref>). Many FOXL2 target genes have been discovered, including genes involved in steroid production (such as <italic>STAR</italic>, <italic>cyp17</italic>, and aromatase), inflammation (such as nuclear factor of activated T cells (<italic>NFAT</italic>), prostaglandin-endoperoxide synthase (<italic>PTGS2</italic>), and code dystrophy 2 (<italic>COD2</italic>)), and apoptosis/detoxification (such as manganese superoxide dismutase (<italic>MnSOD</italic>)) (<xref ref-type="bibr" rid="B12">12</xref>, <xref ref-type="bibr" rid="B13">13</xref>). <italic>FOXL2</italic> also participates in aromatase transcriptional regulation (<xref ref-type="bibr" rid="B14">14</xref>). In Nile tilapia, FOXL2 directly binds to the promoter region of <italic>cyp19a1</italic> through its FH domain to activate <italic>cyp19a1</italic> transcription. FOXL2 can also interact with the ligand-binding domain (LBD) of Ad4BP/SF-1 to enhance Ad4BP/SF-1-mediated <italic>cyp19a1</italic> transcription (<xref ref-type="bibr" rid="B15">15</xref>). Recent studies using catfish have shown that <italic>FOXL2</italic> mainly interacts with the cytochrome P450 protein family (<xref ref-type="bibr" rid="B16">16</xref>). Similarly, transient transfection of Japanese flounder showed that FOXL2 and cAMP analogs could activate <italic>cyp19a1</italic> transcription <italic>in vitro</italic> (<xref ref-type="bibr" rid="B17">17</xref>). These results indicate that <italic>FOXL2</italic> may be crucial in ovarian differentiation in bony fish by regulating aromatase expression and steroid production pathways. Recent studies have shown that FOXL2 can directly bind to SF-1 or act as a nuclear receptor co-modulator to regulate ovarian steroidogenesis and follicular development (<xref ref-type="bibr" rid="B15">15</xref>). Therefore, in this study, we presumed that FOXL2 and SF-1 were candidate factors that regulate <italic>cyp19a1</italic> expression in giant wrasses.</p>
<p>As an imminent danger species, the fishing industry has sharply decreased the giant wrasse population (<xref ref-type="bibr" rid="B18">18</xref>). However, artificially reproducing this species is limited by the small number of male fish. As a social animal, a colony of giant wrasses allows only one male to be present (<xref ref-type="bibr" rid="B19">19</xref>). Indeed, research on sex reversal in giant wrasses is urgent. In the present study, we identified and cloned SF-1 and <italic>FOXL2</italic> cDNA sequences from a giant wrasse and tested both factors in <italic>cyp19a1</italic> transcriptional regulation by utilizing two cell lines (HEK293T and COS-7). Examining <italic>cyp19a1</italic> promoter deletions and mutations confirmed the SF-1 and FOXL2 binding sites in the <italic>cyp19a1</italic> promoter.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<title>2 Materials and Methods</title>
<sec id="s2_1">
<title>2.1 The Experimental Fish</title>
<p>A 2-year-old wild and healthy giant wrasse was purchased from the Hainan Qionghai Fishing Port Terminal and Guangzhou Huangsha Fishery Market. The fish was anesthetized in ice, and samples from the brain and gonads were taken and stored in liquid nitrogen for future use. All animal handling procedures were conducted under the Institutional Animal Care and Use Committee of Hainan University.</p>
</sec>
<sec id="s2_2">
<title>2.2 Cloning of Giant Wrasse SF-1 and <italic>FOXL2</italic> and Expression Vector Construction</title>
<p>RNA was extracted using TRIzol reagent, according to the manufacturer&#x2019;s instructions. The Prime Script&#x2122; RT Reagent Kit with a gDNA Eraser (Perfect Real Time) was used to synthesize cDNA templates. The reverse transcription products were stored at &#x2212;20&#xb0;C for later use. cDNA fragments were cloned into PGEM-Teasy plasmids using the SF-1 F1, SF-1 R1, <italic>FOXL2</italic> F1, and <italic>FOXL2</italic> R1 primers to amplify the target fragments. For this study, SF-1 open reading frame (ORF) F1, SF-1 ORF R1, <italic>FOXL2</italic> ORF F1, and <italic>FOXL2</italic> ORF R1 were used to amplify <italic>Hin</italic>dIII, <italic>Xho</italic>I, and <italic>Xho</italic>I and <italic>Eco</italic>RI restriction sites. According to the restriction endonuclease site existing in pCDNA3.1, a suitable enzyme that was the same as the fragment multi-band restriction site was selected to double-digest the pCDNA3.1 vector. The SF-1 and <italic>FOXL2</italic> ORF sequences were ligated into the pCDNA3.1 plasmid, and then the recombinant plasmid was transferred into the DH5&#x3b1; competent cell. Finally, the recombinant plasmid containing the target fragment was screened and identified, and the promoter sequence was obtained using the GenomeWalker method. The cloning method was performed according to the Universal GenomeWalker&#x2122; 2.0 User Manual. <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref> lists all the primers used for cloning and vector construction.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Primers used in genes cloning and vector construction.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Name</th>
<th valign="top" align="center">Sequence</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">SF-1 F1</td>
<td valign="top" align="left">AAGCAGTGGTATCAACGC</td>
</tr>
<tr>
<td valign="top" align="left">SF-1 R1</td>
<td valign="top" align="left">CCCTCACACGCACGCTTGCTT</td>
</tr>
<tr>
<td valign="top" align="left">FOXL2 F1</td>
<td valign="top" align="left">ATGATGGCCACTTACCAA</td>
</tr>
<tr>
<td valign="top" align="left">FOXL2 R1</td>
<td valign="top" align="left">TTAAATATCAATCCTCGTGTGTAACG</td>
</tr>
<tr>
<td valign="top" align="left">SF-1 ORF F1</td>
<td valign="top" align="left">CCGCTCGAGATGTTGGGAGATAAATCTCACG</td>
</tr>
<tr>
<td valign="top" align="left">SF-1 ORF R1</td>
<td valign="top" align="left">CCCAAGCTTTCACACGCACGCTTGCTT</td>
</tr>
<tr>
<td valign="top" align="left">FOXL2 ORF F1</td>
<td valign="top" align="left">CCGCTCGAGATGATGGCCACTTACCAAAACC</td>
</tr>
<tr>
<td valign="top" align="left">FOXL2 ORF R1</td>
<td valign="top" align="left">GGCCTTAAGTTAAATATCAATCCTCGTGTGTAACG</td>
</tr>
<tr>
<td valign="top" align="left">Cyp19a1a-Q-F1</td>
<td valign="top" align="left">CGGGGTACCAAAAAATGTTTTTGCAGCATTCATT</td>
</tr>
<tr>
<td valign="top" align="left">Cyp19a1a-Q-R1</td>
<td valign="top" align="left">CCCAAGCTTTGCCACTGAGGTAGCATTTC</td>
</tr>
<tr>
<td valign="top" align="left">Cyp19a1b-Q-F1</td>
<td valign="top" align="left">CGGGGTACCAGGCAGGAAACACTCACACTC</td>
</tr>
<tr>
<td valign="top" align="left">Cyp19a1b-Q-R1</td>
<td valign="top" align="left">CCCAAGCTTAAGCCTTCGCCTTACTGGTTG</td>
</tr>
<tr>
<td valign="top" align="left">S-A1A-1255-F</td>
<td valign="top" align="left">CCCAAGCTTCTCTACAAGCCCTCTAGGAC</td>
</tr>
<tr>
<td valign="top" align="left">S-A1A-111-F</td>
<td valign="top" align="left">CCCAAGCTTAGGCTGGCATGAATCCAG</td>
</tr>
<tr>
<td valign="top" align="left">S-A1A-21-F</td>
<td valign="top" align="left">CCCAAGCTTGGTCAGCGGCTCACACTT</td>
</tr>
<tr>
<td valign="top" align="left">S-A1B-1795-F</td>
<td valign="top" align="left">CCCAAGCTTAAGTGCTTGGACCAAAAG</td>
</tr>
<tr>
<td valign="top" align="left">S-A1B-1534-F</td>
<td valign="top" align="left">CCCAAGCTTCAGCATCAGCATGTCCTT</td>
</tr>
<tr>
<td valign="top" align="left">S-A1B-1501-F</td>
<td valign="top" align="left">CCCAAGCTTCGTCGGCTCTTCTTCCAG</td>
</tr>
<tr>
<td valign="top" align="left">S-A1B-864-F</td>
<td valign="top" align="left">CCCAAGCTTCTTTCTTTGCATCGACA</td>
</tr>
<tr>
<td valign="top" align="left">S-A1B-504-F</td>
<td valign="top" align="left">CCCAAGCTTAACATTCCTGGAATCC</td>
</tr>
<tr>
<td valign="top" align="left">F-A1B-1097-F</td>
<td valign="top" align="left">CCCAAGCTTTGTCAAAATCTGTCTGTA</td>
</tr>
<tr>
<td valign="top" align="left">F-A1B-1026-F</td>
<td valign="top" align="left">CCCAAGCTTGCTAAAATGCAAAGTCCC</td>
</tr>
<tr>
<td valign="top" align="left">F-A1B-871-F</td>
<td valign="top" align="left">CCCAAGCTTAGAGGAGAACAAGGGGR</td>
</tr>
<tr>
<td valign="top" align="left">Cyp19a1a-MutSF-1#1-F2</td>
<td valign="top" align="left">CGGGGTACCAAAAAATGTTTTTGCAGCATTCATTCTCTACAAGCCC</td>
</tr>
<tr>
<td valign="top" align="left">Cyp19a1a-MutSF-1#1-R2</td>
<td valign="top" align="left">GGGCTTGTAGAGAATGAATGCTGCAAAAACATTTTTTGGTACCCCG</td>
</tr>
<tr>
<td valign="top" align="left">Cyp19a1a-MutSF-1#2-F3</td>
<td valign="top" align="left">CTGTACGCTAGGCTGGCA</td>
</tr>
<tr>
<td valign="top" align="left">Cyp19a1a-MutSF-1#2-R3</td>
<td valign="top" align="left">TGCCAGCCTAGCGTACAG</td>
</tr>
<tr>
<td valign="top" align="left">Cyp19a1a-MutSF-1#3-F4</td>
<td valign="top" align="left">TGCATCACCGGTCAGCGG</td>
</tr>
<tr>
<td valign="top" align="left">Cyp19a1a-MutSF-1#3-R4</td>
<td valign="top" align="left">CCGCTGACCGGTGATGCA</td>
</tr>
<tr>
<td valign="top" align="left">Cyp19a1b-MutSF-1#1-F2</td>
<td valign="top" align="left">TGGTAACAGATAAGTGCTTGGA</td>
</tr>
<tr>
<td valign="top" align="left">Cyp19a1b-MutSF-1#1-R2</td>
<td valign="top" align="left">TCCAAGCACTTATCTGTTACCA</td>
</tr>
<tr>
<td valign="top" align="left">Cyp19a1b-MutSF-1#2-F3</td>
<td valign="top" align="left">GAACCATGCAGCATCA</td>
</tr>
<tr>
<td valign="top" align="left">Cyp19a1b-MutSF-1#2-R3</td>
<td valign="top" align="left">TGATGCTGCATGGTTC</td>
</tr>
<tr>
<td valign="top" align="left">Cyp19a1b-MutFOXL2#1-F2</td>
<td valign="top" align="left">GATTCAGGAAGTGCTT</td>
</tr>
<tr>
<td valign="top" align="left">Cyp19a1b-MutFOXL2#1-R2</td>
<td valign="top" align="left">AAGCACTTCCTGAATC</td>
</tr>
<tr>
<td valign="top" align="left">Cyp19a1b-MutFOXL2#2-F3</td>
<td valign="top" align="left">AAATGACGTTGTTTGCC</td>
</tr>
<tr>
<td valign="top" align="left">Cyp19a1b-MutFOXL2#2-R3</td>
<td valign="top" align="left">GAATAAATACAAGGGGAG</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_3">
<title>2.3 Promoters and Sequence Analysis</title>
<p>Pomoter regions of the <italic>cyp19a1a</italic> and <italic>cyp19a1b</italic> were isolated by genome walking. The online software ALGGEN-PROMO (<uri xlink:href="http://alggen.lsi.upc.es/cgi-bin/promo_v3/promo/promoinit.cgi?dirDB=TF_8.3">http://alggen.lsi.upc.es/cgi-bin/promo_v3/promo/promoinit.cgi?dirDB=TF_8.3</uri>) was used to predict the <italic>cyp19a1a</italic> and <italic>cyp19a1b</italic> transcription binding sites of SF-1 and FOXL2. The giant wrasse&#x2019;s <italic>NR5A1</italic> and <italic>FOXL2</italic> gene sequences were spliced using DNAMAN software. The ORF was identified using the ORF Finder (<uri xlink:href="https://www.ncbi.nlm.nih.gov/orffinder/">https://www.ncbi.nlm.nih.gov/orffinder/</uri>). The National Center for Biotechnology Information (NCBI) database (<uri xlink:href="https://www.ncbi.nlm.nih.gov/">https://www.ncbi.nlm.nih.gov/</uri>) was used to identify the coding regions and amino acid sequences. The online software Signal P4.1 was used to predict the signal peptides of <italic>NR5A1</italic> and <italic>FOXL2</italic> genes in the giant wrasse. In addition, an adjacency (neighbor joining (NJ)) phylogenetic tree was constructed based on amino acid sequence alignment using MEGA 5.0. GeneDoc software was used for multiple sequence alignments.</p>
</sec>
<sec id="s2_4">
<title>2.4 Constructing SF-1 and <italic>FOXL2</italic> Progressive Deletions and Site Mutants in Aromatase <italic>cyp19a1</italic> Promoters</title>
<p>In this study, the <italic>cyp19a1a</italic> and <italic>cyp19a1b</italic> promoters were analyzed using online software, and the SF-1 and FOXL2 binding positions in their sequences were predicted. The promoters were deleted from the analysis. Primers were designed with restriction sites AAGCTT and GGTACC of restriction endonuclease (<italic>Hin</italic>dIII and <italic>Kpn</italic>I). Progressive deletion fragments were constructed using a pGL-4.10 fluorescent expression vector. Based on the effect of transcription factors on the progressive deletion of the promoter, the scope of key transcription binding sites was narrowed, and specific primers were designed to clone the full-length sequence of site-directed mutations by fusion PCR. The ORFs of <italic>NR5A1</italic> and <italic>FOXL2</italic> were ligated using gene-specific primers, restriction endonucleases, and the pCDNA3.1 vector to construct a site-mutant expression vector.</p>
</sec>
<sec id="s2_5">
<title>2.5 Cell Culture, Transient Transfection, Hormone Treatment, and Luciferase Assays</title>
<p>HEK 293T and COS7 cell lines were grown in Dulbecco&#x2019;s modified Eagle&#x2019;s medium (DMEM) supplemented with 10% fetal bovine serum, 2 mM of <sc>l</sc>-glutamine, 100 U/ml of penicillin, and 0.1 mg/ml of streptomycin in 5% CO<sub>2</sub> and cultured at 37&#xb0;C. The confluent cells were seeded in a 24-well plate. The transfection rate was maintained at ~ 90% at the time of transfection. The specific experimental components were as follows: 1) 250 ng of complete 5&#x2032; upstream or deletion constructs (normal and mutated) of <italic>cyp19a1a</italic> and <italic>cyp19a1b</italic> promoters cloned into the pGL-4.10 (firefly luciferase) vector and 2) 200 ng of pcDNA3.1 expression plasmid (Invitrogen, Carlsbad, CA, USA) containing ORF cDNAs encoding SF-1 and FOXL2. A 5 ng/well of Renilla luciferase (CMV) vector (Promega, Madison, WI, USA) was used as an internal control. Luciferase assays were performed 48 h after transfection using the Dual-Luciferase Reporter Assay System (Promega). Renilla luciferase activity was used to normalize firefly luciferase activity. Luminescence was measured using a GloMax<sup>&#xae;</sup>96 microplate luminometer (Promega). The plasmids used in the transfection experiments were prepared using an Endo Free Plasmid Isolation Kit.</p>
</sec>
<sec id="s2_6">
<title>2.6 Statistical Analysis</title>
<p>The experimental cell data were set up in four parallels per group. A one-way ANOVA was performed, and the results are expressed as the mean &#xb1; SD. Statistical significance was set at <italic>p</italic> &lt; 0.05. * represents a significant difference between the data. SPSS and DPS software was used to perform the statistical analyses and constructed graphs using GraphPad Prism version 5.</p>
</sec>
</sec>
<sec id="s3">
<title>3 Results</title>
<sec id="s3_1">
<title>3.1 Characterizing SF-1 and <italic>FOXL2</italic> cDNA</title>
<p>The SF-1 and <italic>FOXL2</italic> cDNA sequences were cloned and sequenced. The gene encoding SF-1 had a 1,467-bp ORF encoding 488 amino acid residues (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>). The predicted protein (SF-1) had a molecular weight of 55 kDa and a theoretical isoelectric point (pI) of 7.06. <italic>FOXL2</italic> had a 921-bp ORF encoding 306 amino acid residues (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref>). The predicted FOXL2 protein had a molecular weight of 34.59 kDa and a theoretical pI of 9.21.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Nucletide and amino acid sequences of <italic>C. undulates SF-1</italic> and <italic>FOXL2</italic>. <bold>(A)</bold> Nucletide and amino acid sequences of <italic>C. undulates SF-1</italic>. The black box marks the start codon ATG and the stop codon TGA. The black typeface is the nucleotide sequence, the red typeface is the amino acid sequence. <bold>(B)</bold> Nucletide and amino acid sequences of <italic>C. undulates FOXL2</italic>. The black box marks the start codon ATG and the stop codon TAA.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-13-863360-g001.tif"/>
</fig>
</sec>
<sec id="s3_2">
<title>3.2 Homology and Phylogenetic Analysis</title>
<p>Multiple sequence alignment was conducted to compare the amino acid sequences of SF-1 with those of other vertebrates. It showed that SF-1 was conserved in different aquatic animals (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>). Conserved domain analysis indicated that the SF-1 amino acid sequence contained two domains: a conserved DNA-binding domain (DBD) and a C-terminal LBD. FOXL2 consisted of an evolutionarily conserved FH domain (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2B</bold>
</xref>). In addition, a phylogenetic tree was constructed based on the SF-1 amino acid sequences from giant wrasse and 13 other species. As <xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref> shows, SF-1 was most closely related to <italic>Labrus bergylta</italic> SF-1, clustered with <italic>Larimichthys crocea</italic>, and formed a subgroup. SF-1 also showed high similarity to other teleosts and had a relatively long homology with mammalian, avian, and amphibian species. The <italic>FOXL2</italic> homology comparison results were similar to those of SF-1. <italic>FOXL2</italic> showed the closest relationship with <italic>L. bergylta FOXL2. FOXL2</italic> also showed relatively distant homology with mammalian, avian, and amphibian species (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3B</bold>
</xref>). In summary, the molecular evolution of SF-1 and <italic>FOXL2</italic> was consistent with species evolution.</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Amino acids sequence alignment of <italic>C. undulates SF-1</italic> and <italic>FOXL2</italic>. <bold>(A)</bold> Amino acids sequence alignment of <italic>C. undulates SF-1</italic>. The black box represents the conserved DNA binding domain (DBD). The yellow box represents the C-terminal ligand binding domain (LBD). <bold>(B)</bold> Amino acids sequence alignment of <italic>C. undulates FOXL2</italic>. The red box represents the conserved Forkhead (FH) domain.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-13-863360-g002.tif"/>
</fig>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Phylogenetic analysis of <italic>C. undulates</italic> with other vertebrate <italic>SF-1</italic> <bold>(A)</bold> and <italic>FOXL-2</italic> <bold>(B)</bold>. The pylogenetic tree is constructed using the Mega 5.0 adjacency method. Data were resampled with 1,000 bootstrap replicates.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-13-863360-g003.tif"/>
</fig>
</sec>
<sec id="s3_3">
<title>3.3 Effect of SF-1 and <italic>FOXL2</italic> on <italic>cyp19a1</italic> Promoter Transcriptional Activity</title>
<p>We constructed a luciferase reporter system for <italic>cyp19a1a</italic> and <italic>cyp19a1b</italic> promoters and co-transfected the eukaryotic expression vectors of SF-1 and <italic>FOXL2</italic> into HEK293T and COS7 cell lines to understand how SF-1 and <italic>FOXL2</italic> influence the transcriptional activities of promoters. We used different processing times for different cell lines because the expression time of dual luciferase was unknown after transfection.</p>
<p>In the HEK293T cell line, we found that SF-1 significantly upregulated the transcriptional activity of <italic>cyp19a1</italic> promoters 24 and 48 h after transfection, and FOXL2 significantly increased <italic>cyp19a1b</italic> promoter transcriptional activity only after 48 h of transfection (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref>, <italic>p</italic> &lt; 0.05). At the same time, after SF-1 was transfected into COS-7 cells for 48 h, we observed that the transcriptional activities of <italic>cyp19a1a</italic> and <italic>cyp19a1b</italic> promoters were significantly increased. However, FOXL2 did not increase the transcriptional activity of the <italic>cyp19a1</italic> promoters. Conversely, SF-1 and <italic>FOXL2</italic> co-transfection significantly upregulated <italic>cyp19a1</italic> promoter activity (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5</bold>
</xref>, <italic>p</italic> &lt; 0.05). The results of the two cell lines showed that co-transfection of the two transcription factors significantly increased <italic>cyp19a1</italic> promoter activity.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Transcriptional activities of <italic>cyp19a1a</italic> and <italic>cyp19a1b</italic> promoters in HEK293T after 24h and 48h transfection. S meaned that only transcription factor <italic>SF-1</italic> was added, F meaned that only transcription factor <italic>FOXL2</italic> was added. S+F meaned that transcription factors <italic>SF-1</italic> and <italic>FOXL2</italic> were added at the same time. One-way ANOVA was performed on the data and expressed as mean &#xb1; standard deviation (n = 4). *There is a significant difference between the data.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-13-863360-g004.tif"/>
</fig>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Transcriptional activities of <italic>cyp19a1a</italic> and <italic>cyp19a1b</italic> promoters in COS-7 after 48h transfection. S meaned that only transcription factor <italic>SF-1</italic> was added, F meaned that only transcription factor <italic>FOXL2</italic> was added. S+F meaned that transcription factors <italic>SF-1</italic> and <italic>FOXL2</italic> were added at the same time. One-way ANOVA was performed on the data and expressed as mean &#xb1; standard deviation (n = 4). *There is a significant difference between the data.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-13-863360-g005.tif"/>
</fig>
</sec>
<sec id="s3_4">
<title>3.4 Predicting SF-1 and FOXL2 Transcription Binding Sites</title>
<p>We found that there may be three binding sites for the SF-1 transcription factor and no binding sites for FOXL2 using online software to predict the region of the gonadal aromatase <italic>cyp19a1a</italic> promoter (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref>). We identified five SF-1 and three FOXL2 transcription binding sites in the brain aromatase <italic>cyp19a1b</italic> promoter (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7</bold>
</xref>).</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Predicted binding sites of <italic>SF-1</italic> on <italic>cyp19a1a</italic> promoter sequence. The underlined location is the binding site of the predicted transcription binding factor on the initiation. Numbers indicate the distance between the rightmost base in the row and the base of the transcription initiation codo. TSS: Initial site, arrow direction: transcriptional direction.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-13-863360-g006.tif"/>
</fig>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>Predicted binding sites of <italic>SF-1</italic> and <italic>FOXL2</italic> on <italic>cyp19a1b</italic> promoter sequence. The underlined location is the binding site of the predicted transcription binding factor on the initiation. Numbers indicate the distance between the rightmost base in the row and the base of the transcription initiation codon. TSS: Initial site, arrow direction: transcriptional direction.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-13-863360-g007.tif"/>
</fig>
</sec>
<sec id="s3_5">
<title>3.5 Identifying SF-1 and FOXL2 Transcriptional Binding Sites</title>
<p>We adopted the technology of constructing a progressive deletion of the promoter, fusion PCR, and site-directed mutagenesis to determine the transcription binding sites of the two transcription factors in the aromatase promoters and identify the key elements in transcription regulation. Finally, we identified the key SF-1 and FOXL2 transcription binding sites in the aromatase <italic>cyp19a1</italic> promoters.</p>
<sec id="s3_5_1">
<title>3.5.1 The SF-1 Core Binding Site in the Region of Aromatase <italic>cyp19a1</italic> Promoters</title>
<p>With the use of the full length of the <italic>cyp19a1</italic> promoter as a reference comparison, deleting &#x2212;1,291 to &#x2212;111 bp revealed that the transcriptional activity of the <italic>cyp19a1a</italic> promoter was significantly downregulated (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8</bold>
</xref>, <italic>p</italic> &lt; 0.05). We conducted site-directed mutations from &#x2212;1,265 to &#x2212;1,256 bp and &#x2212;119 to &#x2212;112 bp to determine whether &#x2212;120 to &#x2212;112 bp was the key binding site of SF-1 on <italic>cyp19a1a</italic>. We found that mutating &#x2212;120 to &#x2212;112 bp significantly reduced <italic>cyp19a1a</italic> promoter activity (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9</bold>
</xref>, <italic>p</italic> &lt; 0.05).</p>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>Effect of <italic>SF-1</italic> on the transcriptional activity of the <italic>cyp19a1a</italic> promoter fragment of the progressive deletion site. On the left is a schematic diagram of the promoter deletion and the triangle represents the binding site. The right side is the expression of luciferase in the promoter recombinant vector. S-A1A-F1 (-1291 bp to -1255 bp deletion), S-A1A-F2 (-1291 bp to -111 bp deletion), S-A1A-F3 (-1291 bp to -21 bp deletion). The black triangle represents the <italic>SF-1</italic> binding site. One-way ANOVA was performed on the data and expressed as mean &#xb1; standard deviation (n = 4). *There is a significant difference between the data.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-13-863360-g008.tif"/>
</fig>
<fig id="f9" position="float">
<label>Figure&#xa0;9</label>
<caption>
<p>Effect of <italic>SF-1</italic> on the transcriptional activity of the <italic>cyp19a1a</italic> promoter fragment mutated at the transcriptional site. On the left is a schematic diagram of the mutation of the promoter site, and the triangle represents the binding site. The right side is the expression of luciferase in the promoter recombinant vector. The black triangle with a red cross represents the <italic>SF-1</italic> mutation site. One-way ANOVA was performed on the data and expressed as mean &#xb1; standard deviation (n = 4). *There is a significant difference between the data.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-13-863360-g009.tif"/>
</fig>
<p>When we deleted the transcription binding sites that predicted SF-1 in the <italic>cyp19a1b</italic> promoter (<xref ref-type="fig" rid="f10">
<bold>Figure&#xa0;10</bold>
</xref>, <italic>p</italic> &lt; 0.05), the mutations at these sites did not significantly reduce <italic>cyp19a1b</italic> promoter activity (<xref ref-type="fig" rid="f11">
<bold>Figure&#xa0;11</bold>
</xref>, <italic>p</italic> &lt; 0.05). Therefore, we determined that these sites were not the core regulatory sites of SF-1 in the <italic>cyp19a1b</italic> promoter.</p>
<fig id="f10" position="float">
<label>Figure&#xa0;10</label>
<caption>
<p>Effect of <italic>SF-1</italic> on the transcriptional activity of the <italic>cyp19a1b</italic> promoter fragment of the progressive deletion site. On the left is a schematic diagram of the promoter deletion and the triangle represents the binding site. The right side is the expression of luciferase in the promoter recombinant vector. S-A1B-F1 (-2379 bp to -1795 bp deletion), S-A1B-F2 (-2379 bp to -1534 bp deletion), S-A1B-F3 (-2379 bp to -1501 bp deletion), S-A1B-F4 (-2379 bp to -864 bp delettion), S-A1B-F5 (2379 bp to -504 bp deletion). The black triangle represents the <italic>SF-1</italic> binding site. One-way ANOVA was performed on the data and expressed as mean &#xb1; standard deviation (n = 4). *There is a significant difference between the data.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-13-863360-g010.tif"/>
</fig>
<fig id="f11" position="float">
<label>Figure&#xa0;11</label>
<caption>
<p>Effect of <italic>SF-1</italic> on the transcriptional activity of the <italic>cyp19a1b</italic> promoter fragment mutated at the transcriptional site. On the left is a schematic diagram of the mutation of the promoter site, and the triangle represents the binding site. The right side is the expression of luciferase in the promoter recombinant vector. The black triangle with a red cross represents the <italic>SF-1</italic> mutation site. One-way ANOVA was performed on the data expressed as mean &#xb1; standard deviation (n = 4). *There is a significant difference between the data.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-13-863360-g011.tif"/>
</fig>
<p>In summary, we concluded that &#x2212;120 to &#x2212;112 bp (5&#x2032;-CAAGGGCAC-3&#x2032;) was the core regulatory element for SF-1 to regulate the transcriptional activity of the <italic>cyp19a1a</italic> promoter.</p>
</sec>
<sec id="s3_5_2">
<title>3.5.2 The FOXL2 Core Binding Site in the Region of Aromatase <italic>cyp19a1</italic> Promoters</title>
<p>As <xref ref-type="fig" rid="f13">
<bold>Figure&#xa0;13</bold>
</xref> shows, we found that after deleting &#x2212;2,379 to &#x2212;1,097, &#x2212;2,379 to &#x2212;1,026, and &#x2212;2,379 to &#x2212;871 bp, the transcription activities decreased significantly from the full length of the promoters (<xref ref-type="fig" rid="f12">
<bold>Figure&#xa0;12</bold>
</xref>, <italic>p</italic> &lt; 0.05). Based on the predicted results from &#x2212;2,379 to &#x2212;871 bp, we performed site-directed mutations at&#xa0;the following three transcription sites: &#x2212;1,116 to &#x2212;1,098, &#x2212;1,035 to &#x2212;1,027, and &#x2212;890 to &#x2212;872 bp. After mutating &#x2212;890 to &#x2212;872 bp, <italic>cyp19a1b</italic> promoter activity decreased significantly (<xref ref-type="fig" rid="f13">
<bold>Figure&#xa0;13</bold>
</xref>, <italic>p</italic>&#xa0;&lt; 0.05).</p>
<fig id="f12" position="float">
<label>Figure&#xa0;12</label>
<caption>
<p>Effect of <italic>FOXL2</italic> on the transcriptional activity of the <italic>cyp19a1b</italic> promoter fragment at the progressive deletion site. On the left is a schematic diagram of the promoter deletion and the circle represents the binding site. The right side is the expression of luciferase in the promoter recombinant vector. F-A1B-F1 (-2379 bp to -1097 bp deletion), F-A1B-F2 (-2379 bp to -1026 bp deletion), F-A1B-F3 (-2379 bp to -871 bp deletion). The black circle represents the <italic>FOXL2</italic> binding site. One-way ANOVA was performed on the data and expressed as mean &#xb1; standard deviation (n = 4). *There is a significant difference between the data.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-13-863360-g012.tif"/>
</fig>
<fig id="f13" position="float">
<label>Figure&#xa0;13</label>
<caption>
<p>Effect of <italic>FOXL2</italic> on transcriptional activity of the <italic>cyp19a1b</italic> promoter fragment mutated at the transcriptional site. On the left is a schematic diagram of the mutation of the promoter site, and the circle represents the binding site. The right side is the expression of luciferase in the promoter recombinant vector. The black circle with a red cross represents the <italic>FOXL2</italic> mutation site. One-way ANOVA was performed on the data and expressed as mean &#xb1; standard deviation (n = 4). *There is a significant difference between the data.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-13-863360-g013.tif"/>
</fig>
<p>Therefore, we determined that &#x2212;890 to &#x2212;872 bp (5&#x2032;-AGAGGAGAACAAGGGGAG-3&#x2032;) was the core regulatory element for FOXL2 to regulate the transcriptional activity of the <italic>cyp19a1b</italic> promoter.</p>
</sec>
</sec>
</sec>
<sec id="s4">
<title>4 Discussion</title>
<p>
<italic>cyp19a1</italic> is the switch enabling androgen to estrogen conversion, affecting gonadal differentiation and sex ratios by regulating the biosynthesis of gonadal steroid hormones (<xref ref-type="bibr" rid="B20">20</xref>). We cloned two genes encoding the SF-1 and FOXL2 transcription factors and constructed a phylogenetic tree and conserved domains. Phylogenetic trees showed that the giant wrasse&#x2019;s SF-1 and <italic>FOXL2</italic> sequences clustered into the teleost group. Similar to a study on <italic>Cyprinus carpio</italic> SF-1, our conserved domain analysis found that the SF-1 amino acid sequence contained two domains: a conserved DBD and a C-terminal LBD (<xref ref-type="bibr" rid="B21">21</xref>). Similarly, FOXL2 consisted of an evolutionarily conserved FH domain. This result was the same as that of the conserved domain in the human <italic>FOXL2</italic> gene (<xref ref-type="bibr" rid="B22">22</xref>).</p>
<sec id="s4_1">
<title>4.1 SF-1 and FOXL2 Synergistically Upregulate <italic>cyp19a1</italic> Promoter Transcriptional Activities</title>
<p>Evidence supports that NR5A members (FTZ-F1, Ad4BP/SF-1, or LRH-1) and <italic>FOXL2</italic> play a role in the brain. Previous studies have potentiated that NR5A members and <italic>FOXL2</italic> are involved in <italic>cyp19a1a</italic> regulation in some fish and mammals (<xref ref-type="bibr" rid="B23">23</xref>&#x2013;<xref ref-type="bibr" rid="B26">26</xref>). Furthermore, the combination of FOXL2 and SF-1 can significantly enhance aromatase <italic>cyp19a1</italic> transcription (<xref ref-type="bibr" rid="B27">27</xref>). Similarly, our results showed that co-transfection of <italic>SF-1</italic> and <italic>FOXL2</italic> can enhance the transcriptional activity of the <italic>cyp19a1</italic> promoters, which indicated a synergistic effect between <italic>SF-1</italic> and <italic>FOXL2</italic>. The synergistic effects of SF-1 and FOXL2 have also been verified in other teleosts. For example, in catfish, FTZ-F1/SF-1 and FOXL2 bind to the promoter and upregulate transcription of the aromatase gene in the brain (<xref ref-type="bibr" rid="B28">28</xref>). In tilapia, FOXL2 binds to the promoter and interacts with Ad4BP/SF-1 to upregulate aromatase gene transcription in a female-specific manner (<xref ref-type="bibr" rid="B15">15</xref>). Similar results were also obtained in ricefield eels, where <italic>NR5A1A</italic> (one of the genes encoding <italic>NR5A</italic> homologs) cooperated with <italic>FOXL2</italic> to upregulate <italic>cyp19a1a</italic> promoter activity (<xref ref-type="bibr" rid="B29">29</xref>). However, the synergistic mechanism by which SF-1 and FOXL2 act remains unclear. Studies have shown that SF-1-induced anti-Mullerian hormone (<italic>AMH</italic>) regulation <italic>via</italic> functional FOXL2 occurs through protein&#x2013;protein interactions between FOXL2 and SF-1 in human granulosa cells (<xref ref-type="bibr" rid="B30">30</xref>). In addition, Nagahama et&#xa0;al. reported that FOXL2 could interact with the LBD of <italic>NR5A1</italic> through the FH domain to form a heterodimer in tilapia (<xref ref-type="bibr" rid="B15">15</xref>). Researchers in Quebec, Canada, provided a more detailed explanation regarding this synergistic mechanism and found that the zinc finger region of GATA binding protein 4 (GATA-4) mediated GATA-4<italic>/</italic>SF-1 synergy. This synergy is the result of direct protein&#x2013;protein interactions (<xref ref-type="bibr" rid="B31">31</xref>). These results collectively indicate that FOXL2 and SF-1 may affect <italic>cyp19a1</italic> transcriptional regulation through a specific connection or interaction.</p>
</sec>
<sec id="s4_2">
<title>4.2 SF-1 at the Core Binding Site of the <italic>cyp19a1</italic> Promoter Region</title>
<p>In many bony fish, SF-1 binding sites exist in the promoter region of the gonadal aromatase <italic>cyp19a1</italic> (<xref ref-type="bibr" rid="B32">32</xref>&#x2013;<xref ref-type="bibr" rid="B35">35</xref>). In <italic>Oncorhynchus mykiss</italic>, it was found that only &#x2212;150 to &#x2212;142 bp and &#x2212;118 to &#x2212;110 bp were the core transcription binding sites in the <italic>cyp19a1a</italic> promoter (<xref ref-type="bibr" rid="B36">36</xref>). In the orange-spotted grouper, deletion of the region (&#x2212;246 to &#x2212;112 bp) containing two conserved FTZ-F1 sites significantly reduced the transcriptional activity of the <italic>cyp19a1a</italic> promoter (<xref ref-type="bibr" rid="B37">37</xref>). We hypothesized that &#x2212;120 to &#x2212;112 bp were the key transcriptional binding sites of SF-1 in the <italic>cyp19a1a</italic> promoter. Collectively, these results indicated that SF-1 family proteins are common transcriptional regulators of gonad-type <italic>cyp19a1a</italic> genes in fish and provided evidence that they regulate <italic>cyp19a1</italic> expression in vertebrate ovaries. Interestingly, we did not find the core regulatory site of SF-1 in the <italic>cyp19a1b</italic> promoter. From fish to mammals, SF-1 appears to be the common transcription factor of gonad-type <italic>cyp19a1a</italic> but not brain-type <italic>cyp19a1b</italic>. Other studies on aromatase promoters have found that in some fish, including ricefield eel (<xref ref-type="bibr" rid="B38">38</xref>), <italic>Epinephelus akaara</italic> (<xref ref-type="bibr" rid="B37">37</xref>), zebrafish (<xref ref-type="bibr" rid="B34">34</xref>), and <italic>Sparus macrocephalus</italic> (<xref ref-type="bibr" rid="B39">39</xref>), only the <italic>cyp19a1a</italic> promoter contains the SF-1 binding site, while the brain-type <italic>cyp19a1b</italic> promoter does not. Therefore, we speculated that <italic>Cheilinus undulatus</italic> may be the same as these fish. Thus, this explanation is reasonable. For example, the SF-1 binding site was found in the mouse brain-type <italic>cyp19a</italic> promoter (<xref ref-type="bibr" rid="B40">40</xref>). A previous study found that <italic>NR5A1</italic> knockout mice still contained aromatase in some of their brain cells (<xref ref-type="bibr" rid="B41">41</xref>), suggesting that SF-1 may not be necessary for <italic>cyp19a1b</italic> expression.</p>
</sec>
<sec id="s4_3">
<title>4.3 FOXL2 at the Core Binding Site of the <italic>cyp19a1</italic> Promoter Region</title>
<p>Previous studies have shown that FOXL2 is involved in regulating <italic>cyp19a1</italic> promoter transcription in vertebrates. FOXL2 and SF-1 co-regulate aromatase transcription (<xref ref-type="bibr" rid="B15">15</xref>, <xref ref-type="bibr" rid="B27">27</xref>, <xref ref-type="bibr" rid="B28">28</xref>). However, some researchers believe that FOXL2 directly binds to some DNA sites through its FH. Other studies have shown that FOXL2 binds to the half-site sequence of nuclear receptors, namely, the SF-1 response element (SFRE). The SFRE acts on the aromatase promoter (<xref ref-type="bibr" rid="B42">42</xref>). Our experiment found that deleting or mutating &#x2212;890 to &#x2212;872 bp significantly reduced <italic>cyp19a1b</italic> promoter activity. Therefore, we speculated that &#x2212;890 to &#x2212;872 bp is the core element for FOXL2 to regulate <italic>cyp19a1b</italic> transcriptional activity. Our results are consistent with those reported for tilapia. A mutation in the FOXL2 binding site (&#x2212;545 to &#x2212;538 bp) in the <italic>cyp19a1b</italic> promoter of tilapia significantly reduced the activity of the promoter (<xref ref-type="bibr" rid="B15">15</xref>). Similarly, when a FOXL2 binding site in the promoter of catfish <italic>cyp19a1b</italic> was mutated from &#x2212;977 to &#x2212;954 bp, <italic>cyp19a1b</italic> transcriptional activity was significantly downregulated, indicating that this region was the core element of FOXL2 to regulate <italic>cyp19a1b</italic> transcriptional activity (<xref ref-type="bibr" rid="B28">28</xref>). These studies all point to the possible involvement of FOXL2 in regulating <italic>cyp19a1b</italic> promoter transcription.</p>
<p>In conclusion, this study found that SF-1 and FOXL2 can regulate <italic>cyp19a1a</italic> and <italic>cyp19a1b</italic> promoters, respectively. SF-1 and FOXL2 contain key binding elements in the <italic>cyp19a1a</italic> and c<italic>yp19a1b</italic> promoters, respectively. The combination of SF-1 and FOXL2 enhanced aromatase promoter activity in giant wrasse. This study lays a theoretical foundation for identifying the aromatase gene transcriptional regulatory pathway in giant wrasse.</p>
</sec>
</sec>
<sec id="s5" sec-type="data-availability">
<title>Data Availability Statement</title>
<p>The raw data supporting the conclusions of this article will be made available by the authors on reasonable request.</p>
</sec>
<sec id="s6" sec-type="ethics-statement">
<title>Ethics Statement</title>
<p>The animal study was reviewed and approved by the Institutional Animal Care and Use Committee of Hainan University. Written informed consent was obtained from the owners for the participation of their animals in this study.</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author Contributions</title>
<p>YZ, YW and XJ was the main performer of the experiment. XJ and YZ completed the manuscript, the revision of the article and result graphing. SB analyzed the data and submited the article.  XW, FS provided suggestions for writing articles. JL designed all the experiments, provided the required facilities and guidance. All authors read the final article and approved its submission.</p>
</sec>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>This work was supported by the National Natural Science Foundation (Grant No. 3166130111).</p>
</sec>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of Interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s10" sec-type="disclaimer">
<title>Publisher&#x2019;s Note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
</body>
<back>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gemmell</surname> <given-names>NJ</given-names>
</name>
<name>
<surname>Todd</surname> <given-names>EV</given-names>
</name>
<name>
<surname>Goikoetxea</surname> <given-names>A</given-names>
</name>
<name>
<surname>Ortega-Recalde</surname> <given-names>O</given-names>
</name>
<name>
<surname>Hore</surname> <given-names>TA</given-names>
</name>
</person-group>. <article-title>Natural Sex Change in Fish</article-title>. <source>Curr Top Dev Biol</source> (<year>2019</year>) <volume>134</volume>:<fpage>71</fpage>&#x2013;<lpage>117</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/bs.ctdb.2018.12.014</pub-id>
</citation>
</ref>
<ref id="B2">
<label>2</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Piferrer</surname> <given-names>F</given-names>
</name>
<name>
<surname>Bl&#xe1;zquez</surname> <given-names>M</given-names>
</name>
<name>
<surname>Navarro</surname> <given-names>L</given-names>
</name>
<name>
<surname>Gonz&#xe1;lez</surname> <given-names>A</given-names>
</name>
</person-group>. <article-title>Genetic, Endocrine, and Environmental Components of Sex Determination and Differentiation in the European Sea Bass (Dicentrarchus Labrax L.)</article-title>. <source>Gen Comp Endocrinol</source> (<year>2005</year>) <volume>142</volume>(<issue>1-2</issue>):<page-range>102&#x2013;10</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ygcen.2005.02.011</pub-id>
</citation>
</ref>
<ref id="B3">
<label>3</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tao</surname> <given-names>W</given-names>
</name>
<name>
<surname>Yuan</surname> <given-names>J</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>L</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>L</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>Characterization of Gonadal Transcriptomes From Nile Tilapia (Oreochromis Niloticus) Reveals Differentially Expressed Genes</article-title>. <source>PloS One</source> (<year>2013</year>) <volume>8</volume>(<issue>5</issue>):<elocation-id>e63604</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pone.0063604</pub-id>
</citation>
</ref>
<ref id="B4">
<label>4</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Guiguen</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Fostier</surname> <given-names>A</given-names>
</name>
<name>
<surname>Piferrer</surname> <given-names>F</given-names>
</name>
<name>
<surname>Chang</surname> <given-names>CF</given-names>
</name>
</person-group>. <article-title>Ovarianaromatase and Estrogens: A Pivotal Role for Gonadal Sex Differentiation and Sex Change in Fish</article-title>. <source>Gen Comp Endocrinol</source> (<year>2010</year>) <volume>165</volume>(<issue>3</issue>):<page-range>352&#x2013;66</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ygcen.2009.03.002</pub-id>
</citation>
</ref>
<ref id="B5">
<label>5</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Diotel</surname> <given-names>N</given-names>
</name>
<name>
<surname>Le Page</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Mouriec</surname> <given-names>K</given-names>
</name>
<name>
<surname>Tong</surname> <given-names>SK</given-names>
</name>
<name>
<surname>Pellegrini</surname> <given-names>E</given-names>
</name>
<name>
<surname>Vaillant</surname> <given-names>C</given-names>
</name>
<etal/>
</person-group>. <article-title>Aromatase in the Brain of Teleost Fish: Expression, Regulation and Putative Functions</article-title>. <source>Front Neuroendocrinol</source> (<year>2010</year>) <volume>31</volume>(<issue>2</issue>):<page-range>172&#x2013;92</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.yfrne.2010.01.003</pub-id>
</citation>
</ref>
<ref id="B6">
<label>6</label>
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Cao</surname> <given-names>J</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>J</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Luo</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Gan</surname> <given-names>XI</given-names>
</name>
</person-group>. <article-title>Cloning and Expression Characteristics of FTZ-F1 Gene in Jifu Tilapia. China Fisheries Society</article-title>. In: <source>Aquatic Biotechnology Professional Committee of China Fisheries Society and Fish Sex Determination Mechanism Proceedings of the Symposium on and Regulation Technology</source>, vol. <volume>27</volume>. (<year>2011</year>). Available at: <uri xlink:href="https://doc.paperpass.com/conference/20110002zho_23201.html?utm_source=doc_share">https://doc.paperpass.com/conference/20110002zho_23201.html?utm_source=doc_share</uri>.</citation>
</ref>
<ref id="B7">
<label>7</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hoivik</surname> <given-names>EA</given-names>
</name>
<name>
<surname>Lewis</surname> <given-names>AE</given-names>
</name>
<name>
<surname>Aumo</surname> <given-names>L</given-names>
</name>
<name>
<surname>Bakke</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Molecular Aspects of Steroidogenic Factor 1 (SF-1)</article-title>. <source>Mol Cell Endocrinol</source> (<year>2010</year>) <volume>315</volume>(<issue>1</issue>):<fpage>27</fpage>&#x2013;<lpage>39</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.mce.2009.07.003</pub-id>
</citation>
</ref>
<ref id="B8">
<label>8</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Watanabe</surname> <given-names>M</given-names>
</name>
<name>
<surname>Tanaka</surname> <given-names>M</given-names>
</name>
<name>
<surname>Kobayashi</surname> <given-names>D</given-names>
</name>
<name>
<surname>Yoshiura</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Oba</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Nagahama</surname> <given-names>Y</given-names>
</name>
</person-group>. <article-title>Medaka (Oryzias Latipes) FTZ-F1 Potentially Regulates the Transcription of P-450 Aromatase in Ovarian Follicles: cDNA Cloning and Functional Characterization</article-title>. <source>Mol Cell Endocrinol</source> (<year>1999</year>) <volume>149</volume>(<issue>1-2</issue>):<page-range>221&#x2013;8</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/s0303-7207(99)00006-4</pub-id>
</citation>
</ref>
<ref id="B9">
<label>9</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Gong</surname> <given-names>Y</given-names>
</name>
</person-group>. <article-title>Transcription of CYP19A1 is Directly Regulated by SF-1 in the Theca Cells of Ovary Follicles in Chicken</article-title>. <source>Gen Comp Endocrinol</source> (<year>2017</year>) <volume>247</volume>:<fpage>1</fpage>&#x2013;<lpage>7</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ygcen.2017.03.013</pub-id>
</citation>
</ref>
<ref id="B10">
<label>10</label>
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Xie</surname> <given-names>Q</given-names>
</name>
</person-group>. <source>Steroidogenic Factor 1 (SF-1) is Essential for Steroidogenesis, Gonadal Development and Sex Differentiation in Nile Tilapia</source>. <publisher-loc>Chongqing</publisher-loc>: <publisher-name>Southwest University</publisher-name> (<year>2016</year>) p. <page-range>17&#x2013;8</page-range>. Available at: <uri xlink:href="https://kns.cnki.net/kcms/detail/detail.aspx?FileName=1016908992.nh&amp;DbName=CDFD2017">https://kns.cnki.net/kcms/detail/detail.aspx?FileName=1016908992.nh&amp;DbName=CDFD2017</uri>.</citation>
</ref>
<ref id="B11">
<label>11</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Matsumoto</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Crews</surname> <given-names>D</given-names>
</name>
</person-group>. <article-title>Molecular Mechanisms of Temperature-Dependent Sex Determination in the Context of Ecological Developmental Biology</article-title>. <source>Mol Cell Endocrinol</source> (<year>2012</year>) <volume>354</volume>(<issue>1-2</issue>):<page-range>103&#x2013;10</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.mce.2011.10.012</pub-id>
</citation>
</ref>
<ref id="B12">
<label>12</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Escudero</surname> <given-names>JM</given-names>
</name>
<name>
<surname>Haller</surname> <given-names>JL</given-names>
</name>
<name>
<surname>Clay</surname> <given-names>CM</given-names>
</name>
<name>
<surname>Escudero</surname> <given-names>KW</given-names>
</name>
</person-group>. <article-title>Microarray Analysis of Foxl2 Mediated Gene Regulation in the Mouse Ovary Derived KK1 Granulosa Cell Line: Over-Expression of Foxl2 Leads to Activation of the Gonadotropin Releasing Hormone Receptor Gene Promoter</article-title>. <source>J Ovarian Res</source> (<year>2010</year>) <volume>3</volume>(<issue>1</issue>):<fpage>4</fpage>&#x2013;<lpage>4</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/1757-2215-3-4</pub-id>
</citation>
</ref>
<ref id="B13">
<label>13</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Frank</surname> <given-names>B</given-names>
</name>
<name>
<surname>Daniel</surname> <given-names>V</given-names>
</name>
<name>
<surname>Jean</surname> <given-names>D</given-names>
</name>
<name>
<surname>Veitia</surname> <given-names>RA</given-names>
</name>
</person-group>. <article-title>Potential Targets of FOXL2, a Transcription Factor Involved in Craniofacial and Follicular Development, Identified by Transcriptomics</article-title>. <source>Proc Natl Acad Sci USA</source> (<year>2007</year>) <volume>104</volume>(<issue>9</issue>):<page-range>3330&#x2013;5</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1073/pnas.0611326104</pub-id>
</citation>
</ref>
<ref id="B14">
<label>14</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Govoroun</surname> <given-names>MS</given-names>
</name>
<name>
<surname>Pannetier</surname> <given-names>M</given-names>
</name>
<name>
<surname>Pailhoux</surname> <given-names>E</given-names>
</name>
<name>
<surname>Cocquet</surname> <given-names>J</given-names>
</name>
<name>
<surname>Brillard</surname> <given-names>JP</given-names>
</name>
<name>
<surname>Couty</surname> <given-names>I</given-names>
</name>
<etal/>
</person-group>. <article-title>Isolation of Chicken Homolog of the FOXL2 Gene and Comparison of its Expression Patterns With Those of Aromatase During Ovarian Development</article-title>. <source>Dev Dyn</source> (<year>2004</year>) <volume>231</volume>(<issue>4</issue>):<page-range>859&#x2013;70</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/dvdy.20189</pub-id>
</citation>
</ref>
<ref id="B15">
<label>15</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>DS</given-names>
</name>
<name>
<surname>Kobayashi</surname> <given-names>T</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>LY</given-names>
</name>
<name>
<surname>Paul-Prasanth</surname> <given-names>B</given-names>
</name>
<name>
<surname>Ijiri</surname> <given-names>S</given-names>
</name>
<name>
<surname>Sakai</surname> <given-names>F</given-names>
</name>
<etal/>
</person-group>. <article-title>Foxl2 Up-Regulates Aromatase Gene Transcription in a Female-Specific Manner by Binding to the Promoter as Well as Interacting With Ad4 Binding Protein/Steroidogenic Factor 1</article-title>. <source>Mol Endocrinol</source> (<year>2007</year>) <volume>21</volume>(<issue>3</issue>):<page-range>712&#x2013;25</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1210/me.2006-0248</pub-id>
</citation>
</ref>
<ref id="B16">
<label>16</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bhat</surname> <given-names>IA</given-names>
</name>
<name>
<surname>Rather</surname> <given-names>MA</given-names>
</name>
<name>
<surname>Dar</surname> <given-names>JY</given-names>
</name>
<name>
<surname>Sharma</surname> <given-names>R</given-names>
</name>
</person-group>. <article-title>Molecular Cloning, Computational Analysis and Expression Pattern of Forkhead Box L2 (Foxl2) Gene in Catfish</article-title>. <source>Comput Biol Chem</source> (<year>2016</year>) <volume>64</volume>:<fpage>9</fpage>&#x2013;<lpage>18</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.compbiolchem.2016.05.001</pub-id>
</citation>
</ref>
<ref id="B17">
<label>17</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yamaguchi</surname> <given-names>T</given-names>
</name>
<name>
<surname>Yamaguchi</surname> <given-names>S</given-names>
</name>
<name>
<surname>Hirai</surname> <given-names>T</given-names>
</name>
<name>
<surname>Kitano</surname> <given-names>T</given-names>
</name>
</person-group>. <article-title>Follicle-Stimulating Hormone Signaling and Foxl2 are Involved in Transcriptional Regulation of Aromatase Gene During Gonadal Sex Differentiation in Japanese Flounder, Paralichthys Olivaceus</article-title>. <source>Biochem Biophys Res Commun</source> (<year>2007</year>) <volume>359</volume>(<issue>4</issue>):<page-range>935&#x2013;40</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.bbrc.2007.05.208</pub-id>
</citation>
</ref>
<ref id="B18">
<label>18</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>M</given-names>
</name>
<name>
<surname>Luo</surname> <given-names>J</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>G</given-names>
</name>
<name>
<surname>Wen</surname> <given-names>X</given-names>
</name>
<name>
<surname>Guangcan</surname> <given-names>WU</given-names>
</name>
<name>
<surname>Wenshen</surname> <given-names>LI</given-names>
</name>
<etal/>
</person-group>. <article-title>Embryonic Development and Morphologic Observations of Newly-Hatched Cheilinus Undulatus Larvae</article-title>. <source>Prog Fishery Sci</source> (<year>2015</year>) <volume>36</volume>(<issue>5</issue>):<page-range>38&#x2013;9</page-range>. Available at: <uri xlink:href="http://journal.yykxjz.cn/yykxjz/ch/reader/view_abstract.aspx?file_no=20150506&amp;flag=1">http://journal.yykxjz.cn/yykxjz/ch/reader/view_abstract.aspx?file_no=20150506&amp;flag=1</uri>.</citation>
</ref>
<ref id="B19">
<label>19</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dorenbosch</surname> <given-names>M</given-names>
</name>
<name>
<surname>Grol</surname> <given-names>MGG</given-names>
</name>
<name>
<surname>Nagelkerken</surname> <given-names>I</given-names>
</name>
<name>
<surname>Velde</surname> <given-names>VD</given-names>
</name>
</person-group>. <article-title>eagrass Beds and Mangroves as Potential Nurseries for the Threatened Indo-Pacific Humphead Wrasse, Cheilinus Undulatus and Caribbean Rainbow Parrotfish,Scarus Guacamaia</article-title>. <source>Biol Conserv</source> (<year>2006</year>) <volume>129</volume>:<page-range>277&#x2013;82</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.biocon.2005.10.032</pub-id>
</citation>
</ref>
<ref id="B20">
<label>20</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fan</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Zou</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Jiao</surname> <given-names>S</given-names>
</name>
<name>
<surname>Tan</surname> <given-names>X</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Liang</surname> <given-names>D</given-names>
</name>
<etal/>
</person-group>. <article-title>Significant Association of Cyp19a Promoter Methylation With Environmental Factors and Gonadal Differentiation in Olive Flounder Paralichthys Olivaceus</article-title>. <source>Comp Biochem Physiol Part A: Mol Integr Physiol</source> (<year>2017</year>) <volume>208</volume>:<page-range>70&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.cbpa.2017.02.017</pub-id>
</citation>
</ref>
<ref id="B21">
<label>21</label>
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Zhao</surname> <given-names>W</given-names>
</name>
</person-group>. <source>Structure, Expression Pattern and its Relationship With miRNA Targets Analysis of Sf-1 Gene in Yellow River Camp</source>. <publisher-loc>Henan</publisher-loc>: <publisher-name>the Graduate School of Henan Normal University</publisher-name> (<year>2019</year>) p. <fpage>3</fpage>&#x2013;<lpage>4</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.27118/d.cnki.ghesu.2019.000080</pub-id>
</citation>
</ref>
<ref id="B22">
<label>22</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pelletier</surname> <given-names>GJ</given-names>
</name>
<name>
<surname>Brody</surname> <given-names>SL</given-names>
</name>
<name>
<surname>Liapis</surname> <given-names>H</given-names>
</name>
<name>
<surname>White</surname> <given-names>RA</given-names>
</name>
<name>
<surname>Hackett</surname> <given-names>BP</given-names>
</name>
</person-group>. <article-title>A Human Forkhead/Winged-Helix Transcription Factor Expressed in Developing Pulmonary and Renal</article-title>. <source>Am J Physiol</source> (<year>1998</year>) <volume>274</volume>(<issue>3</issue>):<page-range>L351&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1152/ajplung.1998.274.3.L351</pub-id>
</citation>
</ref>
<ref id="B23">
<label>23</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pannetier</surname> <given-names>M</given-names>
</name>
<name>
<surname>Fabre</surname> <given-names>S</given-names>
</name>
<name>
<surname>Batista</surname> <given-names>F</given-names>
</name>
<name>
<surname>Kocer</surname> <given-names>A</given-names>
</name>
<name>
<surname>Renault</surname> <given-names>L</given-names>
</name>
<name>
<surname>Jolivet</surname> <given-names>G</given-names>
</name>
<etal/>
</person-group>. <article-title>FOXL2 Activates P450 Aromatase Gene Transcription: Towards a Better Characterization of the Early Steps of Mammalian Ovarian Development</article-title>. <source>J&#xa0;Mol Endocrinol</source> (<year>2006</year>) <volume>36</volume>(<issue>3</issue>):<fpage>399</fpage>&#x2013;<lpage>413</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1677/jme.1.01947</pub-id>
</citation>
</ref>
<ref id="B24">
<label>24</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vincenzo</surname> <given-names>P</given-names>
</name>
<name>
<surname>Rosa</surname> <given-names>S</given-names>
</name>
<name>
<surname>Adele</surname> <given-names>C</given-names>
</name>
<name>
<surname>Maggiolini</surname> <given-names>M</given-names>
</name>
<name>
<surname>Bourguiba</surname> <given-names>S</given-names>
</name>
<name>
<surname>Delalande</surname> <given-names>C</given-names>
</name>
<etal/>
</person-group>. <article-title>Differential Expression of Steroidogenic Factor-1/Adrenal 4 Binding Protein and Liver Receptor Homolog-1 (LRH-1)/Fetoprotein Transcription Factor in the Rat Testis: LRH-1 as a Potential Regulator of Testicular Aromatase Expression</article-title>. <source>Endocrinology</source> (<year>2004</year>) <volume>145</volume>(<issue>5</issue>):<fpage>2186</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1210/en.2003-1366</pub-id>
</citation>
</ref>
<ref id="B25">
<label>25</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fan</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Zou</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Liang</surname> <given-names>D</given-names>
</name>
<name>
<surname>Tan</surname> <given-names>X</given-names>
</name>
<name>
<surname>You</surname> <given-names>F</given-names>
</name>
</person-group>. <article-title>Roles of Forkhead Box Protein L2 (Foxl2) During Gonad Differentiation and Maintenance in a Fish, the Olive Flounder (Paralichthys Olivaceus)</article-title>. <source>Reproduction Fertil Dev</source> (<year>2019</year>) <volume>31</volume>(<issue>11</issue>):<page-range>1742&#x2013;52</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1071/RD18233</pub-id>
</citation>
</ref>
<ref id="B26">
<label>26</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yoshiura</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Senthilkumaran</surname> <given-names>B</given-names>
</name>
<name>
<surname>Watanabe</surname> <given-names>M</given-names>
</name>
<name>
<surname>Oba</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Kobayashi</surname> <given-names>T</given-names>
</name>
<name>
<surname>Nagahama</surname> <given-names>Y</given-names>
</name>
</person-group>. <article-title>Synergistic Expression of Ad4bp/Sf-1 and Cytochrome P-450 Aromatase (Ovarian Type) in the Ovary of Nile Tilapia, Oreochromis Niloticus, During Vitellogenesis Suggests Transcriptional Interaction</article-title>. <source>Biol Reprod</source> (<year>2003</year>) <volume>68</volume>(<issue>5</issue>):<page-range>1545&#x2013;53</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1095/biolreprod.102.010843</pub-id>
</citation>
</ref>
<ref id="B27">
<label>27</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fleming</surname> <given-names>NI</given-names>
</name>
<name>
<surname>Knower</surname> <given-names>KC</given-names>
</name>
<name>
<surname>Lazarus</surname> <given-names>KA</given-names>
</name>
<name>
<surname>Fuller</surname> <given-names>PJ</given-names>
</name>
<name>
<surname>Simpson</surname> <given-names>ER</given-names>
</name>
<name>
<surname>Clyne</surname> <given-names>CD</given-names>
</name>
</person-group>. <article-title>Aromatase is a Direct Target of FOXL2: C134W in Granulosa Cell Tumors <italic>via</italic> a Single Highly Conserved Binding Site in the Ovarian Specific Promoter</article-title>. <source>PloS One</source> (<year>2010</year>) <volume>5</volume>(<issue>12</issue>):<elocation-id>e14389</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pone.0014389</pub-id>
</citation>
</ref>
<ref id="B28">
<label>28</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sridevi</surname> <given-names>P</given-names>
</name>
<name>
<surname>Chaitanya</surname> <given-names>RK</given-names>
</name>
<name>
<surname>Dutta-Gupta</surname> <given-names>A</given-names>
</name>
<name>
<surname>Senthilkumaran</surname> <given-names>B</given-names>
</name>
</person-group>. <article-title>FTZ-F1 and FOXL2 Up-Regulate Catfish Brain Aromatase Gene Transcription by Specific Binding to the Promoter Motifs</article-title>. <source>Biochim Biophys Acta</source> (<year>2012</year>) <volume>1819</volume>(<issue>1</issue>):<fpage>57</fpage>&#x2013;<lpage>66</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.bbagrm.2011.10.003</pub-id>
</citation>
</ref>
<ref id="B29">
<label>29</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yan</surname> <given-names>T</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>H</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>C</given-names>
</name>
<name>
<surname>Peng</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Meng</surname> <given-names>F</given-names>
</name>
<name>
<surname>Gan</surname> <given-names>R</given-names>
</name>
<etal/>
</person-group>. <article-title>Nr5a Homologues in the Ricefield Eel Monopterus Albus: Alternative Splicing, Tissue-Specific Expression, and Differential Roles on the Activation of Cyp19a1a Promoter <italic>In Vitro</italic>
</article-title>. <source>Gen Comp Endocrinol</source> (<year>2021</year>) <volume>312</volume>:<elocation-id>113871</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ygcen.2021.113871</pub-id>. ISSN 0016-6480.</citation>
</ref>
<ref id="B30">
<label>30</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jin</surname> <given-names>H</given-names>
</name>
<name>
<surname>Won</surname> <given-names>M</given-names>
</name>
<name>
<surname>Park</surname> <given-names>SE</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>S</given-names>
</name>
<name>
<surname>Park</surname> <given-names>M</given-names>
</name>
<name>
<surname>Bae</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>FOXL2 Is an Essential Activator of SF-1-Induced Transcriptional Regulation of Anti-M&#xfc;llerian Hormone in Human Granulosa Cells</article-title>. <source>PloS One</source> (<year>2016</year>) <volume>11</volume>(<issue>7</issue>):<elocation-id>e0159112</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pone.0159112</pub-id>
</citation>
</ref>
<ref id="B31">
<label>31</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tremblay</surname> <given-names>JJ</given-names>
</name>
<name>
<surname>Viger</surname> <given-names>RS</given-names>
</name>
</person-group>. <article-title>Transcription Factor GATA-4 Enhances M&#xfc;llerian Inhibiting Substance Gene Transcription Through a Direct Interaction With the Nuclear Receptor SF-1</article-title>. <source>Mol Endocrinol</source> (<year>1999</year>) <volume>13</volume>(<issue>8</issue>):<page-range>1388&#x2013;401</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1210/mend.13.8.0330</pub-id>
</citation>
</ref>
<ref id="B32">
<label>32</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Callard</surname> <given-names>GV</given-names>
</name>
</person-group>. <article-title>Differential Tissue Distribution, Developmental Programming, Estrogen Regulation and Promoter Characteristics of Cyp19 Genes in Teleost Fish</article-title>. <source>J Steroid Biochem Mol Biol</source> (<year>2001</year>) <volume>1-5</volume>(<issue>79</issue>):<page-range>305&#x2013;14</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/s0960-0760(01)00147-9</pub-id>
</citation>
</ref>
<ref id="B33">
<label>33</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kazeto</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Ijiri</surname> <given-names>S</given-names>
</name>
<name>
<surname>Place</surname> <given-names>AR</given-names>
</name>
<name>
<surname>Zohar</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Trant</surname> <given-names>JM</given-names>
</name>
</person-group>. <article-title>The 5&#x2019;-Flanking Regions of CYP19A1 and CYP19A2 in Zebrafish</article-title>. <source>Biochem Biophys Res Commun</source> (<year>2001</year>) <volume>288</volume>(<issue>3</issue>):<fpage>503</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1006/bbrc.2001.5796</pub-id>
</citation>
</ref>
<ref id="B34">
<label>34</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tanaka</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Structure and Promoter Analysis of the Cytochrome P-450 Aromatase Gene of the Teleost Fish, Medaka (Oryzias Latipes)</article-title>. <source>J Biochem</source> (<year>1995</year>) <volume>4</volume>(<issue>117</issue>):<page-range>719&#x2013;25</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/oxfordjournals.jbchem.a124768</pub-id>
</citation>
</ref>
<ref id="B35">
<label>35</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xiaotian</surname> <given-names>C</given-names>
</name>
</person-group>. <article-title>Two Types of Aromatase With Different Encoding Genes, Tissue Distribution and Developmental Expression in Nile Tilapia (Oreochromis Niloticus)</article-title>. <source>Gen Comp Endocrinol</source> (<year>2005</year>) <volume>141</volume>(<issue>2</issue>):<page-range>101&#x2013;15</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/oxfordjournals.jbchem.a124768</pub-id>
</citation>
</ref>
<ref id="B36">
<label>36</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kanda</surname> <given-names>H</given-names>
</name>
<name>
<surname>Okubo</surname> <given-names>T</given-names>
</name>
<name>
<surname>Omori</surname> <given-names>N</given-names>
</name>
<name>
<surname>Niihara</surname> <given-names>H</given-names>
</name>
<name>
<surname>Matsumoto</surname> <given-names>N</given-names>
</name>
<name>
<surname>Yamada</surname> <given-names>K</given-names>
</name>
<etal/>
</person-group>. <article-title>Transcriptional Regulation of the Rainbow Trout CYP19a Gene by FTZ-F1 Homologue</article-title>. <source>J Steroid Biochem Mol Biol</source> (<year>2006</year>) <volume>99</volume>(<issue>2</issue>):<fpage>85</fpage>&#x2013;<lpage>92</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jsbmb.2005.12.005</pub-id>
</citation>
</ref>
<ref id="B37">
<label>37</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>W</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>H</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>H</given-names>
</name>
<name>
<surname>Li</surname> <given-names>M</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>S</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Q</given-names>
</name>
<etal/>
</person-group>. <article-title>Isolation and Characterization of Cyp19a1a and Cyp19a1b Promoters in the Protogynous Hermaphrodite Orange-Spotted Grouper (Epinephelus Coioides)</article-title>. <source>Gen Comp Endocrinol</source> (<year>2012</year>) <volume>175</volume>(<issue>3</issue>):<page-range>473&#x2013;87</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ygcen.2011.12.005</pub-id>
</citation>
</ref>
<ref id="B38">
<label>38</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>W</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Peng</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>S</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>C</given-names>
</name>
<etal/>
</person-group>. <article-title>Differential Synergism of Ftz-F1 Homologues and Foxl2 on the Activation of Cyp19a1a Gene From Rice Field Eel Monopterus Albus, a Protogynous Hermaphroditic Teleost</article-title>. <source>Biol Reprod</source> (<year>2010</year>) <volume>82</volume>(<issue>1</issue>):<page-range>134&#x2013;5</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1095/biolreprod.109.076729</pub-id>
</citation>
</ref>
<ref id="B39">
<label>39</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ten-Tsao</surname> <given-names>W</given-names>
</name>
<name>
<surname>Shigeho</surname> <given-names>I</given-names>
</name>
<name>
<surname>Yonathan</surname> <given-names>Z</given-names>
</name>
</person-group>. <article-title>Molecular Biology of Ovarian Aromatase in Sex Reversal: Complementary DNA and 5&#x2019;-Flanking Region Isolation and Differential Expression of Ovarian Aromatase in the Gilthead Seabream (Sparus Aurata)</article-title>. <source>Biol Reprod</source> (<year>2006</year>) <volume>74</volume>(<issue>5</issue>):<fpage>857</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1095/biolreprod.105.045351</pub-id>
</citation>
</ref>
<ref id="B40">
<label>40</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Honda</surname> <given-names>SI</given-names>
</name>
<name>
<surname>Harada</surname> <given-names>N</given-names>
</name>
<name>
<surname>Abe-Dohmae</surname> <given-names>S</given-names>
</name>
<name>
<surname>Takagi</surname> <given-names>Y</given-names>
</name>
</person-group>. <article-title>Identification of Cis-Acting Elements in the Proximal Promoter Region for Brain-Specific Exon 1 of the Mouse Aromatase Gene</article-title>. <source>Mol Brain Res</source> (<year>1999</year>) <volume>66</volume>(<issue>1&#x2013;2</issue>):<page-range>122&#x2013;32</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/s0169-328x(99)00017-0</pub-id>
</citation>
</ref>
<ref id="B41">
<label>41</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shinoda</surname> <given-names>K</given-names>
</name>
<name>
<surname>Lei</surname> <given-names>H</given-names>
</name>
<name>
<surname>Yoshii</surname> <given-names>H</given-names>
</name>
<name>
<surname>Nomura</surname> <given-names>M</given-names>
</name>
<name>
<surname>Nagano</surname> <given-names>M</given-names>
</name>
<name>
<surname>Shiba</surname> <given-names>H</given-names>
</name>
<etal/>
</person-group>. <article-title>Developmental Defects of the Ventromedial Hypothalamic Nucleus and Pituitary Gonadotroph in the Ftz-F1 Disrupted Mice</article-title>. <source>Dev Dynamics</source> (<year>2010</year>) <volume>204</volume>(<issue>1</issue>):<page-range>22&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/aja.1002040104</pub-id>
</citation>
</ref>
<ref id="B42">
<label>42</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lamba</surname> <given-names>P</given-names>
</name>
<name>
<surname>Fortin</surname> <given-names>JS</given-names>
</name>
</person-group>. <article-title>A Novel Role for the Forkhead Transcription Factor FOXL2 in Activin A-Regulated Follicle-Stimulating Hormone Beta Subunit Transcription</article-title>. <source>Mol Endocrinol</source> (<year>2009</year>) <volume>23</volume>(<issue>7</issue>):<page-range>1001&#x2013;13</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1210/me.2008-0324</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>