<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Endocrinol.</journal-id>
<journal-title>Frontiers in Endocrinology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Endocrinol.</abbrev-journal-title>
<issn pub-type="epub">1664-2392</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fendo.2022.843334</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Endocrinology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>BRAF<sup>V600E</sup> Mutation-Responsive miRNA-222-3p Promotes Metastasis of Papillary Thyroid Cancer Cells <italic>via</italic> Snail-Induced EMT</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Gao</surname>
<given-names>Yuan</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1421625"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Xiang</surname>
<given-names>Dapeng</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Li</surname>
<given-names>Weijie</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zheng</surname>
<given-names>Xi</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Lin</given-names>
</name>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1124104"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Li</surname>
<given-names>Zhiyu</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1096818"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Chen</surname>
<given-names>Ting</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1421479"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Cancer Institute, Key Laboratory of Cancer Prevention and Intervention, Ministry of Education, Second Affiliated Hospital of Zhejiang University School of Medicine</institution>, <addr-line>Hangzhou</addr-line>, <country>China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Department of General Surgery, Second Affiliated Hospital School of Medicine, Zhejiang University</institution>, <addr-line>Hangzhou</addr-line>, <country>China</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Key Laboratory of Respiratory Disease of Zhejiang Province, Department of Respiratory and Critical Care Medicine, Second Affiliated Hospital of Zhejiang University School of Medicine</institution>, <addr-line>Hangzhou</addr-line>, <country>China</country>
</aff>
<aff id="aff4">
<sup>4</sup>
<institution>Zhejiang Provincial Key Laboratory of Pancreatic Disease, The First Affiliated Hospital, Zhejiang University School of Medicine</institution>, <addr-line>Hangzhou</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Joachim Feldkamp, Bielefeld University, Germany</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Khawla S. Al-Kuraya, King Faisal Specialist Hospital &amp; Research Centre, Saudi Arabia; Loris Bertazza, University of Padua, Italy</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Ting Chen, <email xlink:href="mailto:tchen2013@zju.edu.cn">tchen2013@zju.edu.cn</email>
</p>
</fn>
<fn fn-type="equal" id="fn003">
<p>&#x2020;These authors have contributed equally to this work and shared first authorship</p>
</fn>
<fn fn-type="other" id="fn002">
<p>This article was submitted to Cancer Endocrinology, a section of the journal Frontiers in Endocrinology</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>16</day>
<month>05</month>
<year>2022</year>
</pub-date>
<pub-date pub-type="collection">
<year>2022</year>
</pub-date>
<volume>13</volume>
<elocation-id>843334</elocation-id>
<history>
<date date-type="received">
<day>25</day>
<month>12</month>
<year>2021</year>
</date>
<date date-type="accepted">
<day>14</day>
<month>04</month>
<year>2022</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2022 Gao, Xiang, Li, Zheng, Wang, Li and Chen</copyright-statement>
<copyright-year>2022</copyright-year>
<copyright-holder>Gao, Xiang, Li, Zheng, Wang, Li and Chen</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>
<italic>BRAF</italic> mutation accounts for 50% of the PTC (papillary thyroid carcinoma) and is closely associated with high-risk clinicopathological characteristics. Increasing evidence implied that dysregulation of miRNA participated in carcinogenesis and progression of cancer. Clinical data showed the significant up-regulation of miR-222-3p in PTC; however, the role of miR-222-3p and possible relationship with <italic>BRAF</italic> mutation remained unclear. Here, we identified significant up-regulation of miR-222-3p in PTC tissues harboring <italic>BRAF<sup>V600E</sup>
</italic> mutation compared with BRAF wild type (<italic>BRAF<sup>WT</sup>
</italic>) from collected PTC clinical samples. External validation performed with The Cancer Genome Atlas (TCGA) databases was consistent with the above result. Exogenous expression of BRAF<sup>V600E</sup> oncoprotein increased the expression of miR-222-3p in B-CPAP and TPC-1 cells. The treatment of BRAF<sup>V600E</sup> and MEK inhibitor, PLX4720 and PD0325901, decreased the expression of miR-222-3p in B-CPAP but not in TPC-1. Inhibition of miR-222-3p significantly suppressed the migration of B-CPAP and induced a mesenchymal-epithelial transition (MET) phenotype <italic>via</italic> the Snail transcription factor. Immunohistochemistry (IHC) analysis demonstrated the up-regulation of Snail correlated with lymph node metastasis and <italic>BRAF<sup>V600E</sup>
</italic> mutation in PTC. Besides, <italic>in situ</italic> hybridization (ISH) and IHC analysis of PTC clinical samples confirmed the correlation between the expression of miR-222-3p and Snail. These results showed miR-222-3p conduced more aggressive clinical manifestation of PTC by promoting Snail-induced EMT.</p>
</abstract>
<kwd-group>
<kwd>papillary thyroid carcinoma</kwd>
<kwd>lymph node metastasis</kwd>
<kwd>miR-222-3p</kwd>
<kwd>BRAF<sup>V600E</sup>
</kwd>
<kwd>Snail</kwd>
</kwd-group>
<contract-sponsor id="cn001">National Natural Science Foundation of China<named-content content-type="fundref-id">10.13039/501100001809</named-content>
</contract-sponsor>
<counts>
<fig-count count="5"/>
<table-count count="1"/>
<equation-count count="0"/>
<ref-count count="24"/>
<page-count count="9"/>
<word-count count="4711"/>
</counts>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<title>Introduction</title>
<p>The incidence of PTC has significantly increased in the last decade worldwide. Although most PTCs have a good prognosis, some patients still went through local recurrence or distant metastasis after surgery and radioactive iodine therapy. Treatment of advanced PTC patients characterized by recurrent disease, distant metastasis, and resistance to radioactive iodine, including traditional radiotherapy, chemotherapy, and kinase inhibitors, has limited benefits, but a lot of side effects. These patients showed a poor quality of life and a dismal lifespan (5-year disease-specific survival is ~70%) (<xref ref-type="bibr" rid="B1">1</xref>, <xref ref-type="bibr" rid="B2">2</xref>).</p>
<p>miRNA is one endogenous non-coding RNA with a length of ~21 nucleotides, which can promote or inhibit protein expression by combining with target mRNA following the principle of base complementary pairing (<xref ref-type="bibr" rid="B3">3</xref>). Aberrant miRNA expression can activate multiple oncogenic pathways in different types of cancers (<xref ref-type="bibr" rid="B4">4</xref>). Previous studies showed that miR-222-3p was one of the most consistently overexpressed miRNAs in PTC and an eight to eleven folds increase compared to normal thyroid tissues has been reported (<xref ref-type="bibr" rid="B5">5</xref>, <xref ref-type="bibr" rid="B6">6</xref>). Up-regulated miR-222-3p can promote prostate cancer cell cycle transformation, enhance chordoma cell migration and facilitate endometrial carcinoma cell invasion (<xref ref-type="bibr" rid="B7">7</xref>&#x2013;<xref ref-type="bibr" rid="B9">9</xref>). In PTC, the up-regulation of miR-222-3p is correlated with high-risk features such as extrathyroidal extension, lymph node metastasis, and recurrence (<xref ref-type="bibr" rid="B5">5</xref>, <xref ref-type="bibr" rid="B10">10</xref>, <xref ref-type="bibr" rid="B11">11</xref>). However, the mechanism of the metastasis and invasion conducted by dysregulation of miR-222-3p still needs to be further explored.</p>
<p>There are multiple driver mutations in PTC, including but not limited to <italic>BRAF</italic> mutation, <italic>RAS</italic> mutation, <italic>TP53</italic> mutation, <italic>RET/PTC</italic> rearrangement, and <italic>NTRK1</italic> rearrangement (<xref ref-type="bibr" rid="B12">12</xref>), among which the <italic>BRAF<sup>V600E</sup>
</italic> mutation accounts for the highest proportion, reaching ~50%. BRAF<sup>V600E</sup> oncoprotein, caused by a c.1799 T&gt;A transversion, is associated with aggressive clinicopathologic features, such as extrathyroidal invasion, lymph node metastasis, and advanced disease stages (<xref ref-type="bibr" rid="B13">13</xref>, <xref ref-type="bibr" rid="B14">14</xref>). Induction of <italic>BRAF<sup>V600E</sup>
</italic> mutation and simultaneous activation of thyroid-stimulating hormone receptor signaling pathway can transform normal thyroid follicular cells into cancer cells (<xref ref-type="bibr" rid="B15">15</xref>). The BRAF<sup>V600E</sup> oncoprotein could constitutively activate the mitogen-activated protein kinase (MAPK) pathway, thereby enhancing malignancy (<xref ref-type="bibr" rid="B16">16</xref>).</p>
<p>Here, by analyzing the data of PTC patients from TCGA, we found that the miR-222-3p expression was related to the <italic>BRAF<sup>V600E</sup>
</italic> mutation in PTC. We supposed that BRAF<sup>V600E</sup> could augment the metastasis capability of PTC by upregulating miR-222-3p expression. In this study, we verified the correlation between the <italic>BRAF<sup>V600E</sup>
</italic> mutation and the up-regulation of miR-222-3p in the tumor samples of PTC patients. By adjusting the expression of BRAF<sup>V600E</sup> protein in the PTC cell line, the corresponding expression level of miR-222-3p was determined. Furthermore, we tried to elaborate on the metastasis-promoting effect of miR-222-3p through the Snail-induced EMT. The clarification of the correlation between miR-222-3p and BRAF<sup>V600E</sup> and the metastasis-promoting role of miR-222-3p in PTC may shed more light on the diagnosis and treatment of PTC.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<title>Materials and Methods</title>
<sec id="s2_1">
<title>Human Thyroid Tissues</title>
<p>70 cases of PTCs were collected by the Department of Pathology of Second Affiliated Hospital of Zhejiang University School of Medicine from 2019 to 2020. All PTC samples were surgically resected and the whole hematoxylin and eosin slides of all samples were reviewed by two senior pathologists. Formalin-fixed paraffin-embedded (FFPE) samples of PTCs were stored at room temperature (51 cases with <italic>BRAF<sup>V600E</sup>
</italic> mutation and 19 cases with BRAF<sup>WT</sup>. 45 cases with lymph node metastasis and 25 cases with no metastasis).45 consecutive cases with lymph node metastasis were included in two years to compare the miR-222-3p in PTC tumors with and without lymph node metastasis.</p>
<p>This study was approved by the Human Research Ethics Committee of the Second Affiliated Hospital of Zhejiang University School of Medicine, Hangzhou, China. The IRB protocol number is 2019010.</p>
</sec>
<sec id="s2_2">
<title>Cell Culture</title>
<p>B-CPAP (RRID: CVCL_0153) cell line was purchased from the Chinese Academy of Sciences (Shanghai, China). TPC-1 (RRID: CVCL_6298) cell line was purchased from Procell (Wuhan, China). K1 (RRID: CVCL_2537) cell line was purchased from Cellcook (Guangzhou, China). B-CPAP and TPC-1 were cultured in RPMI-1640 medium (Sigma), K1 was cultured in DMEM medium (Gibco). Both media were supplemented with 10% (v/v) fetal bovine serum. All cells were maintained at 5% CO<sub>2</sub> and 37&#xb0;C in a humidified atmosphere.</p>
</sec>
<sec id="s2_3">
<title>miRNA Inhibitor Transfection and MAPK Pathway Inhibitor</title>
<p>Cells were seeded in a 12-well plate. After 24h, transfection was performed with Lipofectamine 3000 reagent (Thermo Fisher Scientific), following the manufacturer&#x2019;s instructions. Transfection experiments were performed using 100nM miR-222-3p inhibitors or negative control (Genepharma). The inhibitor efficiency was greater than ninety-five percent. Sequences of miR-222-3p inhibitor and negative control were as following:</p>
<p>hsa-miR-222-3p inhibitor: 5&#x2019;-ACCCAGUAGCCAGAUGUAGCU-3&#x2019;; has-miR-222-3p negative control: 5&#x2019;-CAGUACUUUUGUGUAGUACAA-3&#x2019;.</p>
<p>PLX4720 (BRAF<sup>V600E</sup> inhibitor) and PD0325901 (MEK inhibitor) were purchased from Selleck.</p>
</sec>
<sec id="s2_4">
<title>Construction of BRAF<sup>V600E</sup> Overexpression Plasmid</title>
<p>pcDNA3.1- plasmid was used as the vector plasmid, and Xba I (Takara, <italic>TCTAGA</italic>) and Hind III (Takara, <italic>AAGCTT</italic>) were determined as restriction sites. A <italic>BRAF<sup>V600E</sup>
</italic> point mutation (GTG&#x2192;GAG) and the amplification primer sequence were shown below:</p>
<p>BRAF forward: 5&#x2019;-GC<italic>TCTAGA</italic>ATGGCGGCGCTGAGCGGTGG-3&#x2019;, BRAF<sup>V600E</sup> reverse: 5&#x2019;-CTCCATCGAGATTTCTCTGTAGCTAGACCAA-3&#x2019;; BRAF<sup>V600E</sup> forward: 5&#x2019;-TTGGTCTAGCTACAGAGAAATCTCGATGGAG-3&#x2019;, BRAF reverse: 5&#x2019;-CCC<italic>AAGCTT</italic>TCACTTGTCATCGTCGTCCTTGTAATCG TGGACAGGAAACGCACCATATC-3&#x2019;.</p>
</sec>
<sec id="s2_5">
<title>RNA Extraction and Quantitative Real-Time PCR</title>
<p>Total RNA was isolated with RNA-Quick Purification Kit (YiShan Biotech) according to the manufacturer&#x2019;s instructions. Reverse transcription of mRNA and miRNA (stem-loop primer) was performed following the manufacturer&#x2019;s protocols of the PrimeScript&#x2122; RT reagent kit (Takara). Quantitative real-time PCR was performed following the manufacturer&#x2019;s protocols of TB Green&#x2122; <italic>Premix Ex Taq</italic>&#x2122; II (Takara). Expression of miR-222-3p was normalized to internal control U6. Primer sequences as following: miR-222-3p forward: 5&#x2019;-GGGAGCTACATCTGGCTA-3&#x2019; and reverse: 5&#x2019;-GTGTCGTGGAGTCGGCAA-3&#x2019;; U6 forward: 5&#x2019;-CTCGCTTCGGCAGCACA-3&#x2019; and reverse: 5&#x2019;-AACGCTTCACGAATTTGCGT-3&#x2019;; miR-222-3p stem-loop primer: 5&#x2019;- CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGAGACC-3&#x2019;.</p>
</sec>
<sec id="s2_6">
<title>Western Blotting</title>
<p>Cells were lysed with Mammalian Protein Extract Reagent (Thermo Scientific) supplemented with protease inhibitor cocktail (1:100) (Thermo Scientific). Cell lysates were electrophoresed on 10% SDS-PAGE and then transferred to PVDF membranes. The membranes were blocked with 5% milk and then hybridized with a primary antibody at 4&#xb0;C overnight. The membrane was washed and hybridized with horseradish peroxidase (HRP)-conjugated secondary antibody. Signals were visualized by SuperSignal&#x2122; West Pico PLUS Chemiluminescent Substrate (Thermo Scientific). Primary antibodies were listed below: anti-E-cadherin (HUABIO, EM0502, 1:1000), anti-Snail (HUABIO, ER1706-22, 1:4000), anti-Zeb2 (HUABIO, ER64964, 1:1000), anti-NF-&#x3ba;B-P65 (HUABIO, ET1603-12, 1:2000), anti-p-P65(S536) (CST, EP2294Y, 1:1000), anti-p-P65(S468) (ABclonal, AP0446, 1:1000), anti-&#x3b2;-actin (HUABIO, M1210-2, 1:5000), anti-DYKDDDDK Tag (HUABIO, M1402-2, 1:2000).</p>
</sec>
<sec id="s2_7">
<title>Cell Migration</title>
<p>For transwell migration assay, cell migration ability was measured by transwell permeable chamber with 8.0 &#x3bc;m pore size (Corning Costar, USA). Cell transfected with miR-222-3p inhibitor or negative control were collected after 72&#xa0;h. 5 &#xd7; 10<sup>4</sup> cells were seeded on the upper chamber. 2.5% FBS was used as a chemokine in the lower chambers. After 4-5&#xa0;h of incubation at cell incubator cells were fixed with 4% paraformaldehyde for 30&#xa0;min and stained with crystal violet solution for 5&#xa0;min. Cells were removed from the upper membrane with cotton swabs and migrated cells on the lower membrane were taken photos under a microscope (Random 5 fields, 40 &#xd7;).</p>
</sec>
<sec id="s2_8">
<title>MiRNA ISH</title>
<p>In brief, FFPE tissue sections were deparaffinized in xylene and rehydrated in a series of decreasing alcohol concentrations. To expose miR-222-3p probes (MiR-222-3p probe sequence: 5&#x2019;-ACCCAGTAGCCAGATGTAGC-3&#x2019;), tissue sections were incubated with 15 &#x3bc;g/mL Proteinase K solution at 37&#xb0;C for 10&#xa0;min, after a titration experiment that established the optimal unmasking treatment while maintaining tissue morphology. 3% methanol-H<sub>2</sub>O<sub>2</sub> were used to block endogenous peroxidase. Tissues were then pre-hybridized with ISH buffer for 30&#xa0;min, and then hybridized with locked nucleic acid-based digoxigenin (DIG)-labeled miR binding oligonucleotides at 50&#xb0;C. Tissues were then washed stringently in decreasing concentrations of saline-sodium citrate (SSC) buffer. Following the stringent wash, tissues were blocked in 2% sheep serum and 1% bovine serum albumin (BSA). Tissues were then incubated with anti-DIG-HRP at 37&#xb0;C for 40&#xa0;min. Freshly prepared DAB color developing solution was added and the color development time was controlled under the microscope. The sections were re-dyed by Harris hematoxylin for about 3 minutes and dehydrated. Positive is brownish yellow, and the nucleus is blue.</p>
<p>The scoring system (1-12) is done according to the depth of the color and the proportion of the positive cell. The images corresponding to scores 0, 3, 6, 9, and 12 are shown in <xref ref-type="supplementary-material" rid="SF1">
<bold>Supplementary Figure&#xa0;1</bold>
</xref>.</p>
</sec>
<sec id="s2_9">
<title>IHC</title>
<p>FFPE tissue sections were deparaffinized, rehydrated, antigen retrieved using Proteinase K, and blocked in sheep serum and BSA solution as described above in the ISH section. Snail antigen was retrieved by citrate antigen retrieval solution (Beyotime Biotechnology). Then, tissue sections were incubated with polyclonal rabbit anti-human primary antibody (Snail 1:150, ER1706-22, HUABIO) at RT for 1&#xa0;h. A DAB Horseradish Peroxidase Color Development Kit (Beyotime Biotechnology) was used for the subsequent steps. Tissue endogenous peroxidase activity was blocked with peroxidase block for 5&#xa0;min. Thereafter, sections were incubated with horseradish peroxidase (HRP)-conjugated secondary antibody for 30&#xa0;min and visualized with diaminobenzidine (DAB) substrate at RT.</p>
</sec>
<sec id="s2_10">
<title>Statistical Analysis</title>
<p>A two-tailed <italic>t</italic>-test was used for continuous variables (GraphPad Prism v9.0 and SPSS v25). Mann-Whitney <italic>t</italic>-test was used for ranked variables. Ranked correlation analysis was used to analyze the correlation of ISH score (hsa-miR-222-3p) and IHC score (Snail) in 60 PTC samples. Each sample was corresponding to an ISH score and an H-score. The bioinformatics data on the miRNA expression and mutation status of PTC were publicly available from UCSC Xena Browser under GDC TCGA Thyroid Cancer (THCA) datasets. PTC samples in TCGA were divided into two groups (BRAF<sup>WT</sup> and BRAF<sup>V600E</sup> mutation) according to BRAF gene status. A two-tailed <italic>t-</italic>test was used for comparing the miRNA expression. <italic>p</italic>&lt;0.05 was considered as statistically significant.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<title>Results</title>
<sec id="s3_1">
<title>The Expression of miR-222-3p in PTCs With or Without <italic>BRAF<sup>V600E</sup>
</italic> Mutation</title>
<p>Through differential analysis of miR-222-3p expression in PTC clinical samples from TCGA, we found miR-222-3p had a higher expression level in PTC patients harboring <italic>BRAF<sup>V600E</sup>
</italic> mutation (n=279) compared with that in PTC patients harboring <italic>BRAF<sup>WT</sup>
</italic> (n=212) (p&lt;0.001) (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>). Subsequently, to further verify the clinical correlation of miR-222-3p, we evaluated miR-222-3p expression in PTC clinical samples from our research center through ISH analysis (<xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>). ISH analysis of PTC patients harboring <italic>BRAF<sup>V600E</sup>
</italic> mutation (n=51) and <italic>BRAF<sup>WT</sup>
</italic> (n=19) demonstrated that PTC lesions with <italic>BRAF<sup>V600E</sup>
</italic> mutation showed a higher level of miR-222-3p than that with <italic>BRAF<sup>WT</sup>
</italic> (p&lt;0.0001) (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1B, C</bold>
</xref>). In addition, we tested the expression of miR-222-3p in PTC cell lines, named TPC-1, B-CPAP, and K1 (TPC-1 cell line harbors <italic>BRAF<sup>WT</sup>
</italic>, while B-CPAP and K1 cell line harbor <italic>BRAF<sup>V600E</sup>
</italic> mutation). Through relative quantitative PCR (qPCR), we found the expression of miR-222-3p in B-CPAP (p=0.0154) and K1 (p=0.0035) cell lines was higher than that in TPC-1 (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1D</bold>
</xref>). We found that miR-222-3p was also overexpressed in the PTC cell line harboring <italic>BRAF<sup>V600E</sup>
</italic> mutation.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Hsa-miR-222-3p is overexpressed in PTC cells and patients harboring <italic>BRAF<sup>V600E</sup>
</italic> mutation. <bold>(A)</bold> Differential analysis of miR-222-3p expression for 491 thyroid cancerous tissues with <italic>BRAF<sup>WT</sup>
</italic> and <italic>BRAF<sup>V600E</sup>
</italic> mutation. RPM: reads per million mapped reads. ***p &lt; 0.001. <bold>(B)</bold> Representative images (200&#xd7;, 400&#xd7;) of CISH staining of PTC lesions from clinical patients harboring <italic>BRAF<sup>WT</sup>
</italic> and <italic>BRAF<sup>V600E</sup>
</italic> mutation. Negative control from normal thyroid tissues. Scale bar, 100 &#x3bc;M. <bold>(C)</bold> Mann-Whitney <italic>t</italic>-test analysis of miR-222-3p ISH score in PTC lesions between <italic>BRAF<sup>WT</sup>
</italic> and <italic>BRAF<sup>V600E</sup>
</italic>. The solid line and dotted line respectively represent median and interquartile range, ****p &lt; 0.0001. <bold>(D)</bold> q-PCR validation of miR-222-3p expression in PTC cell lines including TPC-1, B-CPAP, and K1. Bars represent means &#xb1; SD of 3 independent experiments each measured in triplicate. *p &lt; 0.05; **p &lt; 0.01.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-13-843334-g001.tif"/>
</fig>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Association between miR-222-3p expression and clinicopathological features in PTC.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Clinicopathological features</th>
<th valign="top" align="center"/>
<th valign="top" align="center">n</th>
<th valign="top" align="center">miR-222-3p score, median (interquartile range)</th>
<th valign="top" align="center">
<italic>P</italic> value</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">Age</td>
<td valign="top" align="left">&lt;55</td>
<td valign="top" align="center">54</td>
<td valign="top" align="center">5 (3-8)</td>
<td valign="top" rowspan="2" align="center">
<italic>p=0.3162</italic>
</td>
</tr>
<tr>
<td valign="top" align="left"/>
<td valign="top" align="left">&#x2265;55</td>
<td valign="top" align="center">16</td>
<td valign="top" align="center">7 (4-8)</td>
</tr>
<tr>
<td valign="top" align="left">Sex</td>
<td valign="top" align="left">Male</td>
<td valign="top" align="center">28</td>
<td valign="top" align="center">7 (4-8)</td>
<td valign="top" rowspan="2" align="center">
<italic>p=0.5126</italic>
</td>
</tr>
<tr>
<td valign="top" align="left"/>
<td valign="top" align="left">Female</td>
<td valign="top" align="center">42</td>
<td valign="top" align="center">4 (3-8.25)</td>
</tr>
<tr>
<td valign="top" align="left">Multicentricity</td>
<td valign="top" align="left">No</td>
<td valign="top" align="center">44</td>
<td valign="top" align="center">7 (3-9)</td>
<td valign="top" rowspan="2" align="center">
<italic>p=0.3176</italic>
</td>
</tr>
<tr>
<td valign="top" align="left"/>
<td valign="top" align="left">Yes</td>
<td valign="top" align="center">24</td>
<td valign="top" align="center">5 (3-8)</td>
</tr>
<tr>
<td valign="top" rowspan="3" align="left">Extrathyroidal extension</td>
<td valign="top" align="left">No</td>
<td valign="top" align="center">62</td>
<td valign="top" align="center">6 (3-8)</td>
<td valign="top" rowspan="2" align="center">
<italic>p=0.9306</italic>
</td>
</tr>
<tr>
<td valign="top" align="left">Yes</td>
<td valign="top" align="center">6</td>
<td valign="top" align="center">5 (4-9)</td>
</tr>
<tr>
<td valign="top" align="left">Unknown</td>
<td valign="top" align="center">2</td>
<td valign="top" align="center">/</td>
<td valign="top" align="center">/</td>
</tr>
<tr>
<td valign="top" align="left">Mutation status</td>
<td valign="top" align="left">BRAF<sup>WT</sup>
</td>
<td valign="top" align="center">19</td>
<td valign="top" align="center">3 (2-4)</td>
<td valign="top" rowspan="2" align="center">
<italic>p &lt; 0.0001</italic>
</td>
</tr>
<tr>
<td valign="top" align="left"/>
<td valign="top" align="left">BRAF<sup>V600E</sup>
</td>
<td valign="top" align="center">51</td>
<td valign="top" align="center">8 (4-12)</td>
</tr>
<tr>
<td valign="top" align="left">TNM stage</td>
<td valign="top" align="left">I</td>
<td valign="top" align="center">57</td>
<td valign="top" align="center">6 (3-8)</td>
<td valign="top" rowspan="2" align="center">
<italic>p=0.2626</italic>
</td>
</tr>
<tr>
<td valign="top" align="left"/>
<td valign="top" align="left">II/III/IV</td>
<td valign="top" align="center">13</td>
<td valign="top" align="center">8 (4-10)</td>
</tr>
<tr>
<td valign="top" align="left">T category</td>
<td valign="top" align="left">Tx</td>
<td valign="top" align="center">2</td>
<td valign="top" align="center">/</td>
<td valign="top" align="center">/</td>
</tr>
<tr>
<td valign="top" align="left"/>
<td valign="top" align="left">T1/T2</td>
<td valign="top" align="center">48</td>
<td valign="top" align="center">5 (2.25-8)</td>
<td valign="top" rowspan="2" align="center">
<italic>p=0.1017</italic>
</td>
</tr>
<tr>
<td valign="top" align="left"/>
<td valign="top" align="left">T3/T4</td>
<td valign="top" align="center">20</td>
<td valign="top" align="center">6 (4-12)</td>
</tr>
<tr>
<td valign="top" align="left">N category</td>
<td valign="top" align="left">N0</td>
<td valign="top" align="center">25</td>
<td valign="top" align="center">3 (2-4)</td>
<td valign="top" rowspan="2" align="center">
<italic>p &lt; 0.0001</italic>
</td>
</tr>
<tr>
<td valign="top" align="left"/>
<td valign="top" align="left">N1</td>
<td valign="top" align="center">45</td>
<td valign="top" align="center">8 (4-12)</td>
</tr>
<tr>
<td valign="top" align="left">M category</td>
<td valign="top" align="left">M0</td>
<td valign="top" align="center">69</td>
<td valign="top" align="center">6 (3-8)</td>
<td valign="top" rowspan="2" align="center">/</td>
</tr>
<tr>
<td valign="top" align="left"/>
<td valign="top" align="left">M1</td>
<td valign="top" align="center">1</td>
<td valign="top" align="center">4</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>TNM, tumor node metastasis;. TNM, stage according to the eighth edition of AJCC.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s3_2">
<title>BRAF<sup>V600E</sup> Oncoprotein Promotes miR-222-3p Expression in PTCs</title>
<p>The above experiments showed that miR-222-3p expression in PTC was correlated with <italic>BRAF<sup>V600E</sup>
</italic> mutation. We speculated that the BRAF<sup>V600E</sup> oncoprotein might promote miR-222-3p expression in PTC. To verify this hypothesis, we constructed a BRAF<sup>V600E</sup>-Flag overexpression plasmid (OE) with pcDNA3.1- as a vector. 48&#xa0;h after transfection, the differential expression of miR-222-3p could not be observed in TPC-1 transfected with OE plasmid (OE group) and empty vector (CTL group), neither was in B-CPAP (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2A&#x2013;C</bold>
</xref>). However, 72&#xa0;h after transfection, miR-222-3p expression in the OE group in both TPC-1 (p=0.0069) and B-CPAP (p=0.0385) were significantly increased compared with that in the CTL group (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2B, C</bold>
</xref>). These results confirmed that the BRAF<sup>V600E</sup> oncoprotein up-regulated the expression of miR-222-3p in PTC cell lines.</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>BRAF<sup>V600E</sup> oncoprotein regulates miR-222-3p expression in PTCs. <bold>(A)</bold> immunoblot of BRAF<sup>V600E</sup>-Flag protein from extracts of TPC-1 and B-CPAP transfected with OE plasmid or empty vector. <bold>(B, C)</bold> q-PCR validation of expression level of miR-222-3p in TPC-1 and B-CPAP transfected with OE plasmid or empty vector after 48&#xa0;h and 72&#xa0;h. Bars represent means &#xb1; SD of 3 independent experiments each measured in triplicate. **p &lt; 0.01; ***p &lt; 0.001. <bold>(D)</bold> Model of inhibitors suppresses BRAF<sup>V600E</sup>-MEK-ERK pathway. <bold>(E)</bold> q-PCR validation of expression level of miR-222-3p in B-CPAP and TPC-1 treated with 10 &#x3bc;M PLX4720 or DMSO after 24&#xa0;h. Bars represent means &#xb1; SD of 3 independent experiments each measured in triplicate. **p &lt; 0.01. <bold>(F)</bold> q-PCR validation of expression level of miR-222-3p in B-CPAP and TPC-1 treated with 10 &#x3bc;M PD0325901 or DMSO after 24&#xa0;h. Bars represent means &#xb1; SD of 3 independent experiments each measured in triplicate. ***p &lt; 0.001.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-13-843334-g002.tif"/>
</fig>
<p>To further clarify how the BRAF<sup>V600E</sup> oncoprotein regulates miR-222-3p, RAF/ERK pathway inhibitors were used to treat PTC cell lines and the expression of miR-222-3p was measured. PLX4720 is a highly selective BRAF<sup>V600E</sup> inhibitor, and its affinity to BRAF<sup>V600E</sup> mutant protein is about ten times higher than that to BRAF wild-type protein. PD0325901 is a non-ATP-competitive MEK inhibitor that inhibits the phosphorylation of ERK1 and ERK2 (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2D</bold>
</xref>). We treated TPC-1, K1, and B-CPAP with 10&#x3bc;M PLX4720 and PD0325901, respectively, and measured the expression of miR-222-3p by qPCR after 24&#xa0;h of treatment. These inhibitors did not affect the expression of miR-222-3p in TPC-1 (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2E, F</bold>
</xref>). For the K1 cell line, we found that 1&#x3bc;M PD0325901 significantly reduced the expression of miR-222-3p by 70% (p=0.0308). However, 1~10&#x3bc;M PLX4720 didn&#x2019;t inhibit the level of miR-222-3p in K1 (<xref ref-type="supplementary-material" rid="SF2">
<bold>Supplementary Figures&#xa0;2A, B</bold>
</xref>). After treatment of B-CPAP with PLX4720, the expression of miR-222-3p was reduced by about 50% (p=0.0433), and after treatment with PD0325901, the expression of miR-222-3p in B-CPAP was reduced by about 70% (p=0.0234) (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2E, F</bold>
</xref>). These results showed that the constitutive expression of miR-222-3p in TPC-1, K1, and B-CPAP could be distinct. The RAF/MEK/ERK pathway is responsible for the expression of miR-222-3p in B-CPAP; however, it seems that BRAF<sup>V600E</sup> inhibitor PLX4720 plays no effect on the activation of the MAPK/ERK pathway and miR-222-3p expression in K1. As for TPC-1, there could be other mechanisms regulating miR-222-3p expression instead of MAPK/ERK pathway.</p>
</sec>
<sec id="s3_3">
<title>MiR-222-3p Is Associated With Lymph Node Metastasis in PTCs</title>
<p>Through the above experimental data, the relationship between miR-222-3p expression and BRAF<sup>V600E</sup> has been clarified. The ISH analysis also showed that PTCs with lymph node metastasis (n=45) had a higher level of miR-222-3p expression (p&lt;0.0001) than those without lymph node metastasis (n=25) (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3A, B</bold>
</xref>). Besides, analysis of the TCGA database implied that the expression of miR-222-3p in PTCs with lymph node metastasis (n=226) was higher than that in PTCs without metastasis (n=231) (p &lt; 0.0001) (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3C</bold>
</xref>). These results indicated that miR-222-3p overexpression might increase the risk of lymph node metastasis. Furthermore, miR-222-3p ISH score and BRAF mutation status were used to predict lymph node metastasis of PTCs. In the ROC curve analysis (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3D</bold>
</xref>), the area under the curve (AUC) was 0.8689, and the optimal cut-off value (0.5859) exhibited a sensitivity and specificity of 0.8667 and 0.76, respectively.</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>miR-222-3p is correlated with lymph node metastasis in PTCs <bold>(A)</bold> Representative images (200&#xd7;, 400&#xd7;) of CISH staining of PTC lesions from clinical patients with and without lymph node metastasis. Scale bar, 100 &#x3bc;M. <bold>(B)</bold> Mann-Whitney <italic>t</italic>-test analysis of miR-222-3p ISH score in PTC lesions between &#x201c;No metastasis&#x201d; and &#x201c;lymph node metastasis&#x201d; group. The solid line and dotted line respectively represent median and interquartile range, ****p &lt; 0.0001. <bold>(C)</bold> Differential analysis of miR-222-3p expression between PTCs with lymph node metastasis (n = 226) and without metastasis (n = 231). FPKM: Fragments Per Kilobase per Million, ****p &lt; 0.0001. <bold>(D)</bold> ROC curve for the prediction of lymph node metastasis in PTCs.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-13-843334-g003.tif"/>
</fig>
</sec>
<sec id="s3_4">
<title>Downregulation of miR-222-3p Suppresses Cell Migration and EMT of PTCs</title>
<p>Next, we examined the role of miR-222-3p in PTC metastasis. The miR-222-3p inhibitor efficiency is greater than ninety-five percent (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4D</bold>
</xref> and <xref ref-type="supplementary-material" rid="SF2">
<bold>Supplementary Figure&#xa0;2C</bold>
</xref>). Suppression of miR-222-3p in B-CPAP and TPC-1 cells by transfection of inhibitors suppressed cell migration (p=0.0009, p=0.0037) (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4A&#x2013;C</bold>
</xref>). Nonetheless, the cell migration ability of K1 cell was not influenced by the miR-222-3p inhibitor (<xref ref-type="supplementary-material" rid="SF2">
<bold>Supplementary Figure&#xa0;2D</bold>
</xref>). Meanwhile, EMT-related markers were measured including E-cadherin, N-cadherin, Twist1, Vimentin, Zeb1, Zeb2, Snail, and Slug through immunoblotting analysis. The decreased expression of Snail and Zeb2 and increased expression of E-cadherin were observed in the B-CPAP inhibitor group (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4E</bold>
</xref> and <xref ref-type="supplementary-material" rid="SF3">
<bold>Supplementary Figure&#xa0;3A</bold>
</xref>). However, these changes cannot be observed in the TPC-1 cell line (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4F</bold>
</xref> and <xref ref-type="supplementary-material" rid="SF3">
<bold>Supplementary Figure&#xa0;3B</bold>
</xref>). These results implicated that miR-222-3p influenced the cell migration ability and the underlying mechanism varied from types of cell lines or gene mutation.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Downregulation of miR-222-3p suppresses cell migration and EMT of PTCs. <bold>(A)</bold> Migration images of representative microscope fields (40x, 100x). <bold>(B, C)</bold> <italic>t</italic>-test analysis of the number of B-CPAP and TPC-1 migrating cells of N.C. and IN group. *** p&lt; 0.001,**p &lt; 0.01. <bold>(D)</bold> q-PCR validation of expression level of miR-222-3p in B-CPAP and TPC-1 transfected with negative control (N.C.) and miR-222-3p inhibitor (IN). ***p &lt; 0.001,****p &lt; 0.0001. <bold>(E, F)</bold> immunoblot of E-cadherin, Zeb2, and Snail protein from extracts of B-CPAP and TPC-1 transfected N.C. and IN. *p &lt; 0.05.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-13-843334-g004.tif"/>
</fig>
</sec>
<sec id="s3_5">
<title>Expression of Snail Is Correlated With Lymph Node Metastasis in PTCs Harboring <italic>BRAF<sup>V600E</sup>
</italic> Mutation and miR-222-3p</title>
<p>
<italic>In vitro</italic> experiment, we showed that miR-222-3p regulated the expression of Snail in B-CPAP. We further examined the expression of Snail in 60 clinical PTC samples by IHC. Through rank correlation analysis, we found that, Snail expression was correlated with miR-222-3p in the PTC clinical samples (r=0.33, p=0.0111) (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5D</bold>
</xref>).</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>High expression of Snail is correlated with lymph node metastasis of PTC harboring <italic>BRAF<sup>V600E</sup>
</italic> mutation. <bold>(A)</bold> Representative images (100&#xd7;, 200&#xd7;) of IHC staining of PTC lesions from clinical patients with and without lymph node metastasis. Scale bar, 100 &#x3bc;M. <bold>(B)</bold> Mann-Whitney <italic>t</italic>-test analysis of Snail H-score in PTC lesions between &#x201c;No metastasis&#x201d; and &#x201c;lymph node metastasis&#x201d; group. The solid line and dotted line respectively represent median and interquartile range, *p &lt; 0.05. <bold>(C)</bold> Mann-Whitney <italic>t</italic>-test analysis of Snail H-score in PTC lesions with lymph node metastasis (right panel) or without metastasis (left panel) between BRAF<sup>WT</sup> and BRAF<sup>V600E</sup> group. The solid line and dotted line respectively represent the median and interquartile range, ns, p &gt; 0.05, **p &lt; 0.01. <bold>(D)</bold> Rank correlation analysis between the score of miR-222-3p and Snail from PTC clinical patients (Spearman r=0.33, N = 60, p=0.0111). Different color data points represented the different case numbers.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fendo-13-843334-g005.tif"/>
</fig>
<p>Furthermore, we also analyzed the correlation between Snail expression and PTC lymph node metastasis. The Snail IHC score in the tumor tissue of PTC patients with lymph node metastasis was significantly higher than that without lymph node metastasis (p=0.0219) (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5A, B</bold>
</xref>). Furthermore, in the tumor tissues of PTC patients without lymph node metastasis, <italic>BRAF<sup>V600E</sup>
</italic> mutation is not significantly related to the Snail IHC score (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5C</bold>
</xref> left); while in the tumor tissues of PTC patients with lymph node metastasis, Snail IHC score in the <italic>BRAF<sup>V600E</sup>
</italic> mutation group was significantly higher than that in the BRAF<sup>WT</sup> group (p=0.0072) (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5C</bold>
</xref> right). Consistent with the rank correlation analysis above, PTCs with both lymph node metastasis and <italic>BRAF<sup>V600E</sup>
</italic> mutation had the highest Snail IHC score and the highest miR-222-3p ISH score among the four groups. Taken together, these results showed that miR-222-3p could promote lymph node metastasis through upregulating Snail in PTCs harboring <italic>BRAF<sup>V600E</sup>
</italic> mutation.</p>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<title>Discussion</title>
<p>In this study, we clarified the correlation between the <italic>BRAF<sup>V600E</sup>
</italic> mutation and the overexpression of miR-222-3p in PTC. Meanwhile, we demonstrated that the miR-222-3p could promote the EMT <italic>via</italic> up-regulation of Snail and lymph node metastasis of PTCs.</p>
<p>Previous studies related to this subject were either focused on the correlation analysis between the <italic>BRAF<sup>V600E</sup>
</italic> mutation and aggressive clinicopathological characteristics such as recurrence, local extrathyroidal invasion, lymph node metastasis, and distant metastasis (<xref ref-type="bibr" rid="B17">17</xref>) or concentrated on the dysregulation of miR-222-3p in PTC patients (<xref ref-type="bibr" rid="B10">10</xref>). However, there is a lack of exploration between the <italic>BRAF<sup>V600E</sup>
</italic> mutation and the high expression of miR-222-3p in PTCs. In the present study, we used the public TCGA database for big data analysis combined with small sample verification to clarify that the <italic>BRAF<sup>V600E</sup>
</italic> mutation in PTC is related to the upregulation of miR-222-3p expression. Here, the expression level of miR-222-3p in clinical PTC samples was measured <italic>via</italic> the semi-quantitative CISH because of the small tumor size and the inevitable false positive staining of red blood cells in FISH. By inhibiting BRAF<sup>V600E</sup> and MEK, or overexpressing exogenous BRAF<sup>V600E</sup> in PTC cell lines, we confirmed that the expression level of miR-222-3p was indeed regulated by the <italic>BRAF<sup>V600E</sup>
</italic> mutation and BRAF-MEK-ERK pathway. In another word, miR-222-3p is located downstream of the BRAF<sup>V600E</sup>/ERK pathway and may act as an intermediate molecule of BRAF<sup>V600E</sup> oncoprotein to promote the malignant transformation. A similar conclusion was drawn in breast cancer that miR-222-3p was downstream of RAS/RAF/MEK/ERK (<xref ref-type="bibr" rid="B18">18</xref>).</p>
<p>Aberrant expression of miR-222-3p played an essential role in various types of cancers. Fan et&#xa0;al. found that decreased miR-222-3p promoted EMT in epithelial ovarian cancer (<xref ref-type="bibr" rid="B19">19</xref>). However, up-regulation of miR-222-3p in cancers was likely to be aggressive characteristics including promotion of cell proliferation, inhibition of cell apoptosis, and enhancement of cell migration and invasion (<xref ref-type="bibr" rid="B18">18</xref>, <xref ref-type="bibr" rid="B20">20</xref>). Gulluoglu et&#xa0;al. found that increased miR-222-3p promoted chordoma progression by targeting E-cadherin-mediated Zeb1-induced EMT (<xref ref-type="bibr" rid="B9">9</xref>). In breast cancer, up-regulation of miR-222-3p promoted Zeb2-induced EMT by targeting transcriptional repressor TRPS1 (<xref ref-type="bibr" rid="B18">18</xref>). Here, we found that inhibition of miR-222-3p could suppress EMT-related transcription factors, Snail and Zeb2, and meanwhile suppress cell migration in PTCs. MiR-222-3p could also facilitate or complicate migration and invasion in several types of cancers such as osteosarcoma, gastric cancer, and endometrial carcinoma (<xref ref-type="bibr" rid="B7">7</xref>, <xref ref-type="bibr" rid="B21">21</xref>, <xref ref-type="bibr" rid="B22">22</xref>). ISH analysis and IHC analysis of PTC clinical samples also revealed the correlation between miR-222-3p and Snail. Previous studies demonstrated the regulation of BRAF<sup>V600E</sup> on Snail in thyroid cancer cell lines and the correlation between <italic>SNAI1</italic> mRNA expression and lymph node metastasis in PTC patients (<xref ref-type="bibr" rid="B23">23</xref>, <xref ref-type="bibr" rid="B24">24</xref>). Here, using IHC analysis of PTC clinical samples, we demonstrated that the expression of Snail in cancerous tissues was related to lymph node metastasis from the protein level, especially in patients harboring <italic>BRAF<sup>V600E</sup>
</italic> mutation. In summary, our study demonstrated that the regulation of miR-222-3p by BRAF<sup>V600E</sup> oncoprotein promoted cell migration of PTCs as well as Snail-induced EMT and was correlated with lymph node metastasis of PTC patients.</p>
<p>Aberrant expression of microRNAs in the patients&#x2019; body fluids could be a piece of novel evidence to assist diagnosis of thyroid carcinoma and post-operation monitoring. On the basic findings of this topic, more studies needed to be carried out to validate our results. Meanwhile, the molecular mechanisms under how miR-222-3p affect lymph node metastasis of PTC patients also need to be further analyzed. These promising leads will provide a new potential biomarker for both diagnosis and prognosis in the clinic.</p>
</sec>
<sec id="s5" sec-type="data-availability">
<title>Data Availability Statement</title>
<p>The original contributions presented in the study are included in the article/<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Material</bold>
</xref>. Further inquiries can be directed to the corresponding author.</p>
</sec>
<sec id="s6" sec-type="ethics-statement">
<title>Ethics Statement </title>
<p>The studies involving human participants were reviewed and approved by Human Research Ethics Committee of the Second Affiliated Hospital of Zhejiang University School of Medicine, Hangzhou, China. The patients/participants provided their written informed consent to participate in this study.</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author Contributions</title>
<p>Conception and design: TC, YG, and DX. Collection and assembly of the data: DX, ZL, LW, and YG. Language editing and grammar correction: TC. Development of the methodology: WL and XZ. Data analysis and interpretation: all authors. Manuscript writing: all authors. All authors contributed to the article and approved the submitted version.</p>
</sec>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>The present study was funded by the National Natural Science Foundation of China (grant no. 81500115) and the Science and Technology Department of Zhejiang Province (grant no. 2016C33141).</p>
</sec>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of Interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s10" sec-type="disclaimer">
<title>Publisher&#x2019;s Note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
</body>
<back>
<sec id="s11" sec-type="supplementary-material">
<title>Supplementary Material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fendo.2022.843334/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fendo.2022.843334/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="Image_1.jpeg" id="SF1" mimetype="image/jpeg">
<label>Supplementary Figure&#xa0;1</label>
<caption>
<p>The images of the miR-222-3p ISH assay corresponding to scores 0, 3, 6, 9, and 12. Scale bar, 100 &#x3bc;M</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="Image_2.jpeg" id="SF2" mimetype="image/jpeg">
<label>Supplementary Figure&#xa0;2</label>
<caption>
<p>The regulation of miR-222-3p in K1 cell line and cell migration experiment. <bold>(A)</bold> q-PCR validation of expression level of miR-222-3p in K1 treated with 1~10 &#x3bc;M PD0325901 or DMSO after 24&#xa0;h. Bars represent means &#xb1; SD of 3 independent experiments each measured in triplicate. *p &lt; 0.05. <bold>(B)</bold> q-PCR validation of expression level of miR-222-3p in K1 treated with 1~10 &#x3bc;M PLX4720 or DMSO after 24&#xa0;h. Bars represent means &#xb1; SD of 3 independent experiments each measured in triplicate. <bold>(C)</bold> q-PCR validation of expression level of miR-222-3p in K1 transfected with N.C and IN. **p &lt; 0.01. <bold>(D)</bold> Migration images of random microscope fields (200x). There is no significant cell number difference between N.C. and IN in K1.</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="Image_3.jpeg" id="SF3" mimetype="image/jpeg">
<label>Supplementary Figure&#xa0;3</label>
<caption>
<p>Statistical analysis graphs of EMT-associated proteins expression between N.C. and IN. <bold>(A)</bold> Using student&#x2019;s t-test method to compare the expression level of E-cadherin, Zeb2, and Snail between N.C. and IN in B-CPAP cell line. *p &lt; 0.05. <bold>(B)</bold> Using student&#x2019;s t-test method to compare the expression level of E-cadherin, Zeb2, and Snail between N.C. and IN in TPC-1 cell line.</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="DataSheet_1.pdf" id="SM1" mimetype="application/pdf"/>
<supplementary-material xlink:href="DataSheet_2.pdf" id="SM2" mimetype="application/pdf"/>
<supplementary-material xlink:href="DataSheet_3.zip" id="SM3" mimetype="application/zip"/>
<supplementary-material xlink:href="DataSheet_4.zip" id="SM4" mimetype="application/zip"/>
<supplementary-material xlink:href="DataSheet_5.zip" id="SM5" mimetype="application/zip"/>
<supplementary-material xlink:href="DataSheet_6.zip" id="SM6" mimetype="application/zip"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nixon</surname> <given-names>IJ</given-names>
</name>
<name>
<surname>Whitcher</surname> <given-names>MM</given-names>
</name>
<name>
<surname>Palmer</surname> <given-names>FL</given-names>
</name>
<name>
<surname>Tuttle</surname> <given-names>RM</given-names>
</name>
<name>
<surname>Shaha</surname> <given-names>AR</given-names>
</name>
<name>
<surname>Shah</surname> <given-names>JP</given-names>
</name>
<etal/>
</person-group>. <article-title>The Impact of Distant Metastases at Presentation on Prognosis in Patients With Differentiated Carcinoma of the Thyroid Gland</article-title>. <source>Thyroid Off J Am Thyroid Assoc</source> (<year>2012</year>) <volume>22</volume>:<page-range>884&#x2013;9</page-range>. doi: <pub-id pub-id-type="doi">10.1089/thy.2011.0535</pub-id>
</citation>
</ref>
<ref id="B2">
<label>2</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>TS</given-names>
</name>
<name>
<surname>Sosa</surname> <given-names>JA</given-names>
</name>
</person-group>. <article-title>Thyroid Surgery for Differentiated Thyroid Cancer - Recent Advances and Future Directions</article-title>. <source>Nat Rev Endocrinol</source> (<year>2018</year>) <volume>14</volume>:<page-range>670&#x2013;83</page-range>. doi: <pub-id pub-id-type="doi">10.1038/s41574-018-0080-7</pub-id>
</citation>
</ref>
<ref id="B3">
<label>3</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Krol</surname> <given-names>J</given-names>
</name>
<name>
<surname>Loedige</surname> <given-names>I</given-names>
</name>
<name>
<surname>Filipowicz</surname> <given-names>W</given-names>
</name>
</person-group>. <article-title>The Widespread Regulation of microRNA Biogenesis, Function and Decay</article-title>. <source>Nat Rev Genet</source> (<year>2010</year>) <volume>11</volume>:<fpage>597</fpage>&#x2013;<lpage>610</lpage>. doi: <pub-id pub-id-type="doi">10.1038/nrg2843</pub-id>
</citation>
</ref>
<ref id="B4">
<label>4</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hayes</surname> <given-names>J</given-names>
</name>
<name>
<surname>Peruzzi</surname> <given-names>PP</given-names>
</name>
<name>
<surname>Lawler</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>MicroRNAs in Cancer: Biomarkers, Functions and Therapy</article-title>. <source>Trends Mol Med</source> (<year>2014</year>) <volume>20</volume>:<page-range>460&#x2013;9</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.molmed.2014.06.005</pub-id>
</citation>
</ref>
<ref id="B5">
<label>5</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>H</given-names>
</name>
<name>
<surname>He</surname> <given-names>L</given-names>
</name>
<name>
<surname>Dong</surname> <given-names>W</given-names>
</name>
<name>
<surname>Li</surname> <given-names>J</given-names>
</name>
<name>
<surname>Shan</surname> <given-names>Z</given-names>
</name>
<etal/>
</person-group>. <article-title>Association Between the Expression of Four Upregulated miRNAs and Extrathyroidal Invasion in Papillary Thyroid Carcinoma</article-title>. <source>OncoTarg Ther</source> (<year>2013</year>) <volume>6</volume>:<page-range>281&#x2013;7</page-range>. doi: <pub-id pub-id-type="doi">10.2147/OTT.S43014</pub-id>
</citation>
</ref>
<ref id="B6">
<label>6</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kondrotien&#x117;</surname> <given-names>A</given-names>
</name>
<name>
<surname>Dauk&#x161;a</surname> <given-names>A</given-names>
</name>
<name>
<surname>Pamedytyt&#x117;</surname> <given-names>D</given-names>
</name>
<name>
<surname>Kazokait&#x117;</surname> <given-names>M</given-names>
</name>
<name>
<surname>&#x17d;virblien&#x117;</surname> <given-names>A</given-names>
</name>
<name>
<surname>Dauk&#x161;ien&#x117;</surname> <given-names>D</given-names>
</name>
<etal/>
</person-group>. <article-title>Plasma-Derived miRNA-222 as a Candidate Marker for Papillary Thyroid Cancer</article-title>. <source>Int J Mol Sci</source> (<year>2020</year>) <volume>21</volume>:<fpage>6445</fpage>. doi: <pub-id pub-id-type="doi">10.3390/ijms21176445</pub-id>
</citation>
</ref>
<ref id="B7">
<label>7</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>B</given-names>
</name>
<name>
<surname>Che</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Qiu</surname> <given-names>H</given-names>
</name>
<name>
<surname>Bao</surname> <given-names>W</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>X</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>W</given-names>
</name>
<etal/>
</person-group>. <article-title>Elevated MiR-222-3p Promotes Proliferation and Invasion of Endometrial Carcinoma <italic>via</italic> Targeting Er&#x3b1;</article-title>. <source>PloS One</source> (<year>2014</year>) <volume>9</volume>:<fpage>e87563</fpage>. doi: <pub-id pub-id-type="doi">10.1371/journal.pone.0087563</pub-id>
</citation>
</ref>
<ref id="B8">
<label>8</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Galardi</surname> <given-names>S</given-names>
</name>
<name>
<surname>Mercatelli</surname> <given-names>N</given-names>
</name>
<name>
<surname>Giorda</surname> <given-names>E</given-names>
</name>
<name>
<surname>Massalini</surname> <given-names>S</given-names>
</name>
<name>
<surname>Frajese</surname> <given-names>GV</given-names>
</name>
<name>
<surname>Ciafr&#xe8;</surname> <given-names>SA</given-names>
</name>
<etal/>
</person-group>. <article-title>miR-221 and miR-222 Expression Affects the Proliferation Potential of Human Prostate Carcinoma Cell Lines by Targeting p27Kip1</article-title>. <source>J Biol Chem</source> (<year>2007</year>) <volume>282</volume>:<page-range>23716&#x2013;24</page-range>. doi: <pub-id pub-id-type="doi">10.1074/jbc.M701805200</pub-id>
</citation>
</ref>
<ref id="B9">
<label>9</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gulluoglu</surname> <given-names>S</given-names>
</name>
<name>
<surname>Tuysuz</surname> <given-names>EC</given-names>
</name>
<name>
<surname>Kuskucu</surname> <given-names>A</given-names>
</name>
<name>
<surname>Ture</surname> <given-names>U</given-names>
</name>
<name>
<surname>Atalay</surname> <given-names>B</given-names>
</name>
<name>
<surname>Sahin</surname> <given-names>F</given-names>
</name>
<etal/>
</person-group>. <article-title>The Potential Function of microRNA in Chordomas</article-title>. <source>Gene</source> (<year>2016</year>) <volume>585</volume>:<fpage>76</fpage>&#x2013;<lpage>83</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.gene.2016.03.032</pub-id>
</citation>
</ref>
<ref id="B10">
<label>10</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jiang</surname> <given-names>K</given-names>
</name>
<name>
<surname>Li</surname> <given-names>G</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>W</given-names>
</name>
<name>
<surname>Song</surname> <given-names>L</given-names>
</name>
<name>
<surname>Wei</surname> <given-names>T</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Z</given-names>
</name>
<etal/>
</person-group>. <article-title>Plasma Exosomal miR-146b-5p and miR-222-3p Are Potential Biomarkers for Lymph Node Metastasis in Papillary Thyroid Carcinomas</article-title>. <source>OncoTarg Ther</source> (<year>2020</year>) <volume>13</volume>:<page-range>1311&#x2013;9</page-range>. doi: <pub-id pub-id-type="doi">10.2147/OTT.S231361</pub-id>
</citation>
</ref>
<ref id="B11">
<label>11</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lee</surname> <given-names>JC</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>JT</given-names>
</name>
<name>
<surname>Clifton-Bligh</surname> <given-names>RJ</given-names>
</name>
<name>
<surname>Gill</surname> <given-names>A</given-names>
</name>
<name>
<surname>Gundara</surname> <given-names>JS</given-names>
</name>
<name>
<surname>Ip</surname> <given-names>JC</given-names>
</name>
<etal/>
</person-group>. <article-title>MicroRNA-222 and microRNA-146b Are Tissue and Circulating Biomarkers of Recurrent Papillary Thyroid Cancer</article-title>. <source>Cancer</source> (<year>2013</year>) <volume>119</volume>:<page-range>4358&#x2013;65</page-range>. doi: <pub-id pub-id-type="doi">10.1002/cncr.28254</pub-id>
</citation>
</ref>
<ref id="B12">
<label>12</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Carling</surname> <given-names>T</given-names>
</name>
<name>
<surname>Udelsman</surname> <given-names>R</given-names>
</name>
</person-group>. <article-title>Thyroid Cancer</article-title>. <source>Annu Rev Med</source> (<year>2014</year>) <volume>65</volume>:<page-range>125&#x2013;37</page-range>. doi: <pub-id pub-id-type="doi">10.1146/annurev-med-061512-105739</pub-id>
</citation>
</ref>
<ref id="B13">
<label>13</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Frasca</surname> <given-names>F</given-names>
</name>
<name>
<surname>Nucera</surname> <given-names>C</given-names>
</name>
<name>
<surname>Pellegriti</surname> <given-names>G</given-names>
</name>
<name>
<surname>Gangemi</surname> <given-names>P</given-names>
</name>
<name>
<surname>Attard</surname> <given-names>M</given-names>
</name>
<name>
<surname>Stella</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>BRAF(V600E) Mutation and the Biology of Papillary Thyroid Cancer</article-title>. <source>Endocrine-Related Cancer</source> (<year>2008</year>) <volume>15</volume>:<fpage>191</fpage>&#x2013;<lpage>205</lpage>. doi: <pub-id pub-id-type="doi">10.1677/ERC-07-0212</pub-id>
</citation>
</ref>
<ref id="B14">
<label>14</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Elisei</surname> <given-names>R</given-names>
</name>
<name>
<surname>Ugolini</surname> <given-names>C</given-names>
</name>
<name>
<surname>Viola</surname> <given-names>D</given-names>
</name>
<name>
<surname>Lupi</surname> <given-names>C</given-names>
</name>
<name>
<surname>Biagini</surname> <given-names>A</given-names>
</name>
<name>
<surname>Giannini</surname> <given-names>R</given-names>
</name>
<etal/>
</person-group>. <article-title>BRAF(V600E) Mutation and Outcome of Patients With Papillary Thyroid Carcinoma: A 15-Year Median Follow-Up Study</article-title>. <source>J Clin Endocrinol Metab</source> (<year>2008</year>) <volume>93</volume>:<page-range>3943&#x2013;9</page-range>. doi: <pub-id pub-id-type="doi">10.1210/jc.2008-0607</pub-id>
</citation>
</ref>
<ref id="B15">
<label>15</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Franco</surname> <given-names>AT</given-names>
</name>
<name>
<surname>Malaguarnera</surname> <given-names>R</given-names>
</name>
<name>
<surname>Refetoff</surname> <given-names>S</given-names>
</name>
<name>
<surname>Liao</surname> <given-names>X-H</given-names>
</name>
<name>
<surname>Lundsmith</surname> <given-names>E</given-names>
</name>
<name>
<surname>Kimura</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>Thyrotrophin Receptor Signaling Dependence of Braf-Induced Thyroid Tumor Initiation in Mice</article-title>. <source>Proc Natl Acad Sci USA</source> (<year>2011</year>) <volume>108</volume>:<page-range>1615&#x2013;20</page-range>. doi: <pub-id pub-id-type="doi">10.1073/pnas.1015557108</pub-id>
</citation>
</ref>
<ref id="B16">
<label>16</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Caronia</surname> <given-names>LM</given-names>
</name>
<name>
<surname>Phay</surname> <given-names>JE</given-names>
</name>
<name>
<surname>Shah</surname> <given-names>MH</given-names>
</name>
</person-group>. <article-title>Role of BRAF in Thyroid Oncogenesis</article-title>. <source>Clin Cancer Res  Off J Am Assoc Cancer Res</source> (<year>2011</year>) <volume>17</volume>:<page-range>7511&#x2013;7</page-range>. doi: <pub-id pub-id-type="doi">10.1158/1078-0432.CCR-11-1155</pub-id>
</citation>
</ref>
<ref id="B17">
<label>17</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Moon</surname> <given-names>S</given-names>
</name>
<name>
<surname>Song</surname> <given-names>YS</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>YA</given-names>
</name>
<name>
<surname>Lim</surname> <given-names>JA</given-names>
</name>
<name>
<surname>Cho</surname> <given-names>SW</given-names>
</name>
<name>
<surname>Moon</surname> <given-names>JH</given-names>
</name>
<etal/>
</person-group>. <article-title>Effects of Coexistent BRAF and TERT Promoter Mutations on Poor Clinical Outcomes in Papillary Thyroid Cancer: A Meta-Analysis</article-title>. <source>Thyroid Off J Am Thyroid Assoc</source> (<year>2017</year>) <volume>27</volume>:<page-range>651&#x2013;60</page-range>. doi: <pub-id pub-id-type="doi">10.1089/thy.2016.0350</pub-id>
</citation>
</ref>
<ref id="B18">
<label>18</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Stinson</surname> <given-names>S</given-names>
</name>
<name>
<surname>Lackner</surname> <given-names>MR</given-names>
</name>
<name>
<surname>Adai</surname> <given-names>AT</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>N</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>H-J</given-names>
</name>
<name>
<surname>O'Brien</surname> <given-names>C</given-names>
</name>
<etal/>
</person-group>. <article-title>TRPS1 Targeting by miR-221/222 Promotes the Epithelial-to-Mesenchymal Transition in Breast Cancer</article-title>. <source>Sci Signaling</source> (<year>2011</year>) <volume>4</volume>:<fpage>ra41</fpage>. doi: <pub-id pub-id-type="doi">10.1126/scisignal.2001538</pub-id>
</citation>
</ref>
<ref id="B19">
<label>19</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fan</surname> <given-names>L</given-names>
</name>
<name>
<surname>Lei</surname> <given-names>H</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>S</given-names>
</name>
<name>
<surname>Peng</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Fu</surname> <given-names>C</given-names>
</name>
<name>
<surname>Shu</surname> <given-names>G</given-names>
</name>
<etal/>
</person-group>. <article-title>Non-Canonical Signaling Pathway of SNAI2 Induces EMT in Ovarian Cancer Cells by Suppressing miR-222-3p Transcription and Upregulating PDCD10</article-title>. <source>Theranostics</source> (<year>2020</year>) <volume>10</volume>:<page-range>5895&#x2013;913</page-range>. doi: <pub-id pub-id-type="doi">10.7150/thno.43198</pub-id>
</citation>
</ref>
<ref id="B20">
<label>20</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chatterjee</surname> <given-names>A</given-names>
</name>
<name>
<surname>Jana</surname> <given-names>S</given-names>
</name>
<name>
<surname>Chatterjee</surname> <given-names>S</given-names>
</name>
<name>
<surname>Wastall</surname> <given-names>LM</given-names>
</name>
<name>
<surname>Mandal</surname> <given-names>G</given-names>
</name>
<name>
<surname>Nargis</surname> <given-names>N</given-names>
</name>
<etal/>
</person-group>. <article-title>MicroRNA-222 Reprogrammed Cancer-Associated Fibroblasts Enhance Growth and Metastasis of Breast Cancer</article-title>. <source>Br J Cancer</source> (<year>2019</year>) <volume>121</volume>:<page-range>679&#x2013;89</page-range>. doi: <pub-id pub-id-type="doi">10.1038/s41416-019-0566-7</pub-id>
</citation>
</ref>
<ref id="B21">
<label>21</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Guo</surname> <given-names>J</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>H</given-names>
</name>
<name>
<surname>Bai</surname> <given-names>C</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>F</given-names>
</name>
</person-group>. <article-title>miR-222-3p Promotes Osteosarcoma Cell Migration and Invasion Through Targeting TIMP3</article-title>. <source>OncoTarg Ther</source> (<year>2018</year>) <volume>11</volume>:<page-range>8643&#x2013;53</page-range>. doi: <pub-id pub-id-type="doi">10.2147/OTT.S175745</pub-id>
</citation>
</ref>
<ref id="B22">
<label>22</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tan</surname> <given-names>X</given-names>
</name>
<name>
<surname>Tang</surname> <given-names>H</given-names>
</name>
<name>
<surname>Bi</surname> <given-names>J</given-names>
</name>
<name>
<surname>Li</surname> <given-names>N</given-names>
</name>
<name>
<surname>Jia</surname> <given-names>Y</given-names>
</name>
</person-group>. <article-title>MicroRNA-222-3p Associated With Helicobacter Pylori Targets HIPK2 to Promote Cell Proliferation, Invasion, and Inhibits Apoptosis in Gastric Cancer</article-title>. <source>J Cell Biochem</source> (<year>2018</year>) <volume>119</volume>:<page-range>5153&#x2013;62</page-range>. doi: <pub-id pub-id-type="doi">10.1002/jcb.26542</pub-id>
</citation>
</ref>
<ref id="B23">
<label>23</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Baquero</surname> <given-names>P</given-names>
</name>
<name>
<surname>S&#xe1;nchez-Hern&#xe1;ndez</surname> <given-names>I</given-names>
</name>
<name>
<surname>Jim&#xe9;nez-Mora</surname> <given-names>E</given-names>
</name>
<name>
<surname>Orgaz</surname> <given-names>JL</given-names>
</name>
<name>
<surname>Jim&#xe9;nez</surname> <given-names>B</given-names>
</name>
<name>
<surname>Chiloeches</surname> <given-names>A</given-names>
</name>
</person-group>. <article-title>(V600E)BRAF Promotes Invasiveness of Thyroid Cancer Cells by Decreasing E-Cadherin Expression Through a Snail-Dependent Mechanism</article-title>. <source>Cancer Lett</source> (<year>2013</year>) <volume>335</volume>:<page-range>232&#x2013;41</page-range>. doi: <pub-id pub-id-type="doi">10.1016/j.canlet.2013.02.033</pub-id>
</citation>
</ref>
<ref id="B24">
<label>24</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wieczorek-Szukala</surname> <given-names>K</given-names>
</name>
<name>
<surname>Kopczynski</surname> <given-names>J</given-names>
</name>
<name>
<surname>Kowalska</surname> <given-names>A</given-names>
</name>
<name>
<surname>Lewinski</surname> <given-names>A</given-names>
</name>
</person-group>. <article-title>Overexpression Correlates With Metastatic Phenotype in BRAF Positive Papillary Thyroid Carcinoma</article-title>. <source>J Clin Med</source> (<year>2020</year>) <volume>9</volume>:<fpage>2701</fpage>. doi: <pub-id pub-id-type="doi">10.3390/jcm9092701</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>