Immortalized human dental pulp cells (HDPs) transfected with the telomerase transcriptase gene were used. These cells were provided by Prof. Takashi Takata (Hiroshima University Graduate School, Hiroshima, Japan; Shunan University, Shunan, Japan); their characteristics are previously described (17). Cells were cultured in growth medium (GM), alpha minimum essential medium (αMEM; Thermo Fisher Scientific, Waltham, USA) supplemented with 10% fetal bovine serum (FBS; Cytiva, Tokyo, Japan), and 100 IU/ml penicillin-streptomycin (Thermo Fisher Scientific) with passaging before subconfluence. Cell culture was performed under humidified conditions at 37°C, 5% CO₂, and the culture medium was changed every 2 days.

We used n-butylboronic acid (n-BA; Sigma-Aldrich, St. Louis, USA), an organoboron compound chemically like boric acid. The n-BA was prepared at 0.1 g/ml by dissolving in αMEM, filtered through 0.2 µm filter (Sartorius AG, Göttingen, Germany) and stored. The n-BA was diluted to the final concentration in the culture medium selected for each experiment.

HDPs were seeded on 96-well plates (IWAKI, Tokyo, Japan) at a density of 1.5 × 10³ cells/well and exchanged with GM supplemented with n-BA 24 h later. Final concentrations of 0.01, 0.1, and 1.0 mM of n-BA GM were prepared. As a control group, growth medium without n-BA was prepared. Cell proliferation activity was measured by the tetrazolium salts (WST-1) assay (Roche Diagnostics, Mannheim, Germany) according to the manufacturer's instructions. The reagent was added to wells at 3, 5, and 7 days with GM at a determined n-BA concentration, and incubated at 37°C for 60 min, and absorbance was measured at 450 nm using a microplate reader (Agilent Technologies, California, USA).

To investigate odontogenic differentiation, HDPs were seeded on 6-well plates at a density of 1.0 × 10⁵ cells/well. After incubation at 37°C, 5% CO₂ humidified until 70%–80% confluency, the medium was changed to osteogenic differentiation medium (OBM). OBM was prepared by adding 10% FBS (Cytiva), 100 IU/ml penicillin-streptomycin (Thermo Fisher Scientific) 10 nmol/L dexamethasone (Sigma-Aldrich), 10 mmol/L β-glycerol phosphate (Wako Pure Chemical Industries, Osaka, Japan), and 50 mmol/L ascorbic acid (Wako Pure Chemical Industries) to αMEM. The culture medium was changed every 2 days.

To evaluate ALP production or mineralization, HDPs were cultured in OBM with and without n-BA. After 7, 14, 21, and 28 days in each culture medium, HDPs were rinsed with phosphate buffered saline (PBS; KAC, Hyogo, Japan) and fixed in 4% paraformaldehyde solution (Wako Pure Chemical Industries) for 10 min. For the ALP staining, TRAP/ALP staining kit (Wako Pure Chemical Industries) was used according to the manufacturer's instructions. HDPs were rinsed with PBS and permeabilization with ethanol/acetone (50:50 v/v) was carried out. ALP substrate solution was incubated at 37°C for 60 min, and the reaction quenched by rinsing with PBS. For staining with alizarin red S (Wako Pure Chemical Industries) after fixation with 4% formaldehyde solution for 10 min, HDPs were stained with alizarin red S staining solution (pH 6.38 with ammonia solution, Wako Pure Chemical Industries) for 60 min, and the reaction quenched by washing with Milli-Q water. The stained HDPs were observed and photographed using an all-in-one fluorescence microscope BZ-X710 (Keyence, Osaka, Japan).

ALP activity changes with and without n-BA were quantified for HDPs. HDPs were cultured with and without n-BA for 7, 14, 21, and 28 days. ALP activity was evaluated using LabAssay ALP (Wako Pure Chemical Industries) according to the manufacturer's instructions with absorbance measured at 405 nm using a microplate reader. To extract total protein, HDPs were dissolved in radio-immunoprecipitation assay buffer (1% Nonidet P-40; Sigma-Aldrich, 150 mmol/L NaCl, and 50 mmol/L Tris; pH = 7.4; containing protease inhibitors). Protein concentrations were determined by the Lowry method using the DC Protein assay (Bio-Rad Laboratories, Hercules, Canada) with bovine serum albumin as standard. ALP activity was calculated as unit per μg protein.

The expression of hard tissue-associated and NaBC1 genes was analyzed by real-time PCR of HDPs. HDPs were cultured in OBM with an n-BA concentration of 0.1 mM [n-BA(+)] or without n-BA [n-BA(−)]. At each time point, total RNA was extracted using TRIzol reagent (Thermo Fisher Scientific) according to the manufacturer's instructions. The RNA was reverse transcribed to complementary DNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, Canada). Analysis of RT-PCR was performed using 2X TaqMan Fast Universal PCR Master Mix no AmpErase reagent (Applied Biosystems) on an ABI7500 Fast System (Applied Biosystems). Gap junction protein alpha 1 (GJA1, Hs00748445_s1), ALP (Hs01029144_m1), osteocalcin (OCN, Hs01587814_g1), and NaBC1 (Hs00984700_g1) were used as target genes and glyceraldehyde-3-posphate dehydrogenase (GAPDH; Applied Biosystems) as an endogenous control gene. The polymerase chain reaction consisting of denaturation at 95°C for 3 s then annealing and extension at 60°C for 30 s was performed for 40 cycles. The incubation period was 7, 14, and 28 days for hard tissue-related gene analysis, and 21 and 28 days for NaBC1 analysis. Relative expression of target genes was estimated using the ΔΔ threshold cycle (Ct) method. The Ct value of GAPDH was subtracted from the Ct value of the target gene to normalize the amount of messenger RNA (mRNA) of the target gene to obtain the ΔCt value. The difference (ΔΔCt) between the ΔCt value of the target gene sample and the ΔCt value of the calibrator was evaluated.

To understand involvement of NaBC1, shRNA was performed. In brief, target sequence of NaBC1 (SLC4A11), CCCTACATGAAGATGATCTTT, was inserted into the shRNA vector (pLKO.1-puroLentivirus vector, Sigma-Aldrich) and the vector was transfected into the HDP at multiplicities of insertion (MOI) of approximately 5. After transfection of the vector, the effect was confirmed WST-1, ALP activity, ALP staining, and alizarin red S staining. As a negative control, non-target shRNA control transduction was used (Sigma-Aldrich).

Statistical analysis was performed in IBM SPSS 28.0 J for Windows (SPSS Japan, Tokyo, Japan).

We conducted a normality test using the Kolmogorov-Smirnov test, which indicated that the data followed a normal distribution. A Levene test was performed on the WST-1 values, which showed homogeneity of variance. After performing a one-way ANOVA, we carried out Tukey's test. For the ALP activity and real-time PCR, we used a t-test to compare the two groups. Significance was set at p < 0.05.

The HDPs proliferation activity when cultured with different n-BA concentrations was evaluated (Figure 2). For all periods, the 0.1 mM group showed significantly increased activity compared to the control group (p < 0.05). The 0.1 mM group activity was significantly increased compared to the 0.01 and 1.0 mM groups at 5 days, and the 1.0 mM group at 7 days (p < 0.05). Based on the cell proliferation assay results, we employed 0.1 mM n-BA for the present study, because of the most increase at 0.1 mM n-BA concentration in this experiment.

To evaluate the formation of hard tissue by incorporation of n-BA, ALP staining and alizarin red S staining were performed.

ALP staining indicated the stained area spread over time for both the n-BA(−) and n-BA(+) groups (Figure 3A). At 14, 21, and 28 days, both groups stained uniformly. Optical microscopic images showed cytoplasm staining in the spindle-shaped cells (Figure 3B). In ARS staining, the dish images exhibit no definite differences in staining between both groups and time points (Figure 3C). Optical microscopic images also showed no cell staining in both groups, but each showed an improvement in staining over time (Figure 3D).

ALP activity changes were evaluated for HDPs cultured with and without n-BA (Figure 4). ALP activity tended to increase over time for both the n-BA(−) and n-BA(+) groups. The ALP activity of the n-BA(+) group was significantly increased compared to the n-BA(−) group at 14, 21, and 28 days (p < 0.05) (Figure 4).

Expression of hard tissue formation-related genes (GJA1, ALP, and OCN) in HDPs were analyzed, with mRNA expression detected in all groups.

Expression of GJA1 was not different between the n-BA(+) and n-BA(−) groups at 7 days, whereas the expression in the n-BA(+) group was 1.2-fold that of the n-BA(−) group and was significantly higher at 14 and 28 days (p < 0.05) (Figure 5A). ALP expression in the n-BA(+) group was significantly lower than in the n-BA(−) group at 7 days (p < 0.05), while at 14 days it was 1.6-fold significantly higher than in the n-BA(−) group (p < 0.05) (Figure 5B). Expression of OCN was not significantly different between the n-BA(+) and n-BA(−) groups at all time points (Figure 5C).

Expression of NaBC1 in HDPs were analyzed, with mRNA expression detected in all groups.

Expression of NaBC1 in the n-BA(+) group was not different to that in the n-BA(−) group at 21 days, although the expression in the n-BA(+) group at 28 days was significantly increased 1.2-fold (p < 0.05) (Figure 6).

The proliferation of HDPs that NaBC1-shRNA was transfected with 0.1 mM n-BA was evaluated using WST-1 assy. There were no significant differences between NaBC1-shRNA-transfected group and control group at 3, 5 and 7 days (Figure 7A). ALP activity also showed no significant differences between NaBC1-shRNA-transfected group and control group at 7, 14 and 21 days (Figure 7B).

Incorporation of n-BA significantly increased ALP activity in HDPs compared to the control at 14, 21, and 28 days. ALP activity of bone marrow stem cells was significantly increased with low concentrations of boric acid, enhancing osteogenic effects (12, 19). Moreover, human dental pulp stem cells with 20 µg/ml NaB significantly increased ALP activity at 14 days (18). Our results suggest that n-BA promotes ALP production in human dental pulp cells.

We investigated the expression of hard tissue formation-related genes (GJA1, ALP, and OCN) with and without n-BA by real-time PCR in this study. GJA1 encodes a gap junction protein, connexin43 (CX43), with an important role in odontoblastic differentiation (20, 21). ALP is synthesized from early differentiation during hard tissue formation, while OCN is synthesized primarily at the late stage of differentiation in osteoblasts (22). The real-time PCR results showed that n-BA increased the expression of GJA1 and ALP in HDPs, but did not change OCN expression. We previously investigated dental pulp viability by determining ALP activity and CX43 (23–25). ALP is an enzyme expressed in early-stage mineralization, and is a dental pulp cell viability marker. Also, we previously observed higher expressions of CX43 in young odontoblasts in rats and in young dental pulp in humans, suggesting that this reflected dental pulp cell viability (20, 26). Furthermore, dental pulp cells regulate cell proliferation via gap junctions mediated by CX43 (24). Therefore, we believe that this increase in ALP activity and expression of GJA1 and ALP by n-BA incorporation, in this study, indicates increased HDPs viability. On the other hand, studies using dental pulp stem cells or bone marrow stromal cells showed increased expression of ALP and OCN after 7 days with boric acid or NaB (18, 19), but these results do not correspond to the results of this study. The likely reason is that the dental pulp stem cells are mesenchymal stem cells that become differentiated mature cells for hard tissue formation, synthesizing OCN after stimulation. In general, differentiation markers such as ALP and OCN are lower during the proliferative phase. Therefore, the mRNA expression of ALP0 and OCN in n-BA(+) group would downregulate at 7 days. Furthermore, cell staining revealed no significant changes in alizarin red S staining of HDPs with n-BA compared to the control group for up to 28 days. The exact reasons remain unknown, but other factors are required for hard tissue formation after n-BA incorporation in HDPs.

We investigated the expression of NaBC1, a boron transporter, using HDPs in the presence of n-BA. Boron promotes differentiation and hard tissue formation in human osteoblastic cells (12, 13), by activating the Wnt/β-catenin pathway (13, 27). Borax is reported to stimulate NaBC1 in mouse mesenchymal stem cells promoting osteogenesis via the BMP pathway (28). However, there are no previous reports investigating NaBC1 gene expression in dental pulp cells. In this study, real-time PCR results demonstrated higher expression of NaBC1 in HDPs with n-BA at 28 days. We found that n-BA increased ALP activity in HDPs, and our data have shown a decline in proliferation assay and ALP activity in HDPs using NaBC1 shRNA. Although it is not definite whether the boron in n-BA is directly involved in cell proliferation and ALP activity under the conditions of this study, the results imply correlation between NaBC1 and cell proliferation or ALP activity.